Bug#787533: [debian-mysql] Bug#787533: mariadb-common: modifies conffiles (policy 10.7.3): /etc/mysql/my.cnf

[Andreas Beckmann]

On 2015-06-15 11:09, Robie Basak wrote:
> The new mysql-common replaces the /etc/mysql/my.cnf conffile with a
> non-conffile maintainer-script-manager symlink (via
> update-alternatives). It is in VCS, though I want to fix a separate bug
> before I upload to minimise the impact on users of unstable and testing
> who will transition from 5.5 to 5.6 as soon as I upload.

as I promised here is a review:

a few comments from just looking at the commit 61e2b53

* mysql-common.postinst:
  - why is the fallback alternative being installed before #DEBHELPER#?
won't that confuse dpkg-maintscript-helper?
at least comment on it, the explanation below is very nice

* mysql-common.postrm:
  - upon purge, delete /etc/mysql/my.cnf.migrated
  - do not use update-alternatives --remove-all, remove only the 
alternatives (possibly) installed by this package (ordered lowest 
to highest priority)
update-alternatives --remove is a silent no-op if the alternative 
does not exist
  - rmdir /etc/mysql should be the last step for purge, not the first


How does the migration work if the mariadb-common mishandling of my.cnf has 
been performed?

from mariadb-common.postinst:

  configure)
# New packaging paradigm for my.cnf as of Dec-2014 for sharing mysql
# variants in Ubuntu. If the new mysql-common package does not provide
# the update-alternatives facility, fall back to creating a symlink
if [ -f /usr/share/mysql-common/configure-symlinks ]
then
  /usr/share/mysql-common/configure-symlinks install mariadb 
"/etc/mysql/mariadb.cnf"
else
  # As configure can be called many times, don't re-create the symlink
  # if it is there already
  if [ ! -L /etc/mysql/my.cnf ]
  then
echo "Notice: configure-symlinks trigger could not be called."
echo "Creating /etc/mysql/my.cnf as a symlink that points to 
mariadb.cnf."
mv -f /etc/mysql/my.cnf /etc/mysql/my.cnf.old
ln -sf mariadb.cnf /etc/mysql/my.cnf
  fi
fi
  ;;


how does dpkg-maintscript-helper rm_conffile cope with the conffile being 
replaced with a symlink to a different file?
I expect you want to use my.cnf.old as my.cnf.migrated if and only if it was 
modified
and you never want to use (a symlink to) mariadb.cnf as my.cnf.migrated

mysql-common needs to Breaks: mariadb-common (<< 
version-where-that-mess-was-removed-again~)
and mysql-common.preinst may have to undo this before #DEBHELPER#
(mariadb-common may have been removed but not purged before the new 
mysql-common gets installed)
(or it may have been purged as well ... probably leaving my.cnf.old

(note: the mariadb.cnf alternative for my.cnf will be reinstalled correctly 
once the fixed mariadb-common gets configured (and that happens after 
mysql-common got configured)


it should be easy to detect: 

  if [ -L /etc/mysql/my.cnf ] && [ "$(readlink /etc/mysql/my.cnf)" = 
"mariadb.cnf" ] ; then ...


The important part is that dpkg cleanly forgets everything about the old 
conffile my.cnf,
otherwise tools like debsums will spew errors since the remembered md5sum does 
not match


Andreas

PS: so far I didn't test anything, just looked at commits (and 
mariadb-common.postinst)


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#690744: Problem is present in jessie after upgrade from wheezy

[Adam Ward]

Hi,
It was working on wheezy.
I have had to add an entry into /etc/rc.local to have it sleep for 10 
seconds before doing a service restart.

Without the sleep the network is still not ready in time.

dmesg shows:

[0.00] Booting Linux on physical CPU 0x0
[0.00] Initializing cgroup subsys cpuset
[0.00] Initializing cgroup subsys cpu
[0.00] Initializing cgroup subsys cpuacct
[0.00] Linux version 3.16.0-4-kirkwood 
(debian-ker...@lists.debian.org) (gcc version 4.8.4 (Debian 4.8.4-1) ) 
#1 Debian 3.16.7-ckt11-1 (2015-05-24)
[0.00] CPU: Feroceon 88FR131 [56251311] revision 1 (ARMv5TE), 
cr=0005397f

[0.00] CPU: VIVT data cache, VIVT instruction cache
[0.00] Machine: QNAP TS-119/TS-219
[0.00] Ignoring unrecognised tag 0x41000403
[0.00] Memory policy: Data cache writeback
[0.00] On node 0 totalpages: 262144
[0.00] free_area_init_node: node 0, pgdat c05d2ca4, node_mem_map 
eeff9000

[0.00]   DMA zone: 1520 pages used for memmap
[0.00]   DMA zone: 0 pages reserved
[0.00]   DMA zone: 194560 pages, LIFO batch:31
[0.00]   HighMem zone: 528 pages used for memmap
[0.00]   HighMem zone: 67584 pages, LIFO batch:15
[0.00] pcpu-alloc: s0 r0 d32768 u32768 alloc=1*32768
[0.00] pcpu-alloc: [0] 0
[0.00] Built 1 zonelists in Zone order, mobility grouping on.  
Total pages: 260624
[0.00] Kernel command line: console=ttyS0,115200 root=/dev/ram 
initrd=0xa0,0x90 ramdisk=34816

[0.00] PID hash table entries: 4096 (order: 2, 16384 bytes)
[0.00] Dentry cache hash table entries: 131072 (order: 7, 524288 
bytes)
[0.00] Inode-cache hash table entries: 65536 (order: 6, 262144 
bytes)
[0.00] Memory: 1024016K/1048576K available (3899K kernel code, 
360K rwdata, 1440K rodata, 277K init, 289K bss, 24560K reserved, 270336K 
highmem)

[0.00] Virtual kernel memory layout:
vector  : 0x - 0x1000   (   4 kB)
fixmap  : 0xffc0 - 0xffe0   (2048 kB)
vmalloc : 0xf000 - 0xff00   ( 240 MB)
lowmem  : 0xc000 - 0xef80   ( 760 MB)
pkmap   : 0xbfe0 - 0xc000   (   2 MB)
modules : 0xbf00 - 0xbfe0   (  14 MB)
  .text : 0xc0008000 - 0xc053ee3c   (5340 kB)
  .init : 0xc053f000 - 0xc058472c   ( 278 kB)
  .data : 0xc0586000 - 0xc05e0068   ( 361 kB)
   .bss : 0xc05e0068 - 0xc062846c   ( 290 kB)
[0.00] NR_IRQS:114
[0.08] sched_clock: 32 bits at 200MHz, resolution 5ns, wraps 
every 21474836475ns

[7.436581] Console: colour dummy device 80x30
[7.436602] Calibrating delay loop... 1974.27 BogoMIPS (lpj=3948544)
[7.452420] pid_max: default: 32768 minimum: 301
[7.452501] Security Framework initialized
[7.452538] Yama: disabled by default; enable with sysctl kernel.yama.*
[7.452597] Mount-cache hash table entries: 2048 (order: 1, 8192 bytes)
[7.452611] Mountpoint-cache hash table entries: 2048 (order: 1, 8192 
bytes)

[7.453193] Initializing cgroup subsys memory
[7.453223] Initializing cgroup subsys devices
[7.453261] Initializing cgroup subsys freezer
[7.453280] Initializing cgroup subsys net_cls
[7.453314] Initializing cgroup subsys blkio
[7.453339] Initializing cgroup subsys perf_event
[7.453366] Initializing cgroup subsys net_prio
[7.453439] CPU: Testing write buffer coherency: ok
[7.453508] ftrace: allocating 16319 entries in 32 pages
[7.468454] Setting up static identity map for 0x3b04b0 - 0x3b0508
[7.470826] devtmpfs: initialized
[7.472930] pinctrl core: initialized pinctrl subsystem
[7.473274] regulator-dummy: no parameters
[7.473597] NET: Registered protocol family 16
[7.473871] DMA: preallocated 256 KiB pool for atomic coherent 
allocations

[7.474711] cpuidle: using governor ladder
[7.474731] cpuidle: using governor menu
[7.474784] Kirkwood: MV88F6282-Rev-A1, TCLK=2.
[7.474801] Feroceon L2: Enabling L2
[7.474828] Feroceon L2: Cache support initialised.
[7.475287] initial MPP regs: 0111 43303311   
  
[7.475302]   final MPP regs: 0155 03303311   
  

[7.476130] Kirkwood PCIe port 0: link up
[7.476135] Kirkwood PCIe port 1: link up
[7.476140] PCI: bus0 uses PCIe port 0
[7.476289] PCI host bridge to bus :00
[7.476302] pci_bus :00: root bus resource [mem 
0xe000-0xe7ff]

[7.476309] pci_bus :00: root bus resource [io 0x1000-0x]
[7.476316] pci_bus :00: No busn resource found for root bus, 
will use [bus 00-ff]

[7.476337] pci :00:00.0: [11ab:6282] type 00 class 0x058000
[7.476354] pci :00:00.0: reg 0x10: [mem 0xf100-0xf10f 
64bit pref]

[7.476363] pci :00:00.0: reg 0x18: [mem 0x-0x3fff]
[7.476396] pci :00:00.0: supports D1 D2
[7.4765

Bug#789454: ITP: ruby-omniauth-bitbucket -- bitbucket oauth2 strategy for omniauth

[Pirate Praveen]

package: wnpp
severity: wishlist

omniauth-bitbucket from rubygems.org


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789456: RM: haskell-citeproc-hs [mips mipsel sparc] -- ROM; Needs Template Haskell

[Joachim Breitner]

Package: ftp.debian.org
Severity: normal

-BEGIN PGP SIGNED MESSAGE-
Hash: SHA1

Hi,

haskell-citeproc-hs now needs Template Haskell to build, so it has to be
removed on architectures not supporting this.

According to dak on coccia, this removal can go ahead right now.

Greetings,
Joachim

-BEGIN PGP SIGNATURE-
Version: GnuPG v1

iEYEARECAAYFAlWGZWoACgkQ9ijrk0dDIGyYBQCeJy8LVNe5c+oCjLoJf8oIXNXY
ve4AnRUpnr/oTQJsPDmbWE6277juep7y
=VK5+
-END PGP SIGNATURE-


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789256: cmus: Pulls in unwanted and potentially dangerous DECnet packages through libroar2

[Ron]

On Sat, Jun 20, 2015 at 07:31:50PM -0500, Jonas Smedegaard wrote:
> Quoting Don Armstrong (2015-06-20 14:38:25)
> > There's clearly a bug here, but even after reading this bug log, I've 
> > had to do research on my own to determine what that issue is.
> > 
> > If the libroar2 maintainers which to keep decnet support, then someone 
> > should probably figure out how to circumvent waiting for the DECnet to 
> > settle when it isn't actually configured, and propose a patch to do 
> > that.
> > 
> > Even just checking for the existence of dnet-common or similar would 
> > probably be enough.
> 
> As I understand it, these are the issues raised here:
> 
>  a) libdnet is unmaintained and thus potentially dangerous to link 
> against
> 
>  b) dnet-common commonly (or always by default?) cause whole system to 
> hang 
> 
> I disagree that any of above are bugs in cmus.

The bit where you and Adrian appear to be talking past each other is:

  c) cmus Recommends roar.  (which it didn't in the Wheezy release)

So anyone installing cmus on a default system (or upgrading from Wheezy)
gets pulled into this.


Demoting that to (at least) Suggests was discussed before this bug
was opened (in a thread that unfortunately didn't hit the BTS since
it was CC'd to an archived bug when Adrian reported it).

Alessio already acknowledged that would be a good idea and suggested
that Adrian open this bug to discuss whether even the Suggests was
still appropriate if installing that suggestion had the same outcome.


