RE: removing comments form a file
Title: RE: removing comments form a file [Noud Aldenhoven] #- Hello everyone, #- #- I was wondering how to remove comments away form a file. I remade it: #!/usr/bin/env python import sys import time helptext = "usage: python rmcomment " def rmcomment(oldfilename, newfilename, comment): start = time.time() oldfile = file(oldfilename, 'r') newfile = file(newfilename, 'w') ccount = 0 lcount = 0 for lin in oldfile: pos = lin.find(comment) if pos != -1: lin = lin[:pos] + "\n" ccount += 1 newfile.write(lin) lcount += 1 print "Done... in %.2f seconds\nRemoved comment from %d lines\nWrote %d lines t o %s" % (time.time()-start , ccount, lcount, newfilename) if __name__ == "__main__": if sys.argv[1] == "-h" or sys.argv[1] == "-help": print helptext else: oldfile = sys.argv[1] newfile = sys.argv[2] comment = sys.argv[3] rmcomment(oldfile, newfile, comment) Some issues: - Used <> instead of [] in the help text, as square brackets mean optional arguments. - Eliminated the raw_input, as in these kind of scripts the user *never* expect to have interact input. - Used file instead of open, to don't read the whole file in memory. But the real change is inside the for loop. Testing it: [EMAIL PROTECTED] ~> cat ww Hello Fuckin' World //how are you doing today //I think it delete this sentence and the next sentence too! But this one not! #Even not this comment [EMAIL PROTECTED] ~> python pru.py ww w2 // Done... in 0.00 seconds Removed comment from 2 lines Wrote 7 lines to w2 [EMAIL PROTECTED] ~> cat w2 Hello Fuckin' World But this one not! #Even not this comment [EMAIL PROTECTED] ~> Regards, . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Compiler benefits (was: The Industry choice)
Title: RE: Compiler benefits (was: The Industry choice) [EMAIL PROTECTED] #- I think your point was that the checking present in modern Fortran #- compilers, or PyCheckers, but absent from core Python, is a net #- benefit. That I grant. I'm reluctant to argue for a change in #- Python. I personally prefer to urge PyChecker on developers. Cameron, I agreed 100% percent with you. But I think that PyChecker should be distributed with Python, but in an external module, as everybody has easy access to it. This, added to an official evangelization towards it, should eliminate a big percentage of claims about not-static-Python. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Python evolution: Unease
Title: RE: Python evolution: Unease [Iwan van der Kleyn] #- need: a better standard ide, an integrated db interface with #- a proper #- set of db drivers (!!), a better debugger, a standard widget/windows #- toolkit, something akin to a standard for web programming, better #- documentation, a standard lib which is better organized, a #- formalized #- set of protocols and patterns for program construction. And an #- interpreter which is fast enough to avoid using C or Pyrex in most #- obvious cases. Let's take one by one: - IDE: Better than what? Than IDLE? Than Eclipse? Than SPE? Than Pythonwin? - Integrated DB interface with a proper set of db drivers (what means the "!!"?): What do you mean with an integrated db interface? An standard API to access different DB engines? Something like the Database API specification (http://www.python.org/topics/database/DatabaseAPI-2.0.html)? There's a SIG on DB at http://www.python.org/sigs/db-sig/ you may want to look at. Regarding drivers, to what DB do you miss one? - Debugger: Again, better than what? I use the debugger in IDLE and it's pretty ok. - Standard widget/windows toolkit: More standard than Tk? - Something akin to a standard for web programming: specifically? - Better documentation: Did you find *any* issue in the docs? And why you didn't post a bug on that? - Better organization of the std lib: What do you propose (specifically)? Please, in your proposal, take in consideration migration plans and how the migration affect actual systems. And of course, why the new organization is better than the old one. BTW, I also think that it should be better organized, but don't know how. - a formalized set of protocols and patterns for program construction: a what? - an interpreter which is fast enough to avoid using C or Pyrex in most obvious cases: CPython is More Than Fast Enough. In which obvious cases it's not enough for you? Don't misinterpret this response. I know it was a rambling. But *maybe* you have something to contribute to Python development, even good ideas only and no work. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Python evolution: Unease
Title: RE: Python evolution: Unease [Skip Montanaro] #- This being the Internet and all, it's not clear that #- referencing external #- documentation is somehow worse than incorporating it #- directly into the #- distribution. The problem is Internet access. For example, once I put together a "Python CD" as a present for my father. Inside it put Linux & Windows installers (Python itself and wxWindows (this name then)). And of course, the whole documentation package, in PDF. Of course, I didn't parse the whole docs to see what other documents I could include. And to my father is kinda complicated (and expensive!) access internet and read the docs there. I mean, it's perfectly possible, but would be better IMO to have the docs concentrated. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Python 2.4 on Windows XP
Title: RE: Python 2.4 on Windows XP [DavidHolt] #- I have a problem that I see on two different machines, one running XP #- SP1 and one XP SP 2. #- #- On both I installed Python 2.4. #- #- I can't seem to start IDLE. When I try to start it, I get an IDLE uses sockets to communicate its windows. Check if the integrated firewall in WinXP is not blocking you . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Python evolution: Unease
Title: RE: Python evolution: Unease [John Roth] #- I would like to contribute some documentation to Python. #- I've got the time, I write quite a bit, etc. I've got fairly #- strong opinions about some things that need to be documented, #- (such as all the new style class descriptor stuff from 2.2) #- and I have relatively little difficulty matching the existing style. #- #- However, I don't #- know TEX, Latex, CVS or Sourceforge. (The latter two are #- on my "learn sometime soon so I can put PyFIT where it belongs" #- list.) The easiest way to contribute with documentation is the following: 1. You found something badly documented. 2. You write/correct the docs as you think they should be. 3. Open a bug in SF and attach your text (just plain text if you don't want to produce something more elaborate). Of course, for step 3 you need a SF account: that's only five minutes. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Python evolution: Unease
Title: RE: Python evolution: Unease [Daniel Bowett] #- Contribute to where on Sourceforge??? Which domentation are #- we talking #- about in general? Suppose you're reading Python documentation. Don't know, for example, os.remove(). There you find that a particular parragraph is difficult to understand. You say "Hey, this could be better written", so you write i a more pedagogic way. After that you go to SF, Python project (http://sourceforge.net/projects/python), and go to Bugs. There, if you are logged in SF, you will see a "Submit new" link. You click on it and you'll see a form to fill. Select some fields (specially bug group in "Documentation") and in "Detailed Description:" you put something like "This particular sentence was difficult to read. Attaching a new way to write it". Of course, then attach the file of your text (if it's short enough you can put it directly in that field). Of course, if you write any NEW documentation about something that is not documented at all, or find some more serious issues with the docs (for example, bad argument count in a function) you can follow the same steps. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Python evolution: Unease
Title: RE: Python evolution: Unease [Daniel Bowett] #- Thanks, typically how long does it take for any documentation to be #- considered and implemented? That depends. If you know that some module is supported by someone in particular, you can asign the bug to him, so it should be attended fast. If not, you depend of that bug to be random reviewed. But once the bug is submitted, you're sure that someone somewhen will take a look at it. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: File Handling Problems Python I/O
Title: RE: File Handling Problems Python I/O
[Josh]
#- able to do so without a problem, but here's the catch: The open
#- statement is only working on certain files. I open a simple text file
#- say file1.txt without any issues, but I change the open statement to
#- another text file and it error's out stating the file
#- doesn't exist. I
#- know the code is correct because it worked for the other file. I have
#- tried both binary and ascii modes to no avail. Any idea why this is
#- happening? I am running Python 2.3.4 wxPython 2.5.3.1 and SPE as the
#- IDE on Win2k. Thanks
Could you please post the actual code?
