Re: Welch essential for learning Tkinter well?

In article <[EMAIL PROTECTED]>, Kevin Walzer <[EMAIL PROTECTED]> wrote: > James Stroud wrote: > >This begs the > > question, is anyone truly an expert in Tkinter? > > Frederick Lundh is, if anyone is. > > http://www.pythonware.com/library/tkinter/introduction/index.htm (outdated) > http://effb

Crypto Suggestion/Help

Hi all, I need some advise on doing the following. I have a Linux application that allows users to access it via a code (password). At the end of the day, I gather a log of activities of the users and zip the file and would like to encrypt it so that the users can not access it or tamper with it.

Re: Crypto Suggestion/Help

Paul, Thanks for the reply. Yes the shop has only one machine and many users use it to perform transactions. Maybe a basic Linux/Unix permissions will do as Thomas Kruger suggested in the thread following you. --Jimmy Paul Rubin wrote: > Jimmy E Touma <[EMAIL PROTECTED]> writes: >&

Re: is laziness a programer's virtue?

"Xah Lee" <[EMAIL PROTECTED]> writes: > • Please remind yourself what is on-topic and off-topic. Unless you You, Sir, ARE off-topic. I suggest you make the experiment to post your drivel on your web site and let your fans come to you. Should be an eye opener, this experiment. Regards -- Markus

Re: is laziness a programer's virtue?

Ingo Menger <[EMAIL PROTECTED]> writes: > On 16 Apr., 23:01, "Xah Lee" <[EMAIL PROTECTED]> wrote: > >> If your article is relevant to X, Y, and Z, >> please cross post it. > > Yeah right, and if it is not, don't post it at all. Your articles are > nothing but a bunch of unfounded allegations, mor

Re: Build Python 2.5 against Tk 8.5

In article <[EMAIL PROTECTED]>, Kevin Walzer <[EMAIL PROTECTED]> wrote: > Martin v. Löwis wrote: > >> I'd like to experiment with Tk 8.5 (now in beta) in my Python > >> application, but Python 2.5 requires Tk 8.4.x. > > > > Why do you say that? AFAIK, that's not the case. > > It's been a while,

Re: Newbie - converting csv files to arrays in NumPy - Matlab vs. Numpy comparison

oyekomova wrote: > Thanks for your help. I compared the following code in NumPy with the > csvread in Matlab for a very large csv file. Matlab read the file in > 577 seconds. On the other hand, this code below kept running for over 2 > hours. Can this program be made more efficient? FYI - The csv f

Re: Newbie - converting csv files to arrays in NumPy - Matlab vs. Numpy comparison

oyekomova wrote: > Thanks for your help. I compared the following code in NumPy with the > csvread in Matlab for a very large csv file. Matlab read the file in > 577 seconds. On the other hand, this code below kept running for over 2 > hours. Can this program be made more efficient? FYI - The csv f

Re: Newbie - converting csv files to arrays in NumPy - Matlab vs. Numpy comparison

oyekomova wrote: > Thanks to everyone for their excellent suggestions. I was able to > acheive the following results with all your suggestions. However, I am > unable to cross file size of 6 million rows. I would appreciate any > helpful suggestions on avoiding memory errors. None of the solutions

Re: numpy or _numpy or Numeric?

eric 3) You get it by either installing a pre-built package for your system or by a) downloading the source tar-file from http://sourceforge.net/project/showfiles.php?group_id=1369&package_id=175103 (get the numpy-.tar.gz file b) tar zxvf numpy-.tar.gz c) cd numpy- d) su

Re: numpy or _numpy or Numeric?

auditory wrote: >>> While trying to install numpy accroding to its homepage. >>> (http://numpy.scipy.org/numpydoc/numdoc.htm). >>> i am quite confused. >> You are reading old documentation for Numeric and so any installation >> description is how to install the Numeric module (not its newer >> re

Debug Build of Python

Hi all, Just curious how to get an "all bells and whistles" debug build of python. In the source for 2.4.3, I see the following debug related options: >From README: (1) e.g. "make OPT=-g" will build a debugging version of Python on most platforms (2) Additional debugging code to help debug memo

Re: Using python as primary language

In article <[EMAIL PROTECTED]>, Michel Albert <[EMAIL PROTECTED]> wrote: > In our company we are looking for one language to be used as default > language. So far Python looks like a good choice (slacking behind > Java). A few requirements that the language should be able cope with > are: > > *

Re: Printing user input?