To quote Alessio replying to Adrian on that:

> I acknowledge your request, it seems legit to me to demote libroar2
> from Recommends to Suggests.
> Could you please file a bug and set its severity to "important"?
> Furthermore, since I have removed 680...@bugs.debian.org from the CC:
> field as the bug is archived and no longer accepts mails, It would be
> great if you could attach our discussion to the report for future
> reference. [1]

and his earlier reply re DECNet to Stephan:

> > While it might not be a common feature, it is a feature none the less.
>
> One that relies on functionalities provided by a factually dead
> software; please get rid of it.
> Meanwhile I'll be demoting cmus's libroar dependency from Recommends
> to Suggests. If roaraudio's maintainers do not show willingness to
> cooperate, then we'll hand this to the TC and see.


I don't have a dog in this race, beyond being CC'd to request some
background clarification in the initial thread, and hoping you all
get on the same page about it soon so it will stop filling my inbox.

I don't particularly care what you choose to do, but "roar pulls in
DECNet -> DECNet breaks people's existing systems" is hardly a new
problem.  People mostly just had a brief respite from it, since for
Wheezy packages that people did actually want stopped pulling in
roar ...

Now that problem is back.  The solutions are all pretty easy, you
just need to pick one.  "Ignoring it" isn't really in the solution
set though, so please do pick one some way or another :)


  hth,
  Ron


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789455: timidity: Version 2.14.0 from 2012 and git hourly releases

[Tony]

Package: timidity
Version: 2.13.2-40.2
Severity: wishlist

Dear Maintainer,

I happened to look at this package on sourceforge.net and noticed that the 
latest upstream version seems to be 2.14.0 
from 2012.  Checking the Debian package pool, I was surprised that the latest 
package seems to be version 2.13.2.  Would 
you please update your watch file if necessary and upgrade the Debian package 
to 2.14.0?

Also, I noticed hourly snapshots from git.  The latest at the time of writing 
is 2.14.0-150421-1200.  Would you look 
into this and consider packaging it if appropriate?

Thank you very much for your attention to this.

-- System Information:
Debian Release: 8.0
  APT prefers testing-updates
  APT policy: (500, 'testing-updates'), (500, 'testing')
Architecture: amd64 (x86_64)

Kernel: Linux 2.6.32-5-amd64 (SMP w/2 CPU cores)
Locale: LANG=C, LC_CTYPE=C (charmap=ANSI_X3.4-1968)
Shell: /bin/sh linked to /bin/dash
Init: sysvinit (via /sbin/init)

Versions of packages timidity depends on:
ii  libasound21.0.28-1
ii  libaudio2 1.9.4-3
ii  libc6 2.19-18
ii  libesd0   0.2.41-11
ii  libflac8  1.3.0-3
ii  libice6   2:1.0.9-1+b1
ii  libjack-jackd2-0 [libjack-0.116]  1.9.10+20140719git3eb0ae6a~dfsg-2
ii  libncurses5   5.9+20150516-2
ii  libogg0   1.3.2-1
ii  libpng12-01.2.50-2+b2
ii  libsm62:1.2.2-1+b1
ii  libtinfo5 5.9+20150516-2
ii  libvorbis0a   1.3.4-2
ii  libvorbisenc2 1.3.4-2
ii  libx11-6  2:1.6.2-3
ii  libxaw7   2:1.0.12-2+b1
ii  libxext6  2:1.3.3-1
ii  libxmu6   2:1.1.2-1
ii  libxt61:1.1.4-1+b1
ii  lsb-base  4.1+Debian13+nmu1
ii  zlib1g1:1.2.8.dfsg-2+b1

Versions of packages timidity recommends:
pn  freepats 
ii  timidity-daemon  2.13.2-40.2

Versions of packages timidity suggests:
ii  fluid-soundfont-gm  3.1-5
ii  fluid-soundfont-gs  3.1-5
pn  pmidi   

-- Configuration Files:
/etc/timidity/timidity.cfg changed [not included]

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789457: network-manager cannot create hotspot

[Pirate Praveen]

package: network-manager
version: 1.0.2-2
severity: grave
reason: it is a major feature and regression

it was working on the same hardware on earlier versions.



signature.asc
Description: OpenPGP digital signature

Bug#789458: powerpc: getEnvironment empty when run in GHCi

[Joachim Breitner]

Package: ghc
Version: 7.8.4-9
Severity: normal

-BEGIN PGP SIGNED MESSAGE-
Hash: SHA1

Hi,

on powerpc (only), we have this:

$ cat env.hs
import System.Environment
main = getEnvironment >>= print
$ runhaskell env.hs
[]
$ ./env
[("RESET","\\e[0m")...

This breaks the test suite of shake.

Greetings,
Joachim

- -- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (500, 'unstable'), (101, 'experimental')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 4.0.0-2-amd64 (SMP w/4 CPU cores)
Locale: LANG=de_DE.utf8, LC_CTYPE=de_DE.utf8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages ghc depends on:
ii  dpkg 1.18.1
ii  gcc  4:4.9.2-4
ii  libbsd-dev   0.7.0-2
ii  libc62.19-18
ii  libc6-dev2.19-18
ii  libffi-dev   3.1-2+b2
ii  libffi6  3.1-2+b2
ii  libgmp-dev   2:6.0.0+dfsg-6
ii  libgmp10 2:6.0.0+dfsg-6
ii  libncurses5-dev  5.9+20150516-2
ii  libtinfo55.9+20150516-2

ghc recommends no packages.

Versions of packages ghc suggests:
ii  ghc-doc  7.8.4-9
ii  ghc-prof 7.8.4-9
pn  haskell-doc  
pn  llvm-3.4 
ii  perl 5.20.2-6

- -- no debconf information

-BEGIN PGP SIGNATURE-
Version: GnuPG v1

iEYEARECAAYFAlWGasoACgkQ9ijrk0dDIGxITgCfYzBm+JG1Z42LZii0ZehAsV7Y
v0MAoMgZ4cmPHSGowjtKjcM/EEccsPru
=rHGr
-END PGP SIGNATURE-


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#493249: error log

[Pirate Praveen]

pravi@savannah:~$ sudo synaptic

(synaptic:12421): GLib-GObject-WARNING **: The property GtkImage:stock
is deprecated and shouldn't be used anymore. It will be removed in a
future version.

(synaptic:12421): GLib-GObject-WARNING **: The property GtkMisc:yalign
is deprecated and shouldn't be used anymore. It will be removed in a
future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkImageMenuItem:use-stock is deprecated and shouldn't be used anymore.
It will be removed in a future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkImageMenuItem:image is deprecated and shouldn't be used anymore. It
will be removed in a future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkSettings:gtk-menu-images is deprecated and shouldn't be used anymore.
It will be removed in a future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkToolButton:stock-id is deprecated and shouldn't be used anymore. It
will be removed in a future version.
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 24: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 34: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 46: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 59: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 71: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 84: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 96: Having multiple values in  isn't supported and may not
work as expected

(synaptic:12421): GLib-GObject-WARNING **: The property GtkButton:xalign
is deprecated and shouldn't be used anymore. It will be removed in a
future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkAlignment:right-padding is deprecated and shouldn't be used anymore.
It will be removed in a future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkContainer:resize-mode is deprecated and shouldn't be used anymore. It
will be removed in a future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkAlignment:bottom-padding is deprecated and shouldn't be used anymore.
It will be removed in a future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkAlignment:left-padding is deprecated and shouldn't be used anymore.
It will be removed in a future version.

(synaptic:12421): GLib-GObject-WARNING **: The property
GtkCellRendererText:background-gdk is deprecated and shouldn't be used
anymore. It will be removed in a future version.
ERROR:root:Cannot import UbuntuDrivers: No module named 'UbuntuDrivers'
/usr/lib/python3/dist-packages/softwareproperties/gtk/utils.py:29:
Warning: The property GtkAlignment:top-padding is deprecated and
shouldn't be used anymore. It will be removed in a future version.
  self.builder.add_from_file(path)
/usr/lib/python3/dist-packages/softwareproperties/gtk/utils.py:29:
Warning: The property GtkAlignment:left-padding is deprecated and
shouldn't be used anymore. It will be removed in a future version.
  self.builder.add_from_file(path)
/usr/lib/python3/dist-packages/softwareproperties/gtk/utils.py:29:
Warning: The property GtkButton:xalign is deprecated and shouldn't be
used anymore. It will be removed in a future version.
  self.builder.add_from_file(path)
/usr/lib/python3/dist-packages/softwareproperties/gtk/utils.py:29:
Warning: The property GtkTreeView:rules-hint is deprecated and shouldn't
be used anymore. It will be removed in a future version.
  self.builder.add_from_file(path)
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 24: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 34: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 46: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 59: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 71: Having multiple values in  isn't supported and may not
work as expected
Fontconfig warning: "/etc/fonts/conf.d/89-ttf-thai-tlwg-synthetic.conf",
line 84: Having multiple values in  isn't supported an

Bug#789459: RM: haskell-diagrams-core [mips mipsel sparc] -- ROM; Needs Template haskell

[Joachim Breitner]

Package: ftp.debian.org
Severity: normal

-BEGIN PGP SIGNED MESSAGE-
Hash: SHA1

Hi,

haskell-diagrams-core needs Template Haskell now, so it, and its reverse
dependencies, need to be removed on mips mipsel and sparc. Something
like
$ dak rm -R -n -a mips,mipsel,sparc haskell-diagrams-core 
haskell-diagrams-cairo haskell-diagrams-lib haskell-diagrams-svg 
haskell-diagrams-gtk

The reported broken Depends from haskell-diagrams is due to an arch:all
package and can be ignored. Hence, this removal is good to go.

Greetings
Joachim

-BEGIN PGP SIGNATURE-
Version: GnuPG v1

iEYEARECAAYFAlWGbN4ACgkQ9ijrk0dDIGzeAwCgs+v96/llOjO12TCbWk+QWkKl
wC4AnitfM0f/aWk9eUJB79z6nHJNWcp/
=fbu/
-END PGP SIGNATURE-


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789354: FTBFS: rpm/librpm4_stubs.c:221:18: error: 'RPMTAG_SUGGESTSNAME' undeclared

[Pietro Abate]

hello there.

This problem is now fixed upstream. I'm going to prepare a new dose3 release
soon to be included in debian. The problem was that librpm introduced
a not backward compatible change. RPMTAG_SUGGESTSNAME was renamed to
RPMTAG_SUGGESTNAME and RPMTAG_ENHANCESNAME to RPMTAG_ENHANCENAME
(notice the missing 'S' ) :-/ The RPM bindings in dose are now well
tested and this change passed unnoticed until now.

pietro


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789323:

[Otto Kekäläinen]

Please install the latest official Debian package of MariaDB and this
issue will not exist. If you want to use .deb packages from other
sources, please don't file bugs against Debian in those cases.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789461: ITP: runescape -- Complete quests and win enormous treasures in RuneScape

[Carlos Donizete]

Package: wnpp
Severity: wishlist
Owner: Carlos Donizete 

* Package name: runescape
  Version : 0.1
  Upstream Author : Jagex Limited 
* URL : http://www.runescape.com/
* License : GPL-2+
  Programming Lang: Java
  Description : Complete quests and win enormous treasures in RuneScape

 The game is a unofficial Linux client Java-based. It makes sure that 
 OpenGL works when using Java7/OpenJDK7. 
 .
 RuneScape offers players a huge variety of benefits such as hundreds 
 of additional quests and adventures, a larger game world to explore, 
 exclusive skills and master and access to a whole host of minigames.
 .
 Players can also access the most powerful weaponry and armour in the game, 
 create clan citadels with their friends and even build their very own house.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789460: unable to receive files over bluetooth

[Pirate Praveen]

package: bluez-obexd
version: 5.23-2+b1
severity: grave
reason: file transfer is a major feature of bluetooth

I can use internet connection of my android phone and send files to it,
but receiving files don't work. I had tried with firefox os phone as
well and result is same.



signature.asc
Description: OpenPGP digital signature

Bug#789462: src:kmod - documentation not buit, "orig".tar.xz isn't

[Pigeon]

Package: kmod
Version: 20-1

The file
http://http.debian.net/debian/pool/main/k/kmod/kmod_20.orig.tar.xz
is not actually the original source code, and the kmod API
documentation is missing from the packages built from it.