Also, post the result to the following: "os.listdir('.')".
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 5th Meeting, Thursday, January 13th
Title: PyAr - Python Argentina 5th Meeting, Thursday, January 13th The Argentinian Python User Group, PyAr, will have its fifth meeting this Thursday, January 13th at 7:00pm. Please see http://pyar.decode.com.ar/Wiki/ProximaReunion for details (in Spanish.) Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - Planning of our first sprint: we actually have two main subjects: Messages Queues Manager with interfaces for SMTP (e-mail), SMPP (SMS) and MM7 (MMS); and Genetic Algorithms. - Website organization & content - Means of promoting the group's activities, in order to increase our member base. Where - We're meeting at Hip Hop Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 19hs. We will be in the back room, so please ask the barman for us. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Writing huge Sets() to disk
Title: RE: Writing huge Sets() to disk [Martin MOKREJŠ] #- > At least you'll need a disk of 34694 EXABYTES!!! #- #- Hmm, you are right. So 20E15 then? I definitely need to be Right. Now you only need 355 PETABytes. Nowadays disk is cheap, but... #- in range 1-14. ;-) Why? . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Writing huge Sets() to disk
Title: RE: Writing huge Sets() to disk [Martin MOKREJ?] #- I have sets.Set() objects having up to 20E20 items, #- each is composed of up to 20 characters. Keeping Are you really sure?? #- How can I write them efficiently to disk? To be more exact, I think that there's some mistake here. At least you'll need a disk of 34694 EXABYTES!!! . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Writing huge Sets() to disk
Title: RE: Writing huge Sets() to disk [Istvan Albert] #- I think that you need to first understand how dictionaries work. #- The time needed to insert a key is independent of #- the number of values in the dictionary. Are you sure? I think that is true while the hashes don't collide. If you have collisions, time starts to depend of element quantity. But I'm not sure Tim sure can enlighten us. Asking-for-god-word--ly yours, . Facundo Bitcora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La informaciÃn contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener informaciÃn confidencial o propietaria, cuya divulgaciÃn es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no està autorizado a divulgar, copiar, distribuir o retener informaciÃn (o parte de ella) contenida en este mensaje. Por favor notifÃquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnÃtico) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de TelefÃnica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrÃnicos pueden ser alterados, motivo por el cual TelefÃnica Comunicaciones Personales S.A. no aceptarà ninguna obligaciÃn cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Writing huve ge Sets() to disk
Title: RE: Writing huve ge Sets() to disk [Martin MOKREJÅ] #- When importing data from a flatfile into mysql table, there's an #- option to delay indexing to the very last moment, when all keys are #- loaded (it doesn't make sense to re-create index after each new #- row into table is added). I believe it's exactly same waste of cpu/io #- in this case - when I create a dictionary and fill it with data, #- I want to create index afterward, not after every key/value pair #- is recorded. "Premature optimization is the root of all evil.". Use dict as is, profile all your code, start optimizing the slower parts, you'll never get to dicts. . Facundo Bitcora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La informaciÃn contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener informaciÃn confidencial o propietaria, cuya divulgaciÃn es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no està autorizado a divulgar, copiar, distribuir o retener informaciÃn (o parte de ella) contenida en este mensaje. Por favor notifÃquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnÃtico) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de TelefÃnica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrÃnicos pueden ser alterados, motivo por el cual TelefÃnica Comunicaciones Personales S.A. no aceptarà ninguna obligaciÃn cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Game programming in Python
Title: RE: Game programming in Python [Baza] #- I'm looking for any books or on-line resources on game #- programming using #- Python. Does anyone have any advice? Check PyGame: http://www.pygame.org/ . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 5th Meeting, tomorrow Thursday, Decimal t alk included
Title: PyAr - Python Argentina 5th Meeting, tomorrow Thursday, Decimal talk included The Argentinian Python User Group, PyAr, will have its fifth meeting this Thursday, January 13th at 7:00pm. Please see http://pyar.decode.com.ar/Wiki/ProximaReunion for details (in Spanish.) Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - Planning of our first sprint: we actually have two main subjects: Messages Queues Manager with interfaces for SMTP (e-mail), SMPP (SMS) and MM7 (MMS); and Genetic Algorithms. - Website organization & content - Means of promoting the group's activities, in order to increase our member base. There will be also an introduction from me to the Decimal data type that debuted in Python 2.4 (but could be used in 2.3 as well). Where - We're meeting at Hip Hop Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 19hs. We will be in the back room, so please ask the barman for us. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: What strategy for random accession of records in massive FAST A file?