On Thu, 2007-11-15 at 09:03 -0800, Mohammed_M wrote: > Hi, > I'm v.new to Python, so please don't be too harsh :) > I get a NameError with the code below - All I want to do is store some > input taken from the user in a variable called name, & then print name > > # START CODE

Re: segmentation fault in scipy?

[EMAIL PROTECTED] wrote: > I'm running operations large arrays of floats, approx 25,000 x 80. > Python (scipy) does not seem to come close to using 4GB of wired mem, > but segments at around a gig. Everything works fine on smaller batches > of data around 10,000 x 80 and uses a max of ~600mb of mem

ANN: NumPy 0.9.8 released

NumPy 0.9.8 has been released. It can be downloaded from http://numeric.scipy.org The release notes are attached. Best regards, -Travis Oliphant NumPy 0.9.8 is a bug-fix and optimization release with a few new features. The C-API was changed so that extensions compiled against

Re: PEP 3102 for review and comment

In article <[EMAIL PROTECTED]>, "Talin" <[EMAIL PROTECTED]> wrote: > (Note: PEPs in the 3xxx number range are intended for Python 3000, > however this particular PEP may be backported if there is support for > it.) > > PEP: 3102 > Title: Keyword-Only Arguments ... > Syntactically, the propos

Re: PEP-xxx: Unification of for statement and list-comp syntax

+1 It does seem like a natural unificiation of the language -- one less exception to learn. -- Russell -- http://mail.python.org/mailman/listinfo/python-list

Re: Scipy: vectorized function does not take scalars as arguments

ago wrote: > Once I vectorize a function it does not acccept scalars anymore. Es > > def f(x): return x*2 > vf = vectorize(f) > print vf(2) > > AttributeError: 'int' object has no attribute 'astype' > > Is this the intended behaviour? > Vectorize handles scalars in recent versions of NumPy. W

Re: Looking for triangulator/interpolator

Grant Edwards wrote: > I need to interpolate an irregularly spaced set of sampled > points: Given a set of x,y,z points, I need to interpolate z > values for a much finer x,y grid. How many x,y,z points do you have? Did you try the fitpack function bisplrep in scipy? It can work well as long as

Re: Looking for triangulator/interpolator

Grant Edwards wrote: > On 2006-05-27, Travis E. Oliphant <[EMAIL PROTECTED]> wrote: > >>> I need to interpolate an irregularly spaced set of sampled >>> points: Given a set of x,y,z points, I need to interpolate z >>> values for a much finer x,y gri

Re: matplotlib and numpy installation

cesco wrote: > Hi, > > I wanted to install python, numpy and matplotlib on Linux Ubuntu. > I installed python with the following commands > ./configure --enable-unicode=ucs4 > [snip] > running build_ext > building 'matplotlib.backends._ns_backend_agg' extension > gcc options: '-pthread -fno-strict

Re: Looking for triangulator/interpolator

Grant Edwards wrote: > On 2006-05-27, Travis E. Oliphant <[EMAIL PROTECTED]> wrote: > >> Not that you made a bad choice. I do wonder, how much of your >> difficulty was with the interface to the underlying fitpack >> routines. > > I've no idea. I ha

Re: When is min(a, b) != min(b, a)?