File   sha256sum
http://http.debian.net/debian/pool/main/k/kmod/kmod_20.orig.tar.xz 
591d729557cf2fcaa434534f7f55f096592f459cfb33501791424076d077295e
https://www.kernel.org/pub/linux/utils/kernel/kmod/kmod-20.tar.xz  
89c1a1a2193c31f9ebe582640bfa2bd401341dc24119f5a7f702588116fadaa0

Several files in the kernel.org version are missing from the Debian
version, including kmod-20/libkmod/docs/gtk-doc.make and
kmod-20/libkmod/docs/Makefile.in. 

The package as originally written is supposed to contain API
documentation in HTML format. When built from the Debian source this
documentation is missing. 

If, however, before executing dpkg-source -x, the genuine
kmod-20.tar.xz from kernel.org is copied as kmod_20.orig.tar.xz and
the hashes in kmod_20-1.dsc adjusted accordingly, the resulting
kmod_20-1_amd64.deb *does* contain the API documentation; it is under
/usr/share/gtk-doc/html/libkmod-3.

Surely the Debian version of the tarball should be identical to the
kernel.org original, and any Debianising patching performed through
the agency of kmod_20-1.debian.tar.xz. It should not be necessary to
refer back to kernel.org to get the complete package including all
files needed to build the API documentation.

Further, and obviously, the documentation being missing from the
Debian package is a thorough pain to anyone wanting to write code
using the API.

-- 
Pigeon

Be kind to pigeons- -Pigeon's Nest: http://pigeonsnest.co.uk/
GPG key: http://pgp.mit.edu:11371/pks/lookup?op=get&search=0x21C61F7F


signature.asc
Description: Digital signature

Bug#789256: cmus: Pulls in unwanted and potentially dangerous DECnet packages through libroar2

[John Paul Adrian Glaubitz]

-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

On 06/21/2015 02:36 AM, Jonas Smedegaard wrote:
> Quoting John Paul Adrian Glaubitz (2015-06-20 15:16:28)
>> You are still trying to boil this down to the mere problem with
>> cmus,
> 
> This bugreport is filed against cmus, is it not?

This is correct. Upon the request of the maintainer of cmus who
already prepared an upload which is why the bug is set to "pending".

>> but that's just a side effect. The real point is that roaraudio 
>> depends on an unmaintained piece of core software which Debian
>> would like to get rid of.
> 
> Then please reassign and retitle the bugreport to discuss the real
> issue where it belongs.

No, we won't, because:

a) Alessio asked for this bug report
b) Patrick Matthei refuses to make any changes to libroar2 to help
   fix this problem
c) You apparently continue to refuse to read what people write to
   explain the situation

Thanks,
Adrian

- -- 
 .''`.  John Paul Adrian Glaubitz
: :' :  Debian Developer - glaub...@debian.org
`. `'   Freie Universitaet Berlin - glaub...@physik.fu-berlin.de
  `-GPG: 62FF 8A75 84E0 2956 9546  0006 7426 3B37 F5B5 F913
-BEGIN PGP SIGNATURE-
Version: GnuPG v2

iQIcBAEBCAAGBQJVhnZVAAoJEHQmOzf1tfkTno8P/jF985wsP8axAb03BEVLZsfl
9F8R7Q+C6EJDtRXRvl2oauGyqC7sB4ci9yqFpGb5E+dkMnNqNRfZv0qiJaxqqul+
iW9KpJqHK/1Kfd+LphWPMl7UfFORDmmoNU9t7Af89s+WwLnf7nlKRI/m9JRBSBCH
Tt16iHYRnwFSlNWSI1oBFh2MHUdXkB6TwYL+NxCRQZcTvdn+v8cCZugAGNBNwxn9
4SU/KJPePET3I6GECed+tTnBBEDsd57Dos8eL/TTcs0G5DgUPSi8mXUKecfCIanq
yOkuU60eUfOFte3mmvOtwu5DDx1bdZc8+u+Z0zep8dLfFAMq+iYO6ShpVu0He1IF
sDop02C0D90DppJpA6c2UA/+/dlIhPnuR6nOMejej8iNNhGlgq/DYq0zuIkaYvhg
AOHFIlO2n1N8GNY8bSWdura14E8ltpuESd9uXeIXcjEz2R4Kop9OvOqC3OEaiYSz
gPUus8W0rnwRkpzEtVC3zNmdKuGJhK4L1oNLHM34w0F7WaWwKqKo1Ky99B15+I3I
qSFs6sqOGnLjSlo6McFYUPBNuQYk48kiB8OMsNoG6rRZZ4Xw3JWYIxwIoKMRhmWi
VHycyTfOLbNEbZ0muQsSMdu9IEXpg8gJ1MtfjVyBhAMERjlXJce3Elbe0c/LRuCz
O+S9jh+kmhNuZYqek6j4
=YEkB
-END PGP SIGNATURE-


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789462: src:kmod - documentation not buit, "orig".tar.xz isn't

[Marco d'Itri]

On Jun 21, Pigeon  wrote:

> Surely the Debian version of the tarball should be identical to the
> kernel.org original, and any Debianising patching performed through
Not at all.
But I will welcome patches to build the documentation from the git tree.

-- 
ciao,
Marco


pgptvQZ8SNoiF.pgp
Description: PGP signature

Bug#789256: cmus: Pulls in unwanted and potentially dangerous DECnet packages through libroar2

[John Paul Adrian Glaubitz]

-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

On 06/21/2015 02:31 AM, Jonas Smedegaard wrote:
>> Even just checking for the existence of dnet-common or similar
>> would probably be enough.
> 
> As I understand it, these are the issues raised here:

You understand incorrectly then.

> a) libdnet is unmaintained and thus potentially dangerous to link 
> against
> 
> b) dnet-common commonly (or always by default?) cause whole system
> to hang

*Not* dnet-common, _libdnet_, seriously, read what I wrote!

> I disagree that any of above are bugs in cmus.

Again, you are not reading what I wrote. Please leave the discussion
if you refuse to do so! Alessio Teglia, one of the cmus maintainers
himself said "Please file a bug report against cmus and ask for
libroar2 to be demoted from Recommends to Suggests".

Fy fæn, Jonas. Les hva folk skrev før to du svarer eposten!

Adrian

- -- 
 .''`.  John Paul Adrian Glaubitz
: :' :  Debian Developer - glaub...@debian.org
`. `'   Freie Universitaet Berlin - glaub...@physik.fu-berlin.de
  `-GPG: 62FF 8A75 84E0 2956 9546  0006 7426 3B37 F5B5 F913
-BEGIN PGP SIGNATURE-
Version: GnuPG v2

iQIcBAEBCAAGBQJVhnXhAAoJEHQmOzf1tfkTzrgP/R7g/iExaetW+ERX6ciKWmCA
5UcsgGBIRqdYiweQ92KvXoAJjCj4RdnkaibGf/Pu9PmNOIaPgYvAaokfYioUtmq4
ctklcoqUADTjO5Kpx6hTaZYIVtfcTMfC+34kZAVcXDFo+7MBcLQ9fwv/M+MMxpP9
EqAq0OGn1+EnBs6eaQJmaA3clNRI18pntl6L9um5MJ5H6OIwTasdOGNeFI+0RQ6V
2S82O2HmkQUxrNu7G9rkF/jGSBciHOCb9HQBvmNKi70Pk34tew52DallgtNDyK97
a781ez7iKHf9Zgs3q2C3rwIxWWPaeRvGA2uj+PP+e2VuWuPAh1Y8CBCMkstyzKV4
0egyMNQCrJXxK6X+1IHTh5IgqUd8NVzdloCNcrDBaW8S7UD11h8tPW0xNIuDvJ/4
PeUyv5rKpy98AdR9oywdzHe/b/vnujYKqwdVmpDWRscePYHKZKph98Mzh7OX81Rk
4yRtcp0hZRCslpJUuInJYl6Ai0fTsUgBXOvta2WnFE84fHOCmpDDomZLVwg5R5ji
FkyWydO8QbgzP7XSrlK9f9uh1wh1rQVHgZkFIkc/U/SDiuyYNxwPe6+kMwkOg/HW
pGIVnA92WsONW61AMj3uTXx3y7+hVvoykrm7TRyhPEh/aLhkOUgkAD2U1Zs1a2HZ
frDyVUPWxnNVYzjBnNIF
=uXlC
-END PGP SIGNATURE-


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789354: FTBFS: rpm/librpm4_stubs.c:221:18: error: 'RPMTAG_SUGGESTSNAME' undeclared

[Ralf Treinen]

On Sun, Jun 21, 2015 at 08:58:11AM +0200, Pietro Abate wrote:
> hello there.
> 
> This problem is now fixed upstream. I'm going to prepare a new dose3 release
> soon to be included in debian. The problem was that librpm introduced
> a not backward compatible change. RPMTAG_SUGGESTSNAME was renamed to
> RPMTAG_SUGGESTNAME and RPMTAG_ENHANCESNAME to RPMTAG_ENHANCENAME
> (notice the missing 'S' ) :-/ The RPM bindings in dose are now well
> tested and this change passed unnoticed until now.

Thanks, Pietro! Does this mean that the new release of dose needs
to build-depend on librpm >= 4.12 ?

-Ralf.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#775438: all is ok now after update kernel

[Bartek Nocoń]

kernel updated to

linux (3.2.68-1+deb7u2) wheezy-security; urgency=high


all works fine now...


--
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789256: cmus: Pulls in unwanted and potentially dangerous DECnet packages through libroar2

[John Paul Adrian Glaubitz]

-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

On 06/21/2015 02:44 AM, Jonas Smedegaard wrote:
>> Jonas, do you actually read what I wrote?
> 
> Yes.

No, you don't, because you constantly say the bug report is not
correct even though a) Alessio requested it and b) already
tagged this bug as "pending" which means he already made
the change.

>> This very bug report exists because the maintainer of roaraudio 
>> refuses to handle any bug reports regarding this issue
> 
> That is no excuse for barking up the wrong tree: The proper way to
>  escalate is to move the bugreport for the real issue to the
> technical committee.

There is no barking up the wrong tree if the one sitting on the tree
asked me to. I don't even know why you jumped into this bug report
with apparently not enough background information to join the
discussion.

Please don't paint me as an ignorant fool when you're the one who
is constantly ignoring the facts. I'm really tired of such allegations,
I don't deserve being treated like an idiot here for all the work I
do in Debian.

>> The sole reason for this bug report is to free cmus from broken
>> and unwanted dependencies.
> 
> ...and the sole relevancy to discuss in this bugreport is therefore
> the bug reported.

No. This bug report exists because Alessio asked for it because Patrick
was asked several times and never responded. That's why the decision was
made by several people - including Alessio - to drop libroar2 from
Recommends to Suggests.

> It seems there are disagreement if cmus is broken and if the
> dependency is unwanted.

There is no disagreement between the people in charge. There is just
disagreement between the people in charge and bystanders who are
apparently not correctly informed because they don't read mail.

And since discussing this under these circumstances is futile
and Alessio has made the change anyway, I will pull out of this
discussion now.