Title: RE: What strategy for random accession of records in massive FASTA file? [Chris Lasher] #- I have a rather large (100+ MB) FASTA file from which I need to #- access records in a random order. The FASTA format is a #- standard format #- for storing molecular biological sequences. Each record contains a #- header line for describing the sequence that begins with a '>' #- (right-angle bracket) followed by lines that contain the actual #- sequence data. Three example FASTA records are below: #- #- >CW127_A01 #- TGCAGTCGAACGAGAACGGTCCTTCGGGATGTCAGCTAAGTGGCGGACGGGTGAGTAATG #- TATAGTTAATCTGCCCTTTAGAGATAACAGTTGGAAACGACTGCTAATAATA #- GCATTAAACAT #- >CW127_A02 #- TGCAGTCGAACGAGAACGGTCCTTCGGGATGTCAGCTAAGTGGCGGACGGGTGAGTAATG #- TATAGTTAATCTGCCCTTTAGAGATAACAGTTGGAAACGACTGCTAATAATA #- GCATTAAACATTCCGCCTAGTACGGTCGCAAGATTCTCAAAGGAATAGACGG #- >CW127_A03 #- TGCAGTCGAACGAGAACGGTCCTTCGGGATGTCAGCTAAGTGGCGGACGGGTGAGTAATG #- TATAGTTAATCTGCCCTTTAGAGATAACAGTTGGAAACGACTGCTAATAATA #- GCATTAAACATTCCGCCTGGG #- ... I think of two ways. If you have enough memory you could load everything in memory, each record as the element of a list, and then access randomly to the list. If you want to keep the memory usage low, you can parse the file once and store in a list the byte position where the record starts and ends. Then access the list randomly and read each record with seek() and read(). . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: How to prevent the script from stopping before it should
Title: RE: How to prevent the script from stopping before it should [EMAIL PROTECTED] #- I have a script that downloads some webpages.The problem is that, #- sometimes, after I download few pages the script hangs( stops). What do you mean with "hangs"? It raises an error and quit? It just stops doing nothing? If the latter, what prints if you hit ctrl-c? . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: bind error!!!!!
Title: RE: bind error! [Perrin Aybara] #- my code was working pretty well until yesterday.suddenly it started #- giving me bind error: address already in use. #- but i have logged out and again logged in, but still the #- problem is not solved #- can somebody give me solution for this Do you really think that somebody could help you with the information that you're giving? You should read this: http://www.catb.org/~esr/faqs/smart-questions.html Regards, . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: RuntimeError: dictionary changed size during iteration
Title: RE: RuntimeError: dictionary changed size during iteration [Robert Brewer] #- > >>> [e for e in vars()] #- > Traceback (most recent call last): #- > File "", line 1, in ? #- > RuntimeError: dictionary changed size during iteration #- > >>> e = None #- > >>> [e for e in vars()] #- > ['e', '__builtins__', 'rlcompleter', '__file__', '_[1]', #- > 'atexit', '__name__', #- > 'readline', '__doc__'] #- #- But not unexpected, since vars() returns a dictionary, and #- binding 'e' #- changes that dictionary while you are iterating over it. Try either: For me, the point is: vars() returns the local variables as a list or is a generator? In the docs don't say nothing about this. If it returns a list, it should NOT raise an error; if it's a generator, the error is fine. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: RuntimeError: dictionary changed size during iteration
Title: RE: RuntimeError: dictionary changed size during iteration [Terry Reedy] #- You must be having a bad day ;-). From Lib Ref 2.1 Built-in Well, that's actually true, :( #- corresponding to the object's symbol table. The returned #- dictionary should #- not be modified: the effects on the corresponding symbol table are #- undefined I actually read that, but didn't understood that it returns THE dictionary (well, that another name binding for the same object was happening). Whatever, I don't get divorced every week, so forgive me. I think that, as it's normal to do... l = list(...) for e in l[:]: l.remove(e) ...insted of... l = list(...) for e in l: l.remove(e) ..., in this case we should do... >>> [e for e in vars().copy()] ['_[1]', 'e', 'v', '__builtins__', '__name__', '__doc__'] . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
Py2.4 .exe installer
Title: Py2.4 .exe installer I'm trying to get everybody at the office to become a Python programmer. The bigger problem I'm facing is that the "official" operating system installed in the PCs is Win NT 4.0, tweaked and restricted, and it's impossible to install the Microsoft package that enables the .msi as a installer. Result: they can not install Py24.msi. There's somewhere a Py24.exe installer? Thanks! Facundo Batista Desarrollo de Red [EMAIL PROTECTED] (54 11) 5130-4643 Cel: 15 5097 5024 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La informaciÃn contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener informaciÃn confidencial o propietaria, cuya divulgaciÃn es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no està autorizado a divulgar, copiar, distribuir o retener informaciÃn (o parte de ella) contenida en este mensaje. Por favor notifÃquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnÃtico) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de TelefÃnica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrÃnicos pueden ser alterados, motivo por el cual TelefÃnica Comunicaciones Personales S.A. no aceptarà ninguna obligaciÃn cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: on the way to find pi!
Title: RE: on the way to find pi!
[Fredrik Lundh]
#- what's the point of that? the math module already contains
#- pi with as many
#- decimals as you can put in a Python float:
#-
#- $ python
#- >>> pi = 3.1415926535897932384
#- >>> pi
#- 3.1415926535897931
#- >>> import math
#- >>> math.pi
#- 3.1415926535897931
#- >>> pi = math.pi
#- True
And if you want to go beyond that, check http://www.python.org/dev/doc/devel/lib/decimal-recipes.html
>>> from decimal import *
>>> getcontext().prec = 60
>>> pi()
Decimal("3.14159265358979323846264338327950288419716939937510582097494")
>>>
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
RE: Help on project, anyone?