In article <[EMAIL PROTECTED]>, Christian Heimes <[EMAIL PROTECTED]> wrote: > Grant Edwards wrote: > > In many applications (e.g. process control) propogating NaN > > values are way too useful to avoid. Avoiding NaN would make a > > lot of code far more complicated than would using them. > > Na

Re: Problem with Tkinter scrollbar callback

In article <[EMAIL PROTECTED]>, "Ivan Van Laningham" <[EMAIL PROTECTED]> wrote: > Hi All-- > I'm having two problems with the scrollbar callback on linux systems > (Fedora 7, Suse 10.1,2 and 3 all exhibit the issues). > > Problem one: on Windows, the callback is called with the arguments as > s

Re: looking for a light weighted library/tool to write simple GUI above the text based application

[EMAIL PROTECTED] wrote: >>> is already solved). >> what you are looking for is curse :) >> http://docs.python.org/lib/module-curses.html >> http://www.ibm.com/developerworks/linux/library/l-python6.html >> >> renaud > > Renaud, thanks for your reply. > > I think I was not specific/clear enough i

Re: Problem with Tkinter scrollbar callback

In article <[EMAIL PROTECTED]>, "Ivan Van Laningham" <[EMAIL PROTECTED]> wrote: > Hi All-- > That helps. Doing a get() on the scrollbar before a set(0.0,0.0) > returns a 4-tuple: (0.0, 0.0, 0.0, 0.0) ! I did the set(0.0,0.0) > and now the callback gets the correct number of arguments. > > Ho

Re: Tkinter equiv for setPalette

In article <[EMAIL PROTECTED]>, Helmut Jarausch <[EMAIL PROTECTED]> wrote: > Hi, > > I am to convert an old Perl-Tk script to Python. > It starts by > my $MW= new MainWindow; > $MW->setPalette(background => 'AntiqueWhite1', foreground => 'blue'); > > Is there an equivalent for Tkinter? How can

Re: pyinstall and matplotlib

In article <[EMAIL PROTECTED]>, John Henry <[EMAIL PROTECTED]> wrote: > On Feb 9, 2:53 pm, John Henry <[EMAIL PROTECTED]> wrote: > > Has anybody been able to create an exe of their python applications > > involving matplotlib using pyinstall (ver 1.3)? I am getting a: > > > > RuntimeError:

Re: Truncated postings

In article <[EMAIL PROTECTED]>, [EMAIL PROTECTED] wrote: > Hello, Over the past 24 hours or so, all of my Python-List e-mails have been > truncated to subject list only. No posts. Are others experiencing this > problem? Or is it just on my end? Thanks, Lloyd R. Prentice

Re: Tkinter: Missing the last piece of the puzzle

In article <[EMAIL PROTECTED]>, [EMAIL PROTECTED] wrote: > Simon Forman wrote: > > yes! check out > > http://aspn.activestate.com/ASPN/Cookbook/Python/Recipe/464635 > > > > HTH, > > ~Simon > > Thanks, Simon. Looks like that will do it. > > Actually, it looks like that will overdo it. I'll be

RE: Do any of you recommend Python as a first programming language?

I vote a strong yes! I went through a MIS major and learned java first. This was a disaster for me typing these long nonsense lines (I didn't understand how classes and their members worked). Next was C and we had to use a command line and notepad to do all our programs. I really didn't learn much

Re: RELEASED Python 2.6.2

Thank you for 2.6.2. I see the Mac binary installer isn't out yet (at least it is not listed on the downloads page). Any chance that it will be compatible with 3rd party Tcl/Tk? Most recent releases have not been; the only way I know to make a compatible build is to build the installer on a ma

Re: [Python-Dev] RELEASED Python 2.6.2

In article , Ned Deily wrote: > In article , > Russell Owen wrote: > > I installed the Mac binary on my Intel 10.5.6 system and it works, > > except it still uses Apple's system Tcl/Tk 8.4.7 instead of my > > ActiveState 8.4.19 (which is in /Library/Frameworks where one would > > expect)