Adrian

- -- 
 .''`.  John Paul Adrian Glaubitz
: :' :  Debian Developer - glaub...@debian.org
`. `'   Freie Universitaet Berlin - glaub...@physik.fu-berlin.de
  `-GPG: 62FF 8A75 84E0 2956 9546  0006 7426 3B37 F5B5 F913
-BEGIN PGP SIGNATURE-
Version: GnuPG v2

iQIcBAEBCAAGBQJVhnf0AAoJEHQmOzf1tfkTtnwQAIua12zw+7unxpFZdT/l+PZw
e3Gd/aR2QULnTKnMVyQxgUrQkS+CtyAjAS1oICM1HHvjh5VEz68xvfFN93yu2Hli
1AUj72Ro3+pXwPcYY8Q1YcDBOrqkgFSajtoi/4/FVgK9q8RZQIATorkOJUBWsZ8P
h7OWy3WQ5o4xPQ54SfG/U2N61abU32TA045yI3vRfwSk9H5y9kIpyhC6E5236RdN
DnOHJkRXUCHzuasKvQ+MenA29UXmz06FP0ob/wnMpkVONlfahSLSJd/T2wh5mQb1
w6JHcAiNPTzJ/hVOG+EySCkEO/D6ZCOYx8ADuDajlcCrfhRLO6HVY8fsSNHmmhY6
h7S5dqoP5R0cWPCWZYZMWFqxTUTUuRdoApiRa9f3slw+FqFQH3c0xd8juTyQ11WA
SpHRi1xe0OS6rNNiIIcVPyzZobzTxBo86hg7CKfPFaQOEkqYj1+RRXY9q7s/VVt/
XcgZT75UjvKqwvWJbg1fHawez0VawWDvQ93BVBnD+0IQX7u4ta7ssIoE7rXsC5u6
cjnm+JrIRJraSeKcAIkGs3vn9PfRkqIwe22lxJXKy/4tMi98ghdXimZBZ7jNGQyv
WqRnKpkYV3zTyBNnfQNfKL9XY0FJuCLD469/pntIBZCJZ8gigMLuOffg51ETJFNX
IDSva4QYpUpR01vcFgWC
=v9bO
-END PGP SIGNATURE-


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789461: ITP: runescape -- Complete quests and win enormous treasures in RuneScape

[Johannes Schauer]

Hi,

Quoting Carlos Donizete (2015-06-21 10:04:03)
> * Package name: runescape
>   Version : 0.1
>   Upstream Author : Jagex Limited 
> * URL : http://www.runescape.com/
> * License : GPL-2+
>   Programming Lang: Java
>   Description : Complete quests and win enormous treasures in RuneScape
> 
>  The game is a unofficial Linux client Java-based. It makes sure that 
>  OpenGL works when using Java7/OpenJDK7. 
>  .
>  RuneScape offers players a huge variety of benefits such as hundreds 
>  of additional quests and adventures, a larger game world to explore, 
>  exclusive skills and master and access to a whole host of minigames.
>  .
>  Players can also access the most powerful weaponry and armour in the game, 
>  create clan citadels with their friends and even build their very own house.

which client do you actually want to package? Where is the source? Are you
talking about https://launchpad.net/rsu-client ?

Because the official client is certainly not GPL-2+ (but I'd be happy to be
proven wrong).

And even if you package the GPL2 client above, then it will require to download
proprietary binaries from Jagex so has to go to non-free unfortunately :(

cheers, josch


signature.asc
Description: signature

Bug#788654: Acknowledgement (git push to host with sni does not work)

[Holger Schramm]

Hi,

after the update of libcurl3-gnutls everything is working again.
This report can be closed.

Regards,
Holger



signature.asc
Description: OpenPGP digital signature

Bug#789463: libunittest++-dev: i386 package built on Ubuntu

[Jakub Wilk]

Package: libunittest++-dev
Version: 1.4.0-3
Usertags: unclean-env

According to the .comment sections of the static library, the i386 
binary package was built on Ubuntu:


$ readelf -p .comment /usr/lib/libunittest++.a | grep GCC | uniq
 [ 1]  GCC: (Ubuntu 4.3.3-5ubuntu4) 4.3.3

Please build your packages in sid!


-- System Information:
Debian Release: stretch/sid
 APT prefers unstable
 APT policy: (500, 'unstable')
Architecture: i386 (i686)

Kernel: Linux 4.0.0-2-amd64 (SMP w/2 CPU cores)
Locale: LANG=C, LC_CTYPE=C (charmap=ANSI_X3.4-1968)
Shell: /bin/sh linked to /bin/dash
Init: sysvinit (via /sbin/init)

--
Jakub Wilk


--
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789464: libadios-dev: arch-dependent files in "Multi-Arch: same" package

[Jakub Wilk]

Package: libadios-dev
Version: 1.8.0-1
Severity: important
User: multiarch-de...@lists.alioth.debian.org
Usertags: multiarch

libadios-dev is marked as "Multi-Arch: same", but the following files 
are architecture-dependent:


/usr/share/doc/libadios-dev/examples/C/Makefile.gz
/usr/share/doc/libadios-dev/examples/C/arrays/Makefile.gz
/usr/share/doc/libadios-dev/examples/C/attributes/Makefile.gz
/usr/share/doc/libadios-dev/examples/C/flexpath_arrays/Makefile.gz
/usr/share/doc/libadios-dev/examples/C/flexpath_arrays/global_range_select/Makefile.gz
... and many other files in /usr/share/doc/libadios-dev/examples/.

An example diff between i386 and amd64 (after ungzipping) is attached.

--
Jakub Wilk


libadios-dev_1.8.0-1.archdiff.xz
Description: application/xz

Bug#789465: rtorrent: website has moved to github

[Paul Wise]

Package: rtorrent
Severity: minor

The upstream website has moved to github:

https://rakshasa.github.io/rtorrent/

-- 
bye,
pabs

https://wiki.debian.org/PaulWise



signature.asc
Description: This is a digitally signed message part

Bug#754567: fixed in rtorrent 0.9.4-1

[Paul Wise]

On Sat, 21 Mar 2015 15:49:39 + Jonathan McDowell wrote:

>  rtorrent (0.9.4-1) experimental; urgency=low
>  .
>* New upstream release. Closes: #754567.

Have you considered moving this to unstable?

-- 
bye,
pabs

https://wiki.debian.org/PaulWise



signature.asc
Description: This is a digitally signed message part

Bug#789329:

[Vincent Hobeïka]

found unstable
affects vera++
thanks


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789466: libtest-prereq-perl: FTBFS with perl 5.22 (Module::Build)

[Dominic Hargreaves]

Source: libtest-prereq-perl
Version: 1.038-1
Severity: important
User: debian-p...@lists.debian.org
Usertags: perl-5.22-transition
Tags: sid stretch

This package FTBFS with perl 5.22 (currently in experimental), since
Module::Build has been removed from perl core:

Can't locate Module/Build.pm in @INC (you may need to install the Module::Build 
module) (@INC contains: /«PKGBUILDDIR»/blib/lib /«PKGBUILDDIR»/blib/arch /etc/pe
rl /usr/local/lib/x86_64-linux-gnu/perl/5.22.0 /usr/local/share/perl/5.22.0 /usr
/lib/x86_64-linux-gnu/perl5/5.22 /usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl
/5.22 /usr/share/perl/5.22 /usr/local/lib/site_perl /usr/lib/x86_64-linux-gnu/pe
rl-base .) at /«PKGBUILDDIR»/blib/lib/Test/Prereq/Build.pm line 25.
BEGIN failed--compilation aborted at 
/«PKGBUILDDIR»/blib/lib/Test/Prereq/Build.pm line 25.
Compilation failed in require at t/get_prereqs.t line 7.
BEGIN failed--compilation aborted at t/get_prereqs.t line 7.

The fix is probably to add a build dependency on libmodule-build-perl.

This bug will become release critical nearer the time of the perl 5.22
migration, expected during the (northern hemisphere) summer.

Cheers,
Dominic.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#782400: multipath-tools: libmultipath: fix discovery of devices with empty rev sysfs attribute

[Ritesh Raj Sarraf]

On Thursday 28 May 2015 05:31 PM, Mauricio Faria de Oliveira wrote:
>> These days I don't work on storage, i.e. don't have a team that spends
>> > the time on these tools. So I keep the upstream first policy, for now.
>> > Even my patch (kpartx) is very trivial but 've put it on hold until
>> > Christoph accepts it.
>> > 
>> > If this really doesn't work in the long run, we may re-visit it.
> Ok, got it. Thanks for clarifying, I had misunderstood that.

Given that mulitpath doesn't do a release very often, I plan on rebasing
on the latest git repo (which includes many of Hannes' fixes). They only
reason I'm procrastinating is because neither of our patches have been
accepted/pushed by Christoph.

-- 
Ritesh Raj Sarraf
RESEARCHUT - http://www.researchut.com
"Necessity is the mother of invention."




signature.asc
Description: OpenPGP digital signature

Bug#789447: transition: qscintilla2

[Emilio Pozuelo Monfort]

Control: tags -1 confirmed

On 21/06/15 03:50, Scott Kitterman wrote:
> Package: release.debian.org
> Severity: normal
> User: release.debian@packages.debian.org
> Usertags: transition
> 
> Qscintilla2 2.9 is now available in experimental.  I've rebuilt all the
> reverse build-depends against the new packages and they built fine.  Ready to
> go to unstable.

Go ahead.

Emilio


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789467: ITP: graywolf -- Placement for digital VLSI design

[Ruben Undheim]

Package: wnpp
Severity: wishlist
Owner: ruben.undh...@gmail.com


* Package name: graywolf
  Version : 0.1.0
  Upstream Maintainer : Ruben Undheim / (Tim Edwards)
  Upstream original author: Yale University
* URL : https://github.com/rubund/graywolf
* License : GPL-2+ with Yale conditions
  Programming Lang: C
  Description : Placement for digital VLSI design

A placement tool known as TimberWolf was developed at Yale University
(1987-1992),
and was distributed as open source for a time until it was taken
commercial. The last
open-source version of this tool does not perform detail routing, but is a
professional-grade placement tool.

The tool has been forked and the fork is called graywolf.
It is a vital part of the qflow digital VLSI design flow.
(https://bugs.debian.org/761368)


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#787947: wheezy-pu: package didjvu/0.2.3-2

[Daniel Stender]

On 20.06.2015 21:32, Adam D. Barratt wrote:
> Control: tags -1 + confirmed
> 
> On Sat, 2015-06-06 at 19:54 +0200, Daniel Stender wrote:
>> I'm propose an update of didjvu in wheezy, 0.2.3-2+deb7u1.
>>
>> The patch is a security fix of #784888 [1] in oldstable, applied
>> already upstream in sid (closed by 0.4-1), and for 0.2.8-1+deb8u1.
> 
> Please go ahead, thanks.
> 
> Regards,
> 
> Adam
 
Done:

didjvu_0.2.3-2+deb7u1_amd64.changes ACCEPTED into 
oldstable-proposed-updates->oldstable-new

Thank you very much for checking this over.