Title: RE: Help on project, anyone? [Georg Brandl] #- Does anyone run, or participate in, a project looking for fellow #- programmers? I don't have a special area of interest, well, #- perhaps web #- programming... You can join us in SiGeFi: http://sf.net/projects/sigefi --- SiGeFi is a Financial Management System, with focus in the needs of the administration of the money in each personal life and house. Always keeping the easy usage and concepts, SiGeFi has features of a complex Management system: - Complies with Double Entry Accounting - Has a Budget-based Money Distribution system - Allow to make Loans between accounts (with associated financial costs) --- Any doubt, contact us through sigefi-list or to me personally. Regards, . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Tuple slices
Title: RE: Tuple slices [George Sakkis] #- Why does slicing a tuple returns a new tuple instead of a #- view of the existing one, given that #- tuples are immutable ? I ended up writing a custom #- ImmutableSequence class that does this, but I #- wonder why it is not implemented for tuples. What exactly is "a view of the existing one"? And how do you return it without creating a new object? Could you send an example? Thanks. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: MySQLdb
Title: RE: MySQLdb
[Daniel Bowett]
#- The problem I have is that it takes just over two minuted to
#- execute the
#- 3000 insert statements which seems really slow! I am running it on a
#- machine with a 1.5 Ghz Pentium M Processor and Gig Of Ram. I
#- dont think
#- the machine is to blame for the speed because during execution the
#- processor sits at about 10% and there is loads of free RAM.
#-
#- Does anyone know if this sort of speed sounds right?
Well, I made the following code.
mod_mysql is mine, but is just a wrapper around the standard module. Here I only use the .accion() method of the Consulta object, that let me send an action (query, insert, etc) to the database.
So I generate a temporary table of four fields, and prepared a list of 3000 entries, each one is a tuple of four elements: ten characters choosed randomly.
---
import random, string, time
import mod_mysql
bdd = mod_mysql.Consulta("pytonisa", "fbatista", "password", "otainfo")
bdd.accion("create temporary table tmp.prueba (c1 char(10), c2 char(10), c3 char(10), c4 char(10));")
r = random.Random()
let = string.letters + string.digits
fuente = [tuple([''.join(r.sample(let, 10)) for j in range(4)]) for x in range(3000)]
t = time.time()
for reg in fuente:
bdd.accion('insert into tmp.prueba values ("%s", "%s", "%s", "%s");' % tuple(reg))
print time.time() - t
---
I only measure the time of the inserts. It took 0.269818067551 seconds.
I'm using a Pentium 4 2.8 GHz, 256 MB of RAM, with Fedora Core 2, kernel 2.4.22, python 2.3.3 (GCC 3.3.2), and MySQL 4.0.18.
Regards,
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 10th Meeting, Thursday, August 4th
Title: PyAr - Python Argentina 10th Meeting, Thursday, August 4th The Argentine Python User Group, PyAr, will have its tenth meeting this Thursday, August 4th at 7:00pm. Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - Discuss present and future of the messaging framework Gauchito Gil (http://www.python.com.ar/Wiki/GauchitoGil) - See if we move to other meeting point. - Discuss website function and see if we go for another content manager. Where - We're meeting at Hip Hop Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 19hs. We will be in the back room, so please ask the barman for us. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Big development in the GUI realm
Title: RE: Big development in the GUI realm [Carlos Ribeiro] #- 'onegui' to rule them all... I would really love to use a GUI made by elves... . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: two questions - no common theme
Title: RE: two questions - no common theme [EMAIL PROTECTED] #- Any help will be greatly appreciated. It's always better to address two different questions in two different mails, with appropiate subjects. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: os.walk() usage
Title: RE: os.walk() usage [rbt] #- The problem I'm encountering is passing the list to other functions. #- It's almost as if each function needs to build the list #- itself (walk the #- filesystem)... which gets in the way of what I was asked to #- do (break #- this thing up into modular, maintainable pieces). You should use a class, which has the different functions you told as methods, but those methods share the "self" namespace. So, you could do something like: mw = MyWalk(path) mw.skip_files(...) mw.skip_dirs(...) mw.search() . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Getting milliseconds in Python
Title: RE: Getting milliseconds in Python [mjs7231] #- I am trying to record how long an operation takes, but can't seem to #- find a function that will allow me to record the timestamp in #- milliseconds, maybe I am looking in the wrong place? Use time.time(). >>> import time >>> def f(): t = time.time() [x**2 for x in range(5)] t = time.time() - t print "%.2f msec" % (t*1000) >>> f() 16.00 msec >>> . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Getting milliseconds in Python
Title: RE: Getting milliseconds in Python [Brian Beck] #- seconds * 100 = milliseconds Wht? It really is seconds = 1000 * milliseconds . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: renaming 'references' to functions can give recursive problem s
Title: RE: renaming 'references' to functions can give recursive problems [Fredrik Lundh] #- you're confused. resetting your brain and reading the documentation #- again might help: #- #- http://docs.python.org/ref/objects.html #- http://docs.python.org/ref/naming.html This article will also help him a lot: http://starship.python.net/crew/mwh/hacks/objectthink.html . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
ANNOUNCE: SiGeFi v0.3
Title: ANNOUNCE: SiGeFi v0.3 We're proud to announce the 0.3 version of SiGeFi, which you can find at: http://sourceforge.net/projects/sigefi What is SiGeFi? --- SiGeFi is a Financial Management System, with focus in the needs of the administration of the money in each personal life and house. Always keeping the easy usage and concepts, SiGeFi has features of a complex Management system: - Complies with Double Entry Accounting - Has a Budget-based Money Distribution system - Allow to make Loans between accounts (with associated financial costs) And of course, it's completely written in Python (didn't decided the GUI yet). What is in this version? Functionality change: - Added the LoanChecker, a programmable asynchronous alert that verifies the loans due date. Internal changes: - Ended the docstrings, and generated the classes documentation using epydoc (that soon will be published in the web as part of its content). - Translated all the code texts to English, and did the gettext integration, so now SiGeFi is multilanguage (so far we have English and Spanish only). - Bugfixing. Specified the SiGeFi graphic interface. In the manual-gui.html document we described each window's functionality, and also we added an image for each one, so if you want to have a preview of how the GUI will look, there you have it). See roadmap.txt to find out the milestone for each version. Be aware that most of the documentation is not translated yet, it's only in Spanish. What can I expect for the next version? --- To us to finish the GUI (with all that that implies) and some other improvements: - See if we replace the PersitentDict with a shelve. - Study the consistency controls of Pickle, and implement some if necessary. - Define the boot procedure and code it in config.py. - Set up the web page. How can I help? --- In a thousand ways, there's a lot of things to do: documentation, fixing code, translations, set up the web page, etc... If you want to participate, send us a mail to the list ([EMAIL PROTECTED]) or directly to us. Thank you. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ -- http://mail.python.org/mailman/listinfo/python-list
RE: Decimal, __radd__, and custom numeric types...