Re: Pass data from Python to C++

In article <[EMAIL PROTECTED]>, brad <[EMAIL PROTECTED]> wrote: > I have some c++ binaries that do rather intense number computations. > They do it well and rather quickly compared to other languages (not just > Python). ... > > However, other components can be written in a more user friendly,

Re: Brand New!

k that's wonderful! > > I think problem solving language independent. As long as you can break down > what you need to do and conceptualize. You must have learned to do with with > botany, so programming came natural :) > > -- > Nick Stinemates ([EMAIL PROTECTED])http://ni

Re: like py2exe, but on a mac

In article <[EMAIL PROTECTED]>, William McBrine <[EMAIL PROTECTED]> wrote: > On Sun, 13 Jul 2008 00:58:59 +0200, Python.Arno wrote: > > > http://undefined.org/python/py2app.html > > py2app bundles Python itself into the app, right? I wonder, is there no > way to create an app bundle that relie

Re: like py2exe, but on a mac

In article <[EMAIL PROTECTED]>, Tommy Nordgren <[EMAIL PROTECTED]> wrote: > On 28 jul 2008, at 03.59, William McBrine wrote: > > > On Sun, 13 Jul 2008 00:58:59 +0200, Python.Arno wrote: > > > >> http://undefined.org/python/py2app.html > > > > py2app bundles Python itself into the app, right? I w

Could someone please review patch 799428: fix Tkinter tk_focusNext?

Patch is a trivial (one word) fix to a long-standing issue with Tkinter: calls to the widget method tk_focusNext() fail with "unsubscriptable object" error. Admittedly we've lived a long time with this bug. But the fix is so simple and so obviously safe that

Can't seem to build python against custom tcl/tk

I'm trying to build a non-framework python on MacOS X 10.5 using a custom tcl/tk that lives in an arbitrary directory. (For complicated reasons we don't want the system tcl/tk). It is easy to build an X11 tcl/tk this way (and we are content with X11) so I did that. Unfortunately I can't seem to

Re: ActiveState Python v2.5 doesn't come with Tkinter or Tk installed.

In article <[EMAIL PROTECTED]>, "Dudeja, Rajat" <[EMAIL PROTECTED]> wrote: > Hi, > > So, now I've finally started using Eclipse and PyDev as an IDE for my > GUI Application. I just wrote some sample programs as an hands on. > > Now I would like to take up Tkinter. I'm using Active State Python

Brand New!

Hi, I'm brand new to programming. Have any suggestions? I'm young. Was it a good idea to start with python? I was planning on creating a very simple program that asked yes/no questions for a school project. -Thanks! -- http://mail.python.org/mailman/listinfo/python-list

Re: Brand New!

On Apr 14, 8:37 pm, Benjamin <[EMAIL PROTECTED]> wrote: > On Apr 14, 9:00 pm, agent E 10 <[EMAIL PROTECTED]> wrote:>    Hi, I'm brand > new to programming. Have any suggestions? I'm young. > > Was it a good idea to start with python? I was planning on creating

Simple unicode-safe version of str(exception)?

I have code like this: except Exception, e: self.setState(self.Failed, str(e)) which fails if the exception contains a unicode argument. I did, of course, try unicode(e) but that fails. The following works, but seems rather messy: except Exception, e: errStr = ",".join([unicod

Re: Simple unicode-safe version of str(exception)?

In article <[EMAIL PROTECTED]>, Bjoern Schliessmann <[EMAIL PROTECTED]> wrote: > "Martin v. Löwis" wrote: > > > e is an exception object, not a Unicode object. > > Er, sure, thanks for pointing that out. At first sight he should > substitute

Re: Simple unicode-safe version of str(exception)?

In article <[EMAIL PROTECTED]>, Donn Cave <[EMAIL PROTECTED]> wrote: > In article <[EMAIL PROTECTED]>, > "Martin v. Löwis" <[EMAIL PROTECTED]> wrote: > > > >> I have code like this: > > >> except Exception, e: > > >

Re: Simple unicode-safe version of str(exception)?