Greetings,
Daniel

-- 
http://qa.debian.org/developer.php?login=debian%40danielstender.com
4096R/DF5182C8
46CB 1CA8 9EA3 B743 7676 1DB9 15E0 9AF4 DF51 82C8


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789028: transition: gnome-panel

[Emilio Pozuelo Monfort]

Control: tags -1 confirmed

On 17/06/15 11:32, Dmitry Shachnev wrote:
> Package: release.debian.org
> Severity: normal
> User: release.debian@packages.debian.org
> Usertags: transition
> 
> Dear Release Team,
> 
> I would like to upload the current experimental version of gnome-panel
> to unstable. In 3.14 the API was changed significantly, and the library
> was renamed from libpanelapplet-4.0 to libpanel-applet. Thus all reverse
> dependencies need porting.
> 
> Applets that used gnome-panel's gconf functionality to store their
> settings will not work with new version and need to be ported to gsettings
> first.
> 
> The current status of reverse dependencies in testing is:
> 
> command-runner-applet: Fixed version available in experimental, needs upload 
> to unstable
> gnome-applets: Fixed version available in experimental, needs upload to 
> unstable
> gnubiff: Debdiff available (https://bugs.debian.org/789026)
> link-monitor-applet: Not ported, maintainer is OK with removing it 
> (https://bugs.debian.org/772621)
> netspeed: This applet was merged in gnome-applets package, old source should 
> be removed
> sensors-applet: Not ported, dead upstream, needs removing from testing 
> (https://bugs.debian.org/772620)
> uim: Debdiff available (https://bugs.debian.org/789025)
> workrave: Needs build-dependency change, already committed to packaging git

Go ahead.

Cheers,
Emilio


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#786713: transition: libwps

[Emilio Pozuelo Monfort]

On 16/06/15 19:49, Emilio Pozuelo Monfort wrote:
> Let's do this after libreoffice migrates (which should happen soon,
> when evolution-data-server is ready).

britney was broken because of a problem in the archive, but that's now fixed and
everything migrated. You can proceed with this.

Cheers,
Emilio


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#788680: openni: FTBFS on mipsel "Unknown platform: mips64"

[Gustavo Prado Alkmim]

Hi.

Attached is a patch for enabling building openni for mipsel arch.

Can you please do a peer review?

Thanks,


Gustavo Prado Alkmim
Bacharel em Ciência da Computação (UFLA)
Doutorando em Ciência da Computação (UNICAMP)

--
"Do que adianta para o homem ganhar o mundo e perder sua alma???"

2015-06-14 6:56 GMT-03:00 James Cowgill :

> Control: severity -1 important
>
> On Sun, 2015-06-14 at 08:51 +0100, Gustavo Prado Alkmim wrote:
> > Package: openni
> > Version: 1.5.4.0-12
> > Severity: serious
> > Justification: fails to build from source
> >
> > Dear Maintainer,
> >
> > Package is failing to build on buildd. I'm working on a fix and I
> > will attach it as soon as possible. Full log is attached.
>
> Since openni has never built on mipsel (it's in the uncompiled state),
> this bug is not RC.
>
> I see you're working on the mips ports as part of GSoC - patches are
> welcome :)
>
> James
diff -rupN openni-1.5.4.0/debian/patches/0015-Add-mipsel-support.patch new.openni-1.5.4.0/debian/patches/0015-Add-mipsel-support.patch
--- openni-1.5.4.0/debian/patches/0015-Add-mipsel-support.patch	1970-01-01 00:00:00.0 +
+++ new.openni-1.5.4.0/debian/patches/0015-Add-mipsel-support.patch	2015-06-20 21:30:36.359637995 +
@@ -0,0 +1,182 @@
+Index: new.openni-1.5.4.0/Include/XnPlatform.h
+===
+--- new.openni-1.5.4.0.orig/Include/XnPlatform.h
 new.openni-1.5.4.0/Include/XnPlatform.h
+@@ -37,6 +37,7 @@
+ #define XN_PLATFORM_ANDROID_ARM 9
+ #define XN_PLATFORM_LINUX_POWERPC 10
+ #define XN_PLATFORM_LINUX_AARCH64 11
++#define XN_PLATFORM_LINUX_MIPSEL 12
+ 
+ #define XN_PLATFORM_IS_LITTLE_ENDIAN 1
+ #define XN_PLATFORM_IS_BIG_ENDIAN2
+@@ -72,6 +73,8 @@
+ 	#include "Linux-AArch64/XnPlatformLinux-AArch64.h"
+ #elif (__linux__ && __powerpc__)
+ 	#include "Linux-Powerpc/XnPlatformLinux-Powerpc.h"
++#elif (__linux__ && __mips__)
++	#include "Linux-Mipsel/XnPlatformLinux-Mipsel.h"
+ #elif _ARC
+ 	#include "ARC/XnPlatformARC.h"
+ #elif (__APPLE__)
+Index: new.openni-1.5.4.0/Platform/Linux/Build/Common/CommonDefs.mak
+===
+--- new.openni-1.5.4.0.orig/Platform/Linux/Build/Common/CommonDefs.mak
 new.openni-1.5.4.0/Platform/Linux/Build/Common/CommonDefs.mak
+@@ -22,6 +22,8 @@ else ifneq (,$(findstring aarch64,$(MACH
+ 	HOST_PLATFORM = AArch64
+ else ifneq (,$(findstring ppc,$(MACHINE)))
+ 	HOST_PLATFORM = Powerpc
++else ifneq (,$(findstring mips,$(MACHINE)))
++	HOST_PLATFORM = Mipsel
+ else
+ 	DUMMY:=$(error Can't determine host platform)
+ endif
+Index: new.openni-1.5.4.0/Platform/Linux/Build/Common/Platform.Mipsel
+===
+--- /dev/null
 new.openni-1.5.4.0/Platform/Linux/Build/Common/Platform.Mipsel
+@@ -0,0 +1,11 @@
++export GLUT_SUPPORTED=1
++
++ifeq "$(CFG)" "Release"
++
++# Optimization level, minus currently buggy optimizing methods (which break bit-exact)
++CFLAGS += -O3 -fno-tree-pre -fno-strict-aliasing
++
++# More optimization flags
++CFLAGS += -ftree-vectorize -ffast-math -funsafe-math-optimizations -fsingle-precision-constant
++
++endif
+Index: new.openni-1.5.4.0/Samples/NiViewer/NiViewer.cpp
+===
+--- new.openni-1.5.4.0.orig/Samples/NiViewer/NiViewer.cpp
 new.openni-1.5.4.0/Samples/NiViewer/NiViewer.cpp
+@@ -49,7 +49,7 @@
+ // 
+ #include 
+ 
+-#if (XN_PLATFORM == XN_PLATFORM_LINUX_X86 || XN_PLATFORM == XN_PLATFORM_LINUX_ARM || XN_PLATFORM == XN_PLATFORM_LINUX_AARCH64 || XN_PLATFORM == XN_PLATFORM_LINUX_POWERPC)
++#if (XN_PLATFORM == XN_PLATFORM_LINUX_X86 || XN_PLATFORM == XN_PLATFORM_LINUX_ARM || XN_PLATFORM == XN_PLATFORM_LINUX_AARCH64 || XN_PLATFORM == XN_PLATFORM_LINUX_POWERPC || XN_PLATFORM == XN_PLATFORM_LINUX_MIPSEL)
+ 	#define UNIX
+ 	#define GLX_GLXEXT_LEGACY
+ #endif
+@@ -79,7 +79,7 @@ using namespace glh;
+ #if (XN_PLATFORM == XN_PLATFORM_WIN32)
+ 	#include 
+ 	#include 	
+-#elif (XN_PLATFORM == XN_PLATFORM_LINUX_X86 || XN_PLATFORM == XN_PLATFORM_LINUX_ARM || XN_PLATFORM == XN_PLATFORM_LINUX_AARCH64 || XN_PLATFORM == XN_PLATFORM_MACOSX || XN_PLATFORM_LINUX_POWERPC)
++#elif (XN_PLATFORM == XN_PLATFORM_LINUX_X86 || XN_PLATFORM == XN_PLATFORM_LINUX_ARM || XN_PLATFORM == XN_PLATFORM_LINUX_AARCH64 || XN_PLATFORM == XN_PLATFORM_MACOSX || XN_PLATFORM_LINUX_POWERPC || XN_PLATFORM == XN_PLATFORM_LINUX_MIPSEL)
+ 	#define _getch() getchar()
+ #endif
+ 
+Index: new.openni-1.5.4.0/Source/OpenNI/XnOpenNI.cpp
+===
+--- new.openni-1.5.4.0.orig/Source/OpenNI/XnOpenNI.cpp
 new.openni-1.5.4.0/Source/OpenNI/XnOpenNI.cpp
+@@ -7062,7 +7062,7 @@ XN_C_API XnStatus xnScriptNodeRun(XnNode
+ 	#define XN_OPEN_NI_FILES_LOCATION "\\Data\\"
+ #elif (CE4100)
+ 	#define XN_OPEN_NI_FILES_LOCATION "/usr/etc/ni/"
+-#elif (XN_PLATFORM == XN_PLATFORM_LI

Bug#789468: bluetooth device name is inconsistent

[Praveen Arimbrathodiyil]

package: bluetooth
version: 5.23-2+b1

In gnome bluetooth settings device identification name is shown as 
"Blues 5.23" but the actual name is "dhcp-0". Also there is no way to 
change it.



--
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789469: Default configuration does not upgrade packages from debian-security

[Simon Van der Linden]

Package: unattended-upgrades
Version: 0.83.3.1

The default configuration of unattended-upgrade in Jessie does not let packages 
from debian-security be upgraded unattended.


# unattended-upgrade --debug
Initial blacklisted packages: 
Initial whitelisted packages: 
Starting unattended upgrades script
Allowed origins are: ['o=Debian,a=jessie-security']
Checking: libssl1.0.0 ([])
Checking: openssl ([])
pkgs that look like they should be upgraded: 
Fetched 0 B in 0s (0 B/s)   
  
fetch.run() result: 0
blacklist: []
whitelist: []
InstCount=0 DelCount=0 BrokenCount=0
No packages found that can be upgraded unattended
#


/etc/apt/apt.conf.d/50unattended-upgrades:
 
Unattended-Upgrade::Allowed-Origins {
"${distro_id}:${distro_codename}-security";
};


Using the following instead solves the problem:

Unattended-Upgrade::Origins-Pattern {

"origin=${distro_id},codename=${distro_codename},label=${distro_id}-Security";
};


--
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789256: cmus: Pulls in unwanted and potentially dangerous DECnet packages through libroar2

[Stephan Jauernick]

Hi Adrian,

On Sun, Jun 21, 2015 at 10:29:21AM +0200, John Paul Adrian Glaubitz wrote:
> On 06/21/2015 02:31 AM, Jonas Smedegaard wrote:
> >> Even just checking for the existence of dnet-common or similar
> >> would probably be enough.
> > 
> > As I understand it, these are the issues raised here:
> 
> You understand incorrectly then.
> 
> > a) libdnet is unmaintained and thus potentially dangerous to link 
> > against
> > 
> > b) dnet-common commonly (or always by default?) cause whole system
> > to hang
> 
> *Not* dnet-common, _libdnet_, seriously, read what I wrote!
> 

libdnet is just a wrapper. You are jumping to unconfirmed conclusions
here. 

> > I disagree that any of above are bugs in cmus.
> 
> Again, you are not reading what I wrote. Please leave the discussion
> if you refuse to do so! Alessio Teglia, one of the cmus maintainers
> himself said "Please file a bug report against cmus and ask for
> libroar2 to be demoted from Recommends to Suggests".
> 

The roar and pulse dependencies are now only installed per suggests.

You will probably still get the unconfirmed bug if you use the
--install-suggests switch for apt. As that will pullin the stuff.

Maybe the proper way might have been to put them into seperate plugin
binary packages like it is done for cmus-plugin-ffmpeg?

If not then you will encounter the funny problem that cmus might not
start anymore if you don't have  libroar or libpulse installed.

In my test it produced a considerable hang on the first launch while it
tried to find a audio output.

Btw. I could neither reproduce your bug on a debian jessie -> testing upgrade.

You did a great job there.