Title: RE: Decimal, __radd__, and custom numeric types... [Nick Coghlan] #- >> a) Checking that replacing the relevant "raise TypeError" #- calls in #- >> Lib/Decimal.py with "return NotImplemented" gives you friendlier #- >> behaviour. #- > #- > #- > It turns out this isn't really practical - there's too #- much code in the #- > module relying on those TypeErrors being raised. #- #- ... #- #- Py> x = friendly_decimal.Decimal() #- Py> C() + x #- OK! #- Py> x + C() #- OK! Nick, did you try the test cases with this modification? . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 7th Meeting, this Thursday
Title: PyAr - Python Argentina 7th Meeting, this Thursday The Argentine Python User Group, PyAr, will have its seventh meeting this Thursday, January 10th at 7:00pm. Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - See how the code evolved from the ideas generated in of our first sprint. - Define how we will promote ourselves in PyCon 2005. Where - We're meeting at Hip Hop Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 19hs. We will be in the back room, so please ask the barman for us. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: shuffle the lines of a large file
Title: RE: shuffle the lines of a large file [Joerg Schuster] #- Thanks to all. This thread shows again that Python's best feature is #- comp.lang.python. QOTW! QOTW! . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ -- http://mail.python.org/mailman/listinfo/python-list
RE: Best way to make a list unique?
Title: RE: Best way to make a list unique? [Max M] #- >>> la = [1,2,3,4,3,2,3,4,5] #- >>> from sets import Set #- >>> sa = Set(la) #- >>> for itm in sa: #- ... print itm Remember that in Python 2.4 you have ´´set´´ as a built-in data type: >>> la = [1,2,3,4,3,2,3,4,5] >>> sa = set(la) >>> for it in sa: print it 1 2 3 4 5 . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ -- http://mail.python.org/mailman/listinfo/python-list
RE: Sorting dictionary by 'sub' value
Title: RE: Sorting dictionary by 'sub' value
[Rory Campbell-Lange]
#- I have a dictionary of images. I wish to sort the dictionary 'v' by a
#- dictionary value using python 2.3. The dictionary value is the date
#- attribute as shown here:
You have to use the DSU algorithm (Decorate, Sort, Undecorate), taking in consideration that the final sorted element can not be a dictionary. For example (with a simpler dictionary):
>>> d = {'a': ('m', 5), 'b': ('k', 9), 'c': ('f', 2)}
I want the dictionary values sorted by the number inside the tuple. So I prepare a list with that number first, and the dictionary key in second place:
>>> temp_list = [ (x[1][1], x[0]) for x in d.items() ]
Then, just sort it and use it.
>>> temp_list.sort()
>>> for (tmp, key) in temp_list:
print d[key]
('f', 2)
('m', 5)
('k', 9)
>>>
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
RE: Recognizing the Arrival of a New File
Title: RE: Recognizing the Arrival of a New File [Greg Lindstrom] #- I am writing an application where I need to recognize when a file #- arrives in a given directory. Files may arrive at any time #- during the #- course of the day. Do I set up a cron job to poll the #- directory every #- few minutes? Write a daemon to monitor the directory? Or #- is there some #- other more common/accepted way to perform this task? I'm #- using Python #- 2.3 on Linux. You can check the date info of the directory: [EMAIL PROTECTED] ~> ll -d gsm drwxr-xr-x 3 fbatista root 4096 feb 25 2004 gsm [EMAIL PROTECTED] ~> cd gsm [EMAIL PROTECTED] ~/gsm> touch w [EMAIL PROTECTED] ~/gsm> cd .. [EMAIL PROTECTED] ~> ll -d gsm drwxr-xr-x 3 fbatista root 4096 mar 8 12:15 gsm Regards, . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: running programs from within python
Title: RE: running programs from within python [M.N.A.Smadi] #- i guess i will answer myself: #- import os #- os.system(string) If you have Py2.4, it's better to use subprocess(). . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ -- http://mail.python.org/mailman/listinfo/python-list
RE: running programs from within python
Title: RE: running programs from within python [M.N.A.Smadi] #- am getting an error in the script as follows: #- #- NameError: global name 'os' is not defined What script? Please paste it here. If it's more than 20 lines, trim it until you find the smaller script that has the error. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Forums based on python
Title: RE: Forums based on python [EMAIL PROTECTED] #- HI #- I AM NEW TO PROGRAMING PRESENTLY I AM USING WINDOWS ME AND WHAT I SAW IN PYTHON INTEREST ME ANN AWFUL LOT. I DOWNLOADED VERSION 2.4 AND I #- TRIED TO GET MY PROGRAM "HELLO WORLD" ETC I SAVED ALL PROGRAMS BUT WHEN I WANT TO RUN IT I CAN'T FIND UNDER EDIT=RUN SCRIPT = WHERE CAN I #- GO TO RUN MY BEGINNING PROGRAMS. DID I DOWNLOAD THE WRONG VERSION #- THANK YOU FOR ANY HELP #- EDWARD A message like... """ Hi, I'm new to programming. Presently I'm using Windows ME and what I saw in Python interest me a lot. I downloaded the version 2.4, and I tried to get my program "Hello world", etc... I saved all programs but when I want to run it I can't find under "Edit"/"Run script". Where can I go to run my beginning programs? Did I download the wrong version? Thank you for any help Edward """ will bring you more help. Note that I'm not considering the actual sense of your words, just the format. Regards, . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: running programs from within python
Title: RE: running programs from within python [James Stroud] #- import os He says he did it: #- > > M.N.A.Smadi wrote: #- > >> (and yes i am importing the os module) But he still didn't paste the code here . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Will presentations at PyCon be recorded/streamed?