In article <[EMAIL PROTECTED]>, Torsten Bronger <[EMAIL PROTECTED]> wrote: > Hallöchen! > > Russell E. Owen writes: > > > [...] > > > > So...to repeat the original question, is there any simpler > > unicode-safe replacement for str(exception)? &

Re: Tkinter event loop question

In article <[EMAIL PROTECTED]>, gordon <[EMAIL PROTECTED]> wrote: > On Aug 27, 10:42 pm, Fredrik Lundh <[EMAIL PROTECTED]> wrote: > > so I guess the question here is from where you expect to call that > > method, and what you expect Tkinter to do when you call it... > > thanks for the reply >

Re: Tkinter event loop question

In article <[EMAIL PROTECTED]>, gordon <[EMAIL PROTECTED]> wrote: > On Aug 29, 4:45 am, "Russell E. Owen" <[EMAIL PROTECTED]> wrote: > >your Controller object should not create root nor should > > it call mainloop to start the event loop. > >

wx

_AUTOSIZE)) idx = self.GetNextItem(idx, wx.LIST_NEXT_ALL, wx.LIST_STATE_DONTCARE) Any help would be greatly appreciated! I do have Shrubbery! Scott Scott E. Desmond Director & Manager Equity Systems Development IT Integration Lead Mellon Capital Management Corporation 500 Grant Street, Suite

Python, Factset, and Excel - Oh my!

ld be greatly appreciated! Scott E. Desmond Director & Manager Equity Systems Development IT Integration Lead Mellon Capital Management Corporation 500 Grant Street, Suite 4200 Pittsburgh, PA 15258 T 412.236.0405 | F 412.236.1703 [EMAIL PROTECTED] | www.mcm.com The information contained in th

Re: Texas Python Regional Unconference Reminders

yourself to the Attendees page if you're able to make it. Also, if you're planning to attend, please send me the following information (to [EMAIL PROTECTED]) so I can request wireless access for you during the meeting: - Full Name - Phone or email - Address - Affiliation

Re: installing numpy

cesco wrote: > Hi, > > I'm trying to install the numpy library (precisely > numpy-0.9.6-py2.4-linux-i686) on Linux but I encounter several This is a dumb pre-built binary package (useful perhaps because it links against ATLAS already) built using distutils. You don't build it and install it usi

Re: Problem w/Tkinter on 2.5 (Panther)

I don't know, and I'm sorry this isn't more helpful, but...if you don't get an answer here, I suggest you post to the python apple mailing list. If you prefer a newsgroup interface (as I do), use gmane's news server and subscribe to gmane.comp.python.apple (you may still have to join the mailin

Re: Tkinter problem on Mac OS X

In article <[EMAIL PROTECTED]>, [EMAIL PROTECTED] (Andrew Trevorrow) wrote: > Our app uses embedded Python to allow users to run arbitrary scripts. > Scripts that import Tkinter run fine on Windows, but on Mac OS X there > is a serious problem. After a script does "root = Tk()" our app's menus

Re: Natural Language Processing in Python

nltk is a good start, we used it in my Computational Linguistics course in school. www.nltk.org --Alejandro -- http://mail.python.org/mailman/listinfo/python-list

Valgrind and Python

Running Python 2.5.1 under Valgrind is interesting; just starting it and then pressing Ctrl-D produces this: ==27082== ERROR SUMMARY: 713 errors from 56 contexts (suppressed: 10 from 1) ==27082== malloc/free: in use at exit: 1,243,153 bytes in 508 blocks. ==27082== malloc/free: 3,002 allocs, 2,494

Re: Valgrind and Python

Jean-Paul Calderone <[EMAIL PROTECTED]> writes: > Did you use the suppression file? No, I didn't, because I was testing Valgrind on binaries that happened to be installed on a Linux machine, and had no reason to treat Python specifically. I see that README.valgrind explains why Python reads memo

Re: Validating cells of a table PyQt

here was a part with validators that looked pretty nice. You can easly and legally download this book from various sites. Best from Poland, trzewiczek -- Using Opera's revolutionary e-mail client: http://www.opera.com/mail/ -- http://mail.python.org/mailman/listinfo/python-list

Re: Python interactive terminal in Ubuntu Linux : some keys fouled up

e thing! cheers, trzewiczek -- Using Opera's revolutionary e-mail client: http://www.opera.com/mail/ -- http://mail.python.org/mailman/listinfo/python-list

Re: Using graphviz to visualize trace.py output, anybody?