1. Threatening with the Technical Commitee Sledgehammer against cmus
2. Possible usability problems for cmus
3. Doing nothing to fix or locate the original problem

The propper course of action, regardless if dnprogs is unmaintained or
not, would have been to debugg the problem. After that to clearly
isolate the component inside roaraudio/dnet/cmus/whatever and then file
a appropriate bug. If this would then be a request to drop the linkage
or a bugfix against one of the componts doesn't matter.

You could have simply opened a bugrequest against roaraudio to drop the
decnet dependency and then if nothing happens consulted the TC. 

If you would have read the two bugrequests you have linked then you would
find out that these were either already answered with a description and
a note that dnet-common won't be a recommended dep anymore or that there
are next to no informations at all.

But neither are you fixing the problem at the right place nor is unclear
if you are fixing it at all.

What is if its a legitimate bug? Now others will stumble upon it and
have to work it out themselves. While it could have been debugged without
much invested time on your side.

If this is how debian works nowdays I am unsure if i want to continue
using it.

Why do i even care? Sorry if you see it as insultive, but it seems to me
that you fail to see reason and are just mindlessly focussed on getting
rid of roaraudio via the wrong methods and actions. 

Thanks.

> Fy fæn, Jonas. Les hva folk skrev før to du svarer eposten!
> 
> Adrian
> 
> -- 
>  .''`.  John Paul Adrian Glaubitz
> : :' :  Debian Developer - glaub...@debian.org
> `. `'   Freie Universitaet Berlin - glaub...@physik.fu-berlin.de
>   `-GPG: 62FF 8A75 84E0 2956 9546  0006 7426 3B37 F5B5 F913

Kind Regards,
Stephan


signature.asc
Description: Digital signature

Bug#788064: wheezy-pu: package gamera/3.3.3-2

[Daniel Stender]

On 20.06.2015 21:40, Adam D. Barratt wrote:
> Control: tags -1 + confirmed
> 
> On Mon, 2015-06-08 at 11:07 +0200, Daniel Stender wrote:
>> I propose an update of gamera in wheezy, 3.3.3-2+deb7u1.
>>
>> The new patch is a fix of CVE-2014-1937 [1].
>>
>> Please see the attached debdiff for details.
> 
> diff -Nru gamera-3.3.3/debian/changelog gamera-3.3.3/debian/changelog
> --- gamera-3.3.3/debian/changelog   2015-06-07 10:02:47.0 +0200
> +++ gamera-3.3.3/debian/changelog   2012-07-04 16:50:40.0 +0200
> @@ -1,10 +1,3 @@
> -gamera (3.3.3-2+deb7u1) oldstable; urgency=medium
> -
> -  * add avoid_mktexmp.diff to fix CVE-2014-1937 (related bug #737324
> -was closed in Sid by 3.4.1-1).
> 
> I assume you're actually proposing the reverse of that. :-)
> 
> Please go ahead.
> 
> Regards,
> 
> Adam

Diffs sometimes are fun :-)

Here we go:
gamera_3.3.3-2+deb7u1_amd64.changes ACCEPTED into 
oldstable-proposed-updates->oldstable-new

Thanks,
Daniel

-- 
http://qa.debian.org/developer.php?login=debian%40danielstender.com
4096R/DF5182C8
46CB 1CA8 9EA3 B743 7676 1DB9 15E0 9AF4 DF51 82C8


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#788691: new version of meep-mpi-default

[Thorsten Alteholz]

Hi,

thanks for reporting this bug, the new version of meep-mpi-default will be 
uploaded soon. Nevertheless I will start with meep ...


  Thorsten


--
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#787933: wheezy-pu: package pdf2djvu/0.7.12-2

[Daniel Stender]

On 20.06.2015 21:31, Adam D. Barratt wrote:
> Control: tags -1 + confirmed
> 
> On Sat, 2015-06-06 at 16:02 +0200, Daniel Stender wrote:
>> I propose an update of pdf2djvu in Wheezy, 0.7.12-2+deb7u1.
>>
>> The patch is a security fix of #784889, already applied in Sid
>> (closed by 0.7.21-1) and Jessie.
>>
>> I've build with Sbuild against oldstable, please see the buildlog
>> here [2]. To prevent the execution of make distclean which fails
>> I've also just added an empty override for dh_auto_clean.
> 
> For clarity it might be worth explicitly mentioning the distclean issue
> in the changelog entry for that change.
> 
> Please go ahead.
> 
> Regards,
> 
> Adam

O.k! I've added a pointer for background info.

Uploaded:
pdf2djvu_0.7.12-2+deb7u1_amd64.changes ACCEPTED into 
oldstable-proposed-updates->oldstable-new

Best once more,
Daniel

-- 
http://qa.debian.org/developer.php?login=debian%40danielstender.com
4096R/DF5182C8
46CB 1CA8 9EA3 B743 7676 1DB9 15E0 9AF4 DF51 82C8


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#776143: Avoid appending timestamps to generated manpages

[Esa Peuha]

Since this package is now orphaned [1], it is possible to just do a QA
upload [2] to fix this issue instead of waiting for someone to adopt the
package (which might take a long time).

[1] http://bugs.debian.org/782433
[2] 
https://www.debian.org/doc/manuals/developers-reference/ch05.en.html#nmu-qa-upload


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789470: libunix-configfile-perl: FTBFS with perl 5.22: Can't use 'defined(@array)'

[Dominic Hargreaves]

Source: libunix-configfile-perl
Version: 0.6-1
Severity: important
User: debian-p...@lists.debian.org
Usertags: perl-5.22-transition
Tags: sid stretch upstream patch
Forwarded: https://rt.cpan.org/Public/Bug/Display.html?id=103189

This package FTBFS with perl 5.22 (currently in experimental):

Can't use 'defined(@array)' (Maybe you should just omit the defined()?) at blib/
lib/Unix/AliasFile.pm line 216.
Compilation failed in require at test.pl line 13.
BEGIN failed--compilation aborted at test.pl line 13.

This bug will become release critical nearer the time of the perl 5.22
migration, expected during the (northern hemisphere) summer.

Cheers,
Dominic.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789429: Acknowledgement (jessie-pu: package evolution-data-server/evolution-data-server_3.12.11-0+deb8u1.dsc)

[Fabian Greffrath]

Hi again,

I am not sure why this request has not hit debian-release@l.d.o, yet. I
hope it is just because of the mere size of the attachment.

However, I'd like to add two more facts to this request:

1) I made a mistake composing the debian/changelog file when I assigned
everything to Josselin. The actual debian/changelog should look like
this:

evolution-data-server (3.12.11-0+deb8u1) jessie; urgency=medium

  * Team upload.

  [ Josselin Mouette ]
  * New upstream bugfix release.
  * Bump valac build-dependency.
  * d/p/03_Use-after-free-gpg-verif.patch,
d/p/04_sqlite-Track-pending-sync-requests.patch:
Dropped, applied upstream.

  [ Fabian Greffrath ]
  * d/p/05_imapx-Shared-folders-removed-folder-list-refresh.patch:
Refreshed (Closes: #787624).
  * d/p/06_Make-camel-stream-write-try-to-write-all-bytes-at-once.patch:
Fix SMTP connection lost while reading message data (Closes: #787398).

 -- Fabian Greffrath   Sat, 20 Jun 2015 23:27:20 +0200

2) There is a patch to the upstream NEWS file hidden in the debdiff
that should make it easier to evaluate the upstream stable point
upgrade. I repeat it here for your convenience:

diff -Nru evolution-data-server-3.12.9~git20141128.5242b0/NEWS 
evolution-data-server-3.12.11/NEWS
--- evolution-data-server-3.12.9~git20141128.5242b0/NEWS2014-11-28 
15:30:16.0 +0100
+++ evolution-data-server-3.12.11/NEWS  2015-02-09 09:07:49.0 +0100
@@ -1,5 +1,67 @@
+Evolution-Data-Server 3.12.11 2015-02-09
+
+
+Bug Fixes:
+   Bug 736006 - Crash under backend_finalize() during online state change 
(Milan Crha)
+   Bug 732145 - Breaks existing (not evolution's) maildir folder structure 
(Milan Crha)
+
+Miscellaneous:
+   [ECalClient] Do not replace cached timezones (Milan Crha)
+
+Translations:
+   Aurimas Černius (lt)
+   Piotr Drąg (pl)
+   Balázs Úr (hu)
+   Marek Černocký (cs)
+
+Evolution-Data-Server 3.12.10 2015-01-12
+
+
+Bug Fixes:
+   Bug 695754 - Use-after-free in 
source_registry_source_notify_enabled_idle_cb() (Milan Crha)
+   Bug 741434 - Use-after-free after error in GPG signature verification 
(Milan Crha)
+   Bug 741699 - Fix "incompatible pointer type" compiler warning (Debarshi 
Ray)
+   Bug 741786 - Gets stuck while closing fds before execing gpg (Debarshi 
Ray)
+   Bug 741787 - [Maildir] Cannot create subfolder 'Inbox' (Milan Crha)
+   Bug 741557 - Bump vala dependency to version 0.22 (Milan Crha)
+
+Miscellaneous:
+   Fix "may be used uninitialized" warning (Fabiano Fidêncio)
+   EDataBook/Cal: Complete Refresh operation in IDLE (Milan Crha)
+
+Evolution-Data-Server 3.12.9 2014-12-08
+---
+
+Bug Fixes:
+   Bug 739904 - Can't create Contact List on an LDAP server (Milan Crha)
+   Bug 678398 - Make evolution-source-registry debugging configurable 
(Milan Crha)
+   Bug 739610 - [IMAPx] Prevent running FETCH and STORE at the same time 
(Milan Crha)
+   Bug 736011 - [CalDAV] Receive two events adds only the first (Milan 
Crha)
+   Bug 736947 - Attachment icon not shown in Sent folder (Milan Crha)
+   Bug 732717 - Refreshing an IMAP account does not refresh folder list 
(Milan Crha)
+   Bug 733518 - Make VOICE type optional for TEL in EContact (Milan Crha)
+   Bug 732018 - Crash due to passing set GError to glib-networking (Milan 
Crha)
+   Bug 740627 - [IMAPx] Cannot append to a write-only folder (Milan Crha)
+   Bug 701138 - Make e_cal_backend_sexp_match_comp() thread safe (Milan 
Crha)
+   Bug 740585 - [IMAPx] Ignore timeout when no command is running (Milan 
Crha)
+   Bug 740843 - Correct documentation of e_cal_client_remove_object_sync() 
(Mateusz Polrola)
+
+Miscellaneous:
+   [ECalBackendFile] Stops refresh thread too late (Milan Crha)
+   ECalComponent: Recurrence ID not rescan properly (Milan Crha)
+   Limit SQLite busy-wait for a lock (Milan Crha)
+   [IMAPx] Speed-up folder cache removal on folder sync (Milan Crha)
+   [IMAPx] Enhance and make work namespace override options (Milan Crha)
+   [IMAPx] Runtime warning on inactivity timeout with IDLE enabled (Milan 
Crha)
+   [SQLite VFS] Track pending sync requests (Milan Crha)
+
+Translations:
+   Sweta Kothari (gu)
+   YunQiang Su (zh_CN)
+   Pedro Albuquerque (pt)
+
 Evolution-Data-Server 3.12.8 2014-11-10
--
+---
 
 Bug Fixes:
Bug 737733 - [IMAPx] Prevent "Stream has outstanding operation" error 
(Milan Crha)


Best regards,

Fabian


signature.asc
Description: This is a digitally signed message part

Bug#789472: psi-plus: Fail to login in gtalk with new qca2-ossl

[Charles Malaheenee]

Package: psi-plus
Version: 0.16.330-1+b1
Severity: normal
Tags: upstream

Dear Maintainer,

Since update of libqca2-plugin-ossl (replaced by libqca2-plugins) psi-plus is
unable to connect with google-talk services with error like "unknown ssl
connection".
Temporary solution - hold old libqca2 package.