Title: RE: Will presentations at PyCon be recorded/streamed? [Grig Gheorghiu] #- Is there an official procedure for signing up for presenting a #- Lightning Talk, except for editing the PyCon05 Wiki page? Don't know. I just edited it today and a mail was generated automatically to some people... . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Why tuple with one item is no tuple
Title: RE: Why tuple with one item is no tuple
[Gregor Horvath]
#- >>>type(('1'))
#-
#-
#- I wonder why ('1') is no tuple
The parentheses don't create the tuple, the comma does:
>>> ('1')
'1'
>>> ('1',)
('1',)
>>> '1',
('1',)
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
--
http://mail.python.org/mailman/listinfo/python-list
RE: 2.4 or 2.3.4 for 2.3 software?
Title: RE: 2.4 or 2.3.4 for 2.3 software? [Jens Bloch Helmers] #- Can we expect the current release of 2.4 to be just as reliable as #- 2.3.4 for 2.3 compliant software? Actually, you can expect to be more reliable, a lot of bugs were fixed. . Facundo -- http://mail.python.org/mailman/listinfo/python-list
RE: How did you learn Python?
Title: RE: How did you learn Python? [Shawn Milo] #- I was just wondering what the best books were for learning Python. #- #- Which books are good for getting started, and which should #- be saved for #- later, or or not useful except as a reference for the learned? My particular process did not involve any printed book. It was something like this: - GvR and FL intro tutorial (don't matter how much you know about languages, just read it). - General overview of standard library - Language reference - Dive into Python Of course, program as much as you can in the whole process. And always read other's code. . Facundo -- http://mail.python.org/mailman/listinfo/python-list
RE: Need help on program!!!
Title: RE: Need help on program!!! [Darth Haggis] #- I need help writing a program #- #- You are to write a python program to accomplish the following: Actually, your homework is *your* homework. Regards, . Facundo -- http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 4th Meeting, Thursday, December 9th
Title: PyAr - Python Argentina 4th Meeting, Thursday, December 9th The Argentinian Python User Group, PyAr, will have its next meeting this Thursday, December 9th at 8.30pm. Please see http://pyar.decode.com.ar/Members/pziliani/event.diciembre for details (in Spanish.) Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - Website organization & content - Means of promoting the group's activities, in order to increase our member base. - Planning of our first sprint. Where - We're meeting at Hip Hop Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 8.30pm. We use to get together early, but this month the starting time has been postponed for reasons beyond our control. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo -- http://mail.python.org/mailman/listinfo/python-list
RE: results of division
Title: RE: results of division [Paul McGuire] #- Errr? How come round() is able to understand 1.775 #- correctly, whereas #- string interp is not? I'm guessing that round() adds some #- small epsilon to #- the value to be rounded, or perhaps even does the brute #- force rounding I #- learned in FORTRAN back in the 70's: add 0.5 and truncate. #- But this would #- still truncate 1.77999 to two places, so this theory #- fails also. What #- magic is round() doing, and should this same be done in the #- string interp #- code? This is a great example of "how to get your life easier" for my paper on Decimal. I will use it, if you don't mind. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: A problem with list
Title: RE: A problem with list [EMAIL PROTECTED] #- where my MyFile.txt looks like this: #- ['abc','def'] The issue is that in the file you don't have a list, you have text, and there is the difference in the behaviour. >>> l = ['abc','def'] >>> for x in l: print x abc def >>> s = "['abc','def']" >>> for x in s: print x [ ' a b c ' , ' d e f ' ] >>> . Facundo -- http://mail.python.org/mailman/listinfo/python-list
RE: A completely silly question
Title: RE: A completely silly question [Amir Dekel] #- What about user input in Python? (like stdin) #- Where can I find it? I can't find any references to it in #- the documentation. sys.stdin http://docs.python.org/lib/module-sys.html . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: [Newby] question about modules
Title: RE: [Newby] question about modules [Jon] #- gives me the following error: NameError: name 'capwords' is #- not defined #- #- As far as I can tell from the online docs, "capwords" should #- be defined in #- the built-in "regex" module. Why is it telling me that #- capwords is not #- defined? So you have to call it "regex.capwords". It's a namespace issue, the function is defined inside the module, so you have to explicitly write it. Considering the question, I think you would make a good use of the tutorial: http://docs.python.org/tut/tut.html . Facundo -- http://mail.python.org/mailman/listinfo/python-list
RE: Python IDE
Title: RE: Python IDE [Chris] #- -chuckle- Hopefully I don't start off a full fledged war.-grin- Too late, :p #- Why didn't you like Eclipse? Was it that the Python modules #- were bad, #- or just Eclipse in general? I use it for my Java developement and #- haven't had any problems with it. I use Eclipse to code in Python when working in a project that has more than 20 modules because all its features (CVS integration, etc.). But for edit one file, I normally use gedit or vim. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: A rational proposal
Title: RE: A rational proposal
[Mike Meyer]
#- Good point. Currently, objects now how to convert themselves to int,
#- float and complex. Should Rational now how to convert itself to
#- Decimal (and conversely, decimal now how to convert itself to
#- Rational)?
To convert a Decimal to Rational, just take the number and divide it by 1E+n:
Decimal(5) -> Rational(5)
Decimal("5.35") -> Rational(535, 100)
To convert a Rational to a Decimal, it would be a good idea to have a method that converts the Rational to a Decimal string...
Rational(5).tostring(6) -> "5.0"
Rational(4, 5).tostring(3) -> "0.80"
Rational(5321351343, 2247313131).tostring(5000) -> whatever
... and then take that string as input to Decimal and it will work.
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
RE: list Integer indexing dies??