In article <[EMAIL PROTECTED]>, [EMAIL PROTECTED] wrote: > Hi, > > has anybody thought of / already used graphviz to convert the output of > trace.py into a graph? I looked at PyUMLGraph, but 1. PyUMLGraph does > not successfully create a dot file, and 2. I don't really want a UML > representation

Re: Pickle for MPI

In article <[EMAIL PROTECTED]>, tooper wrote: > Hello, > > Did anybody tried python pickle module over heterogeneous 32/64 bits > mpi exchanges to overcome the translation problem ? i.e. pickling on > one side (let's say a 32-bits OS side), sending the buffer as string > through mpi and unpickling

Re: What strategy for random accession of records in massive FASTA file?

In article <[EMAIL PROTECTED]>, Chris Lasher wrote: > Hello, > I have a rather large (100+ MB) FASTA file from which I need to > access records in a random order. The FASTA format is a standard format > for storing molecular biological sequences. Each record contains a > header line for describing

Re: wxPython and threads again

In article <[EMAIL PROTECTED]>, perchef wrote: > Hi, > > I have several files to download and a GUI to update. I know this is a > frequently asked question but i can't find an appropriate solution. > My Downloader extends threading.Thread and update a wx.Gauge in GUI > during the process. > > for

Re: wxPython and threads again

On 2005-08-10, Bryan Olson <[EMAIL PROTECTED]> wrote: > > The easiest approach, though, is to use the threadedselectreactor in > Twisted (you need > > to check the HEAD branch out with subversion, because that reactor > isn't included in any releases). > > With threadedselectreactor, it's easy to

Re: wxPython and threads again

On 2005-08-10, Peter Hansen <[EMAIL PROTECTED]> wrote: > David E. Konerding DSD staff wrote: >> Further, calling wx from a thread other than the one running the event > > loop is deep voodoo and should typically be avoided. > > "Typically"? Let's

Re: Wheel-reinvention with Python

In article <[EMAIL PROTECTED]>, Ben Finney wrote: > Brian Victor <[EMAIL PROTECTED]> wrote: >> [EMAIL PROTECTED] wrote: >> > Torsten Bronger wrote: >> >> I've been having a closer look at wxPython which is not Pythonic at >> >> all and bad documented. Probably I'll use it nevertheless. >> > Aye.

Re: any Python equivalent of Math::Polynomial::Solve?

On 2005-02-26, Just <[EMAIL PROTECTED]> wrote: > While googling for a non-linear equation solver, I found > Math::Polynomial::Solve in CPAN. It seems a great little module, except > it's not Python... I'm especially looking for its poly_root() > functionality (which solves arbitrary polynomials)

Re: Python callbacks & PyGILState_Release()

In article <[EMAIL PROTECTED]>, Randall Hopper wrote: > Thomas Heller: > |> Python -> C++ -> Python Callback > |> > |> (example attached) an exception raised in the callback doesn't make it back > |> across C++ to Python. > ... > |> void callback_wrapper( void *user_data ) > |> { > |> // Acq

Re: Guido at Google

In article <[EMAIL PROTECTED]>, Greg Stein wrote: > Guido would acknowledge a query, but never announce it. That's not his > style. > > This should have a positive impact on Python. His job description has a > *very* significant portion of his time dedicated specifically to > working on Python. (m

Re: 2D canvas for GTK

In article <[EMAIL PROTECTED]>, Sandro Dentella wrote: > Il 2006-01-09, John Bauman <[EMAIL PROTECTED]> ha scritto: >> >> "Sandro Dentella" <[EMAIL PROTECTED]> wrote in message >> news:[EMAIL PROTECTED] >>>I need a (decent) canvas for PyGTK. I used tkinter.canvas with real >>>pleasure >>> in the

Re: How do I print a numpy array?