Best regards,
Malaheenee



-- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (990, 'unstable'), (500, 'testing'), (1, 'experimental')
Architecture: amd64 (x86_64)

Kernel: Linux 3.13-1-amd64 (SMP w/2 CPU cores)
Locale: LANG=fr_CA.UTF-8, LC_CTYPE=fr_CA.UTF-8 (charmap=UTF-8) (ignored: LC_ALL 
set to fr_CA.UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages psi-plus depends on:
ii  libaspell15  0.60.7~20110707-3
ii  libc62.19-18
ii  libgcc1  1:5.1.1-9
ii  libidn11 1.30-1
ii  libqca2  2.1.0.3-3
ii  libqt4-dbus  4:4.8.7+dfsg-1
ii  libqt4-network   4:4.8.7+dfsg-1
ii  libqt4-svg   4:4.8.7+dfsg-1
ii  libqt4-xml   4:4.8.7+dfsg-1
ii  libqtcore4   4:4.8.7+dfsg-1
ii  libqtgui44:4.8.7+dfsg-1
ii  libstdc++6   5.1.1-9
ii  libx11-6 2:1.6.3-1
ii  libxss1  1:1.2.2-1
ii  psi-plus-common  0.16.330-1
ii  zlib1g   1:1.2.8.dfsg-2+b1

Versions of packages psi-plus recommends:
pn  libqca2-plugin-ossl  
ii  psi-plus-l10n0.16.330-1
pn  psi-plus-plugins 
ii  psi-plus-sounds  0.16.330-1
pn  sox  

Versions of packages psi-plus suggests:
pn  libqca2-plugin-gnupg  
ii  xdg-utils 1.1.0~rc1+git20111210-7.4

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789471: cg3: FTBFS on buildds

[Pino Toscano]

Source: cg3
Version: 0.9.9~r10439-1
Severity: serious
Tags: patch
Justification: fails to build from source

Hi,

cg3 does not build on Debian buildds.

This is because among the build dependencies there is:
  libboost1.48-dev | libboost-dev (>= 1.49.0)
given that on buildds only the first element of an OR is used (to make
sure the build does not change depending on temporary issues of the
alternatives), and that libboost1.48-dev does not exist.

The solution is to use libboost-dev only, with the minimum version
"lowered" to 1.48 (to include the former alternative option).
Patch attached for it.

Thanks,
-- 
Pino
--- a/debian/control
+++ b/debian/control
@@ -6,7 +6,7 @@ Uploaders: Tino Didriksen 
 Build-Depends: cmake (>= 2.8.9),
debhelper (>= 9.0),
-   libboost1.48-dev | libboost-dev (>= 1.49.0),
+   libboost-dev (>= 1.48),
libicu-dev (>= 4.8)
 Standards-Version: 3.9.6
 Homepage: http://visl.sdu.dk/cg3.html

Bug#789473: does not detect debian kernel as distri kernel

[Timo Weingärtner]

Package: needrestart
Version: 2.1-1
Severity: normal

on stretch:
# needrestart -bkv
[main] eval /etc/needrestart/needrestart.conf
[main] running in root-mode
[main] detected systemd
NEEDRESTART-VER: 2.1
[Kernel] Linux: kernel release 3.16.0-4-amd64, kernel version #1 SMP Debian 
3.16.7-ckt9-3 (2015-04-23)
[Kernel/Linux] /boot/vmlinuz-3.16.0-4-amd64 => 3.16.0-4-amd64 
(debian-ker...@lists.debian.org) #1 SMP Debian 3.16.7-ckt11-1 (2015-05-24) 
[3.16.0-4-amd64]
[Kernel/Linux] Expected linux version: 3.16.0-4-amd64
NEEDRESTART-KCUR: 3.16.0-4-amd64
NEEDRESTART-KEXP: 3.16.0-4-amd64
NEEDRESTART-KSTA: 2

on jessie:
# needrestart -bkv
NEEDRESTART-VER: 1.2
[Kernel] Linux: kernel release 3.16.0-4-amd64, kernel version #1 SMP Debian 
3.16.7-ckt9-3~deb8u1 (2015-04-24)
Failed to load NeedRestart::Kernel::kFreeBSD: [Kernel/kFreeBSD] Not running on 
GNU/kFreeBSD!
[Kernel/Linux] /boot/vmlinuz-3.16.0-4-amd64 => 3.16.0-4-amd64 
(debian-ker...@lists.debian.org) #1 SMP Debian 3.16.7-ckt11-1 (2015-05-24) 
[3.16.0-4-amd64]
[Kernel/Linux] Expected kernel version: 3.16.0-4-amd64
NEEDRESTART-KCUR: 3.16.0-4-amd64
NEEDRESTART-KEXP: 3.16.0-4-amd64
NEEDRESTART-KSTA: 2

on wheezy:
# needrestart -bkv
NEEDRESTART-VER: 1.2
[Kernel] Linux: kernel release 3.2.0-4-amd64, kernel version #1 SMP Debian 
3.2.68-1+deb7u1
[Kernel/Linux] /boot/vmlinuz-3.2.0-4-amd64 => 3.2.0-4-amd64 
(debian-ker...@lists.debian.org) #1 SMP Debian 3.2.68-1+deb7u2 [3.2.0-4-amd64]
[Kernel/Linux] Expected kernel version: 3.2.0-4-amd64
NEEDRESTART-KCUR: 3.2.0-4-amd64
NEEDRESTART-KEXP: 3.2.0-4-amd64
NEEDRESTART-KSTA: 2

This means that you can't tell from batch mode output if a reboot is needed.

Please also backport the fix to wheezy and jessie.


Regards
Timo

-- Package-specific info:
needrestart output:
Your outdated processes:
[removed, this bug is about kernels]

checkrestart output:


-- System Information:
Debian Release: stretch/sid
  APT prefers testing
  APT policy: (900, 'testing'), (800, 'unstable')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 3.16.0-4-amd64 (SMP w/8 CPU cores)
Locale: LANG=de_DE.UTF-8, LC_CTYPE=de_DE.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages needrestart depends on:
ii  dpkg   1.18.1
ii  libmodule-find-perl0.12-1
ii  libmodule-scandeps-perl1.19-1
ii  libproc-processtable-perl  0.51-1
ii  libsort-naturally-perl 1.03-1
ii  libterm-readkey-perl   2.32-2
ii  perl   5.20.2-6

needrestart recommends no packages.

Versions of packages needrestart suggests:
ii  libnotify-bin  0.7.6-2

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789474: gnome-settings-daemon: Keyboard shortcuts do not work after update to version 3.16.2-3

[Marcel Lippmann]

Package: gnome-settings-daemon
Version: 3.16.2-3
Severity: normal

Dear Maintainer,

After updating gnome-settings-daemon to version 3.16.2-3 several keyboard
shortcuts (lock screen, custom shortcuts, …) and hardware buttons (volume,
screen brightness, …) stopped working.

Downgrading the package back to version 3.14.2-3 (stable version) resolved the
issue.  However, after downgrading several mouse and touchpad settings have no
effect.

If you need more information or this behaviour is already known, please let me
know.


-- System Information:
Debian Release: stretch/sid
  APT prefers testing
  APT policy: (500, 'testing'), (500, 'stable')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 3.16.0-4-amd64 (SMP w/4 CPU cores)
Locale: LANG=en_GB.utf8, LC_CTYPE=en_GB.UTF-8 (charmap=UTF-8) (ignored: LC_ALL 
set to en_GB.UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages gnome-settings-daemon depends on:
ii  dconf-gsettings-backend [gsettings-backend]  0.24.0-2
ii  gsettings-desktop-schemas3.16.1-1
ii  libc62.19-18
ii  libcairo21.14.2-2
ii  libcanberra-gtk3-0   0.30-2.1
ii  libcanberra0 0.30-2.1
ii  libcolord2   1.2.1-1+b2
ii  libcups2 1.7.5-12
ii  libfontconfig1   2.11.0-6.3
ii  libgdk-pixbuf2.0-0   2.31.4-2
ii  libgeocode-glib0 3.16.2-1
ii  libglib2.0-0 2.44.1-1
ii  libgnome-desktop-3-103.16.2-2
ii  libgtk-3-0   3.16.4-2
ii  libgudev-1.0-0   230-1
ii  libgweather-3-6  3.16.1-1
ii  liblcms2-2   2.6-3+b3
ii  libnm-glib4  1.0.2-2
ii  libnm-util2  1.0.2-2
ii  libnotify4   0.7.6-2
ii  libnspr4 2:4.10.8-2
ii  libnss3  2:3.19.1-2
ii  libpackagekit-glib2-18   1.0.6-1
ii  libpam-systemd   215-18
ii  libpango-1.0-0   1.36.8-3
ii  libpangocairo-1.0-0  1.36.8-3
ii  libpolkit-gobject-1-00.105-8
ii  libpulse-mainloop-glib0  6.0-2
ii  libpulse06.0-2
ii  librsvg2-2   2.40.9-2
ii  libupower-glib3  0.99.3-1+b1
ii  libwacom20.8-1
ii  libwayland-client0   1.8.1-1
ii  libx11-6 2:1.6.3-1
ii  libxext6 2:1.3.3-1
ii  libxi6   2:1.7.4-1+b2
ii  libxtst6 2:1.2.2-1+b1
ii  nautilus-data3.14.2-1

Versions of packages gnome-settings-daemon recommends:
ii  pulseaudio  6.0-2

Versions of packages gnome-settings-daemon suggests:
ii  gnome-screensaver3.6.1-4
ii  metacity [x-window-manager]  1:3.14.3-1
ii  mutter [x-window-manager]3.14.4-2+b1
ii  x11-xserver-utils7.7+4

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#766880: xscreensaver screensaver don't appear in mate-screensaver

[Tormod Volden]

On Sat, Jun 20, 2015 at 4:59 PM, Jonas Smedegaard wrote:
>
> I would guess that GNOME uses gnome-screensaver instead and therefore
> has no use (other than indirectly) for xscreensaver.  But I don't know,

Actually GNOME was the original reason for shipping the desktop files.
The xscreensaver daemon and configuration tools do not use the desktop
files. They were only shipped so that people could use the hacks in
xscreensaver-data/gl packages with gnome-screensaver. How this works
in GNOME land today, I don't know. Technically, what was GNOME then is
Mate now, or something.

> and if you don't either then I suggest to treat them equally to any
> other DE: Let them speak up themselves if they need special treatment!
>
>
>> If all the DE maintainers are on the debian-desktop ML, I can ask
>> there.
>
> Even if they are not, I consider that list the appropriate place to ask:
> To be extra nice (and as bonus promote the existence of that list!) I
> suggest to do careful cross-posting:
>
>  a) put only debian-desktop@ as To:
>  b) Cc: any other lists you may find relevant
>  c) add debian-desktop@ also as Mail-Followup-To: and Mail-Reply-To:
> (the latter for MUAs not supporting the former) and mention
> explicitly at the top and bottom of your mail that you recommend
> any followup response to go _only_ to debian-desktop@.

Thanks, a good idea. I don't know of any for (b) other then
debian-devel. You could say any DE disqualifies if is not represented
on debian-desktop...

Regards,
Tormod


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#761310: [pkg-cinnamon] Bug#761310: cinnamon-common: The digital photo frame desklet does not recurse into subdirectories

[Fabio Fantoni]

Il 12/09/2014 21:38, Martín Ferrari ha scritto:
> Package: cinnamon-common
> Version: 2.2.16-3
> Severity: wishlist
> Tags: patch
>
> Hi, much to my surprise, the photoframe desklet will not show pictures in
> subdirectories, which is a useful feature if you want to have all your 
> pictures
> shown.
>
> I made a simple patch, but it is probably not the best way, as it takes quite 
> a while to preload all images, but it is a suggestion.