Title: RE: list Integer indexing dies?? [Ishwor] #- Now why doesnt this list which holds integer seem to work?? #- #- >>> l = [1,2,3] #- >>> l[0] #- 1 #- >>> l[0][0] #- #- Traceback (most recent call last): #- File "", line 1, in -toplevel- #- l[0][0] #- TypeError: unsubscriptable object #- >>> l[0] #- 1 #- >>> 1[0] #- #- Traceback (most recent call last): #- File "", line 1, in -toplevel- #- 1[0] #- TypeError: unsubscriptable object #- >>> Well, because the integer is not a subscriptable object IOW, the string is a sequence of characters, and the integer is not sequence at all. >>> 'a'[0] 'a' >>> 'ab'[0] 'a' >>> 'ab'[1] 'b' What behaviour did you expect when subscripting an integer? . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: list Integer indexing dies??
Title: RE: list Integer indexing dies?? [Ishwor] #- >>> 'invalid'[0] #- 'i' #- >>> 123232[-1] #- # Python should automagically infer here that user #- # means indexing and *not* the number per se. #- # (i mean list in context of the line :-) ) Python never should automagically infer nothing! Type "import this" in the interactive interpreter and look at rule #2. #- > IOW, the string is a sequence of characters, and the #- integer is not sequence #- > at all. #- > #- #- strings are immutable sequence of collections in Python. Integers are #- numbers. ;-) Nop. Strings are not a sequence of collections, just a sequence of characters. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: list Integer indexing dies??
Title: RE: list Integer indexing dies?? [Ishwor] #- > What should 035[0] cough up? Be carefull it should #- #- >>>035[0] #- 3 # my own opinion. #- #- > cough up the same as 29[0]. #- #- >>>29[0] #- 2 #again my own opinion Be aware that: >>> 035 == 29 True >>> . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: list IndexError
Title: RE: list IndexError [Steven Bethard] #- True, true. Maybe you could lobby for copy as a builtin in #- Python 3000? That's a good idea to me. But copy() as a builtin is not clear if it's shallow or deep. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: feature suggestion
Title: RE: feature suggestion [flexibal] #- we do make #- typos... and it's very disturbing to find your program crashing after #- two weeks of operation, over a NameError... because a #- certain branch in #- your code, that was previously never taken, had finally been taken. #- #- i've written several large-scale projects in python by #- now... i find it #- excellent for automated testing and other infrastructural #- needs... but #- mistyped variable-, function-, class-, and module- names been a PITA #- for me ever since i've started to use python. All the paths in your code should be tested by unittest *before* putting he software in production. Actually, they should be tested *before* writing the code itself. I'm a big -1 on including static definitions to prevent errors. The only advantage I see to them is to speed enhancements (a la Pyrex). . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: FutureWarning
Title: RE: FutureWarning [Egor Bolonev] #- = #- C:\Documents and Settings\+уюЁ\My #- Documents\Scripts\octopus_eye\1\oct_eye_db.py: #- 213: FutureWarning: hex()/oct() of negative int will return #- a signed #- string in P #- ython 2.4 and up #- if hex(binascii.crc32(data))[0] == '-': #- = #- hex() will return numbers like -0xa1? Python 2.4 (#60, Nov 30 2004, 11:49:19) [MSC v.1310 32 bit (Intel)] on win32 ... >>> hex(-3) '-0x3' >>> . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: A Revised Rational Proposal
Title: RE: A Revised Rational Proposal
[Mike Meyer]
#- When combined with a floating type - either complex or float - or a
#- decimal type, the result will be a TypeError. The reason for this is
#- that floating point numbers - including complex - and decimals are
#- already imprecise. To convert them to rational would give an
I'm ok with raising TypeError when mixing with float.
Bu tI think that it should interact with decimal, as decimal is not imprecise: you can go Decimal->Rational and viceversa without losing information.
As I posted in a previous message:
To convert a Decimal to Rational, just take the number and divide it by 1E+n:
Decimal(5) -> Rational(5)
Decimal("5.35") -> Rational(535, 100)
To convert a Rational to a Decimal, it would be a good idea to have a method that converts the Rational to a Decimal string...
Rational(5).tostring(6) -> "5.0"
Rational(4, 5).tostring(3) -> "0.80"
Rational(5321351343, 2247313131).tostring(5000) -> whatever
... and then take that string as input to Decimal and it will work.
#- - Should raising a rational to a non-integer rational
#- silently produce
#- a float, or raise an InvalidOperation exception?
I think that it never should decay into float silently.
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
RE: A Revised Rational Proposal
Title: RE: A Revised Rational Proposal [Dan Bishop] #- I disagree with raising a TypeError here. If, in mixed-type #- expressions, we treat ints as a special case of rationals, it's #- inconsistent for rationals to raise TypeErrors in situations #- where int #- doesn't. I think it never should interact with float. Rational is being precise by nature, and it should be made explicit when losing information (by the user, using float() to the Rational or str() or repr() to the float). . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: A Revised Rational Proposal
Title: RE: A Revised Rational Proposal
[Dan Bishop]
#- * Binary operators with one Rational operand and one float or Decimal
#- operand will not raise a TypeError, but return a float or Decimal.
I think this is a mistake. Rational should never interact with float.
#- * Expressions of the form Decimal op Rational do not work. This is a
#- bug in the decimal module.
Can you tell me where? (or submit a bug in SF). Thanks.
#- * The constructor only accepts ints and longs. Conversions
#- from float
#- or Decimal to Rational can be made with the static methods:
#- - fromExactFloat: exact conversion from float to Rational
What ExactFloat means to you? For example, what should Rational.fromExactFloat(1.1) should return?
And we starting here the same long discussion that lead decimal to not be created from float because it never would be clear what it will do.
#- - fromExactDecimal: exact conversion from Decimal to Rational
Rational already is created from strings like "2.33", so use str() over the Decimal, not a special method:
>>> import decimal
>>> decimal.Decimal("3.44")
Decimal("3.44")
>>> str(decimal.Decimal("3.44"))
'3.44'
>>> import rational
>>> rational.Rational(str(decimal.Decimal("3.44")))
Rational("344 / 100")
>>>
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
RE: A Revised Rational Proposal
Title: RE: A Revised Rational Proposal
[Mike Meyer]
#- I don't think so, as I don't see it coming up often enough to warrant
#- implementing. However, Rational("x" / "y") will be an acceptable
#- string format as fallout from accepting floating point string
#- representations.