On 2006-12-02, Robert Kern <[EMAIL PROTECTED]> wrote: > Beliavsky wrote: >> When I print an array in any language, I (and I think most programmers) >> expect by default to have all elements displayed. Matlab, R, and >> Fortran 95 have somewhat similar arrays to numpy, and that is what they >> do. I

Re: processing the genetic code with python?

In article <[EMAIL PROTECTED]>, nuttydevil wrote: > I have many notepad documents that all contain long chunks of genetic > code. They look something like this: > > atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag > tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa > agcgtgg

Re: Chroot Jail Not Secure for Sandboxing Python?

On 2007-06-25, [EMAIL PROTECTED] <[EMAIL PROTECTED]> wrote: > On Jun 25, 1:43 am, "Martin v. Löwis" <[EMAIL PROTECTED]> wrote: >> [EMAIL PROTECTED] schrieb: >> >> > This wiki page suggests using a chroot jail to sandbox Python, but >> > wouldn't running something like this in your sandboxed Python

Re: ZSI, SOAP and .NET web services - problem

On 2007-03-22, Jaroslaw Zabiello <[EMAIL PROTECTED]> wrote: > I try to connect to web services (written in C#/.NET) with latest ZSI > 2.0rc3 library. It just does not work. > > from ZSI.ServiceProxy import ServiceProxy > wsdl = 'http://192.168.0.103/NewWebServices/TemplateInsert.asmx?wsdl' > prin

Re: No zlib in Python 2.4.4

On 2007-04-11, [EMAIL PROTECTED] <[EMAIL PROTECTED]> wrote: > On Apr 11, 9:14 am, Marc 'BlackJack' Rintsch <[EMAIL PROTECTED]> wrote: >> In <[EMAIL PROTECTED]>, shamzz wrote: >> > Shouldn't zlib be compiled as a Python module automatically in Python >> > 2.4.4. I'm guessing Python is doing some ki

Calling a dos batch file from python

Suppose I have a batch file called mybatch.bat and I want to run it from a python script. How can I call this batch file in python script? Thanx/NSP -- http://mail.python.org/mailman/listinfo/python-list

Re: Calling a dos batch file from python

On Sep 4, 5:01 pm, [EMAIL PROTECTED] wrote: > On Sep 4, 8:42 am, n o s p a m p l e a s e <[EMAIL PROTECTED]> > wrote: > > > Suppose I have a batch file called mybatch.bat and I want to run it > > from a python script. How can I call this batch file in python scri

Calling a matlab script from python

Suppose I have a matlab script mymatlab.m. How can I call this script from a python script? Thanx/NSP -- http://mail.python.org/mailman/listinfo/python-list

PAMELA DAVID

PAMELA DAVID www.alphasearch.gr -- http://mail.python.org/mailman/listinfo/python-list

graphing lifelines

(crossposted to sci.math) I'm looking for a tool which will take a dataset of tuples indicating the year of birth and death of a person: (1872, 1950, "Sri Aurobindo") (1821, 1910, "Mary Baker Eddy") (1831, 1891, "HP. Blavatksy") And graph them out, in bars, annotating them with the person's name

Re: graphing lifelines

On Jul 15, 3:38 pm, Larry Bates <[EMAIL PROTECTED]> wrote: > > Certainly a "Hi-Tech Shaman" can whip something up to do this, right? > Yes, well E.J. Gold is the Hi-Tech Shaman. I'm Terrence Brannon, stating that fact :) So, maybe EJ could whip up such a thing :) I like the sci.math answer I go

<    1   2   3