Remember that repr() should comply with eval() to assure that x == eval(repr(x)).
'Rational("x" / "y")' won't comply it, as eval will raise "TypeError: unsupported operand type(s) for /: 'str' and 'str'".
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
RE: Tutorial problem
Title: RE: Tutorial problem
[Rÿe9veillÿe9]
#- The problem is that it doesnt print the
#-
#- [ choice = input ('Pick a number:') ]
#-
#- command. It just runs thru the whole thing without
#- allowing the user a selection.
Are you sure? It should raise a NameErrorin the while, because the name 'choice' is not defined before.
. Facundo
Bitácora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje.
Muchas Gracias.
--
http://mail.python.org/mailman/listinfo/python-list
RE: Other notes
Title: RE: Other notes [EMAIL PROTECTED] #- Here are some questions and suggestions of mine that I've #- collected in #- the last weeks on the language (please note that some (most?) of them #- are probably wrong/useless/silly, but I've seen that such #- notes help me #- understand a lot of things and to find my weak spots.) It's a *very* good idea to address each subject in a different thread. Personally, maybe there's a point that interest me and where I can participate, but i don't have time to go through the rest of the mails. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
RE: Securing a future for anonymous functions in Python
Title: RE: Securing a future for anonymous functions in Python [Nick Coghlan] #- I just don't understand why people complain so much about #- the restriction to a #- single _expression_ in lambdas, yet there is nary a peep about #- the same #- restriction for generator expressions and list comprehensions. What *I* don't understand (and it could perfectly be plain ignorance, as never studied languages or computer sciences) is why anonymous functions are so important. While I'm one of those who spend 30% of the time writing the function and 70% choosing a name for it, I never really use lambdas (except for minor cases in Tkinter buttons). hoping-to-learn-something-new-in-the-next-mail--ly yours, . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 8th Meeting, this Thursday
Title: PyAr - Python Argentina 8th Meeting, this Thursday The Argentine Python User Group, PyAr, will have its eighth meeting this Thursday, January 10th at 7:00pm. Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - Conclusions of PyAr in PyCon 2005. - See what we'll do with the t-shirts, and how we'll export them. - Analyze a future meeting point. Where - We're meeting at Hip Hop Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 19hs. We will be in the back room, so please ask the barman for us. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo -- http://mail.python.org/mailman/listinfo/python-list
ANNOUNCE: SiGeFi v0.3.1
Title: ANNOUNCE: SiGeFi v0.3.1 We're proud to announce the 0.3.1 version of SiGeFi, which you can find at: http://sourceforge.net/projects/sigefi What is SiGeFi? --- SiGeFi is a Financial Management System, with focus in the needs of the administration of the money in each personal life and house. Always keeping the easy usage and concepts, SiGeFi has features of a complex Management system: - Complies with Double Entry Accounting - Has a Budget-based Money Distribution system - Allow to make Loans between accounts (with associated financial costs) And of course, it's completely written in Python (didn't decided the GUI yet). What is in this version? GUI: - Main window, with the full menu structure. - Opening of a database and accounts' tree loading. Internal changes: - Specified the start-up procedure. - Implemented consistency controls in the Persistence layer. - Bugfixing (mainly with exchange rates constraints). Created a "demo" application that shows how to work with the core by hand, useful as documentation, and allows to create datasets for GUI testing. See roadmap.txt to find out the milestone for each version, and TODO.txt for more detail. Be aware that most of the documentation is not translated yet, it's only in Spanish. What can I expect for the next version? --- More work in the GUI: - Finish the main windows, the interaction core of the program. - Add shortcuts. - Integrate a toolbar. How can I help? --- In a thousand ways, there's a lot of things to do: documentation, fixing code, translations, set up the web page, etc... If you want to participate, send us a mail to the list ([EMAIL PROTECTED]) or directly to us. Thank you. . Facundo Bitácora De Vuelo: http://www.taniquetil.com.ar/plog PyAr - Python Argentina: http://pyar.decode.com.ar/ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 8th Meeting, today
Title: PyAr - Python Argentina 8th Meeting, today The Argentine Python User Group, PyAr, will have its eighth meeting today at 7:00pm. Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - Conclusions of PyAr in PyCon 2005. - See what we'll do with the t-shirts, and how we'll export them. - Analyze a future meeting point. Where - We're meeting at Hip Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 19hs. We will be in the back room, so please ask the barman for us. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo -- http://mail.python.org/mailman/listinfo/python-list
PyAr - Python Argentina 9th Meeting, this Thursday
Title: PyAr - Python Argentina 9th Meeting, this Thursday The Argentine Python User Group, PyAr, will have its nineth meeting this Thursday, May 12nd at 7:00pm. Agenda -- Despite our agenda tends to be rather open, this time we would like to cover these topics: - See what we'll do with the t-shirts, and other "merchandising". - Analyze a future meeting point. Where - We're meeting at Hip Bar, Hipólito Yirigoyen 640, Ciudad de Buenos Aires, starting at 19hs. We will be in the back room, so please ask the barman for us. About PyAr -- For more information on PyAr see http://pyar.decode.com.ar (in Spanish), or join our mailing list (Also in Spanish. For instructions see http://pyar.decode.com.ar/Members/ltorre/listademail) We meet on the second Thursday of every month. . Facundo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ADVERTENCIA. La información contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener información confidencial o propietaria, cuya divulgación es sancionada por la ley. Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no está autorizado a divulgar, copiar, distribuir o retener información (o parte de ella) contenida en este mensaje. Por favor notifíquenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magnético) que pueda haber realizado del mismo. Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telefónica Comunicaciones Personales S.A. o alguna empresa asociada. Los mensajes electrónicos pueden ser alterados, motivo por el cual Telefónica Comunicaciones Personales S.A. no aceptará ninguna obligación cualquiera sea el resultante de este mensaje. Muchas Gracias. -- http://mail.python.org/mailman/listinfo/python-list