Hi, probably is good post it as PR in upstream git, so will be
considered for 2.8:
https://github.com/linuxmint/Cinnamon/pulls

>
> --- /tmp/desklet.js.orig2 2014-09-12 20:32:48.453444788 +0100
> +++ /usr/share/cinnamon/desklets/photofr...@cinnamon.org/desklet.js   
> 2014-09-12 20:27:21.077437008 +0100
> @@ -113,7 +113,22 @@
>  this.dir_monitor_id = null
>  }
>  },
> -
> +_scan_dir: function(dir) {
> +let dir_file =  Gio.file_new_for_path(dir);
> +let fileEnum = dir_file.enumerate_children('standard::*',
> +Gio.FileQueryInfoFlags.NONE, null);
> +let info;
> +while ((info = fileEnum.next_file(null)) != null) {
> +let fileType = info.get_file_type();
> +let fileName = dir + "/" + info.get_name();
> +if (fileType == Gio.FileType.DIRECTORY) {
> +this._scan_dir(fileName);
> +} else {
> +this._loadImage(fileName);
> +}
> +}
> +fileEnum.close(null);
> +},
>  setup_display: function() {
>  this._photoFrame = new St.Bin({style_class: 'photoframe-box', 
> x_align: St.Align.START});
>  
> @@ -142,17 +157,7 @@
>  }
>  
>  if (this.dir_file.query_exists(null)) {
> -let fileEnum = this.dir_file.enumerate_children('standard::*', 
> Gio.FileQueryInfoFlags.NONE, null);
> -let info;
> -while ((info = fileEnum.next_file(null)) != null) {
> -let fileType = info.get_file_type();
> -if (fileType != Gio.FileType.DIRECTORY) {
> -this._loadImage(this.dir + "/" + info.get_name());
> -}
> -}
> -
> -fileEnum.close(null);
> -
> +this._scan_dir(this.dir);
>  this.updateInProgress = false;
>  this.currentPicture = null;
>  this._update_loop();
>
>
> -- System Information:
> Debian Release: jessie/sid
>   APT prefers testing
>   APT policy: (500, 'testing'), (100, 'unstable'), (50, 'experimental')
> Architecture: amd64 (x86_64)
>
> Kernel: Linux 3.14-2-amd64 (SMP w/4 CPU cores)
> Locale: LANG=en_IE.UTF-8, LC_CTYPE=en_IE.UTF-8 (charmap=UTF-8)
> Shell: /bin/sh linked to /bin/dash
>
> Versions of packages cinnamon-common depends on:
> ii  dconf-gsettings-backend [gsettings-backend]  0.20.0-2
> ii  gir1.2-meta-muffin-0.0   2.2.6-3
> ii  python   2.7.8-1
> ii  python-pil   2.5.3-1
>
> cinnamon-common recommends no packages.
>
> cinnamon-common suggests no packages.
>
> -- no debconf information
>
> https://lists.alioth.debian.org/mailman/listinfo/pkg-cinnamon-team
> to unsubscribe: 
> mailto:pkg-cinnamon-team-requ...@lists.alioth.debian.org?subject=unsubscribe
>
>




smime.p7s
Description: Firma crittografica S/MIME

Bug#789460: sharing is turned on

[Pirate Praveen]

bluetooth sharing is turned on from "Sharing"



signature.asc
Description: OpenPGP digital signature

Bug#788388: [pkg-cinnamon] Bug#788388: cinnamon: Cinnamon crashes on loading, goes to Fallback, difficulty with use

[Fabio Fantoni]

Il 13/06/2015 10:51, Robert Hackbauer ha scritto:
> Package: cinnamon
> Version: 2.2.16-5
> Followup-For: Bug #788388
>
> Dear Maintainer,
>
> I have the same problem with Cinnamon after updating some cinnamon-packages
> amongst others. Directly after starting up, the dialog appears to either
> restart Cinnamon or go to fallback mode.

Was for all cinnamon components updated to 2.6 except cinnamon that was
blocked in NEW queue.

>
> When I enter cinnamon into the command line, the following error message comes
> up:
>
> cinnamon: symbol lookup error: cinnamon: undefined symbol:
> meta_plugin_type_register
>
>
> The log from the update before this error occured:
>
> Commit Log for Fri Jun 12 18:38:50 2015
>
>
> Die folgenden Pakete wurden vollständig entfernt:
> (The following packages were purged:)
> libglib2.0-0:i386
> libgstreamer-plugins-base0.10-0:i386
> libgstreamer0.10-0:i386
> libhogweed2
> libhogweed2:i386
> libnettle4:i386
> libplist2
> libqt4-webkit
>
> Die folgenden Pakete wurden aktualisiert:
> (The following packages were updated:)
> accountsservice (0.6.37-3+b1) to 0.6.40-2
> audacity (2.0.6-2) to 1:2.1.0-dmo2
> audacity-data (2.0.6-2) to 1:2.1.0-dmo2
> cinnamon-control-center (2.2.11-4) to 2.6.0-1
> cinnamon-control-center-data (2.2.11-4) to 2.6.0-1
> cinnamon-desktop-data (2.2.3-3) to 2.6.4-1
> cinnamon-l10n (2.2.4-1) to 2.6.2-1
> cinnamon-screensaver (2.2.4-6) to 2.6.3-1
> cinnamon-session (2.2.2-5) to 2.6.2-1
> cinnamon-session-common (2.2.2-5) to 2.6.2-1
> cinnamon-settings-daemon (2.2.4.repack-7) to 2.6.2-1
> cjs (2.2.2-2) to 2.6.0-1
> cups (1.7.5-11) to 1.7.5-12
> cups-bsd (1.7.5-11) to 1.7.5-12
> cups-client (1.7.5-11) to 1.7.5-12
> cups-common (1.7.5-11) to 1.7.5-12
> cups-core-drivers (1.7.5-11) to 1.7.5-12
> cups-daemon (1.7.5-11) to 1.7.5-12
> cups-ppdc (1.7.5-11) to 1.7.5-12
> cups-server-common (1.7.5-11) to 1.7.5-12
> deb-multimedia-keyring (2014.2) to 2015.6.1
> dnsmasq-base (2.72-3.1) to 2.72-3.1+b1
> docbook-xml (4.5-7.2) to 4.5-7.3
> dpkg (1.17.25) to 1.18.1
> dpkg-dev (1.17.25) to 1.18.1
> fonts-opensymbol (2:102.6+LibO4.4.3-1) to 2:102.6+LibO4.4.4~rc1-1
> fritzing (0.9.0b+dfsg-1) to 0.9.0b+dfsg-1.1
> fritzing-data (0.9.0b+dfsg-1) to 0.9.0b+dfsg-1.1
> gcc-5-base (5.1.1-8) to 5.1.1-9
> gcc-5-base:i386 (5.1.1-8) to 5.1.1-9
> gir1.2-accountsservice-1.0 (0.6.37-3+b1) to 0.6.40-2
> gir1.2-cinnamondesktop-3.0 (2.2.3-3) to 2.6.4-1
> gir1.2-cmenu-3.0 (2.2.0-3) to 2.6.0-1
> gir1.2-gnomebluetooth-1.0 (3.14.1-1) to 3.16.1-1
> gir1.2-meta-muffin-0.0 (2.2.6-4) to 2.6.1-1
> gir1.2-upowerglib-1.0 (0.99.2-3) to 0.99.3-1+b1
> gnome-bluetooth (3.14.1-1) to 3.16.1-1
> gnupg-agent (2.0.27-2) to 2.0.28-1
> gnupg2 (2.0.27-2) to 2.0.28-1
> google-chrome-stable (43.0.2357.81-1) to 43.0.2357.125-1
> gstreamer1.0-plugins-bad (1.4.5-2) to 1.4.5-2+b1
> gvfs (1.24.1-2) to 1.24.1-2+b1
> gvfs-backends (1.24.1-2) to 1.24.1-2+b1
> gvfs-bin (1.24.1-2) to 1.24.1-2+b1
> gvfs-daemons (1.24.1-2) to 1.24.1-2+b1
> gvfs-libs (1.24.1-2) to 1.24.1-2+b1
> libaccountsservice0 (0.6.37-3+b1) to 0.6.40-2
> libarchive13 (3.1.2-11) to 3.1.2-11+b1
> libatk-wrapper-java (0.30.5-1) to 0.33.0-2
> libatk-wrapper-java-jni (0.30.5-1) to 0.33.0-2
> libatomic1 (5.1.1-8) to 5.1.1-9
> libavdevice55 (6:11.4-1) to 6:11.4-2
> libcilkrts5 (5.1.1-8) to 5.1.1-9
> libcinnamon-control-center1 (2.2.11-4) to 2.6.0-1
> libcinnamon-desktop4 (2.2.3-3) to 2.6.4-1
> libcinnamon-menu-3-0 (2.2.0-3) to 2.6.0-1
> libcjs0 (2.2.2-2) to 2.6.0-1
> libcups2 (1.7.5-11) to 1.7.5-12
> libcupscgi1 (1.7.5-11) to 1.7.5-12
> libcupsimage2 (1.7.5-11) to 1.7.5-12
> libcupsmime1 (1.7.5-11) to 1.7.5-12
> libcupsppdc1 (1.7.5-11) to 1.7.5-12
> libdpkg-perl (1.17.25) to 1.18.1
> libgcc1 (1:5.1.1-8) to 1:5.1.1-9
> libgcc1:i386 (1:5.1.1-8) to 1:5.1.1-9
> libgfortran3 (5.1.1-8) to 5.1.1-9
> libgnome-bluetooth13 (3.14.1-1) to 3.16.1-1
> libgnutls-deb0-28 (3.3.15-2) to 3.3.15-5
> libgnutls-deb0-28:i386 (3.3.15-2) to 3.3.15-5
> libgnutls-openssl27 (3.3.15-2) to 3.3.15-5
> libgomp1 (5.1.1-8) to 5.1.1-9
> libgpg-error0 (1.17-3) to 1.19-2
> libgpg-error0:i386 (1.17-3) to 1.19-2
> libgpod-common (0.8.3-1.1+b1) to 0.8.3-1.1+b2
> libgpod4 (0.8.3-1.1+b1) to 0.8.3-1.1+b2
> libgstreamer-plugins-bad1.0-0 (1.4.5-2) to 1.4.5-2+b1
> libgtkspell3-3-0 (3.0.6-1) to 3.0.7-2
> libgudev-1.0-0 (219-12) to 230-1
> libhtml-tree-perl (5.03-1) to 5.03-2
> libimobiledevice4 (1.1.6+dfsg-3.1) to 1.1.6+dfsg-3.1+b1
> libio-socket-inet6-perl (2.72-1) to 2.72-2
> libio-socket-ssl-perl (2.015-1) to 2.016-1
> libitm1 (5.1.1-8) to 5.1.1-9
> libldap-2.4-2 (2.4.40+dfsg-1) to 2.4.40+dfsg-1+b2
> libldap-2.4-2:i386 (2.4.40+dfsg-1) to 2.4.40+dfsg-1+b2
> liblocale-gettext-perl (1.05-8+b1) to 1.05-9
> liblsan0 (5.1.1-8) to 5.1.1-9
> libmtp-common (1.1.9-1) to 1.1.9-2
> libmtp-runtime (1.1.9-1) to 1.1.9-2
> libmtp9 (1.1.9-1) to 1.1.9-2
> libmuffin0 (2.2.6-4) to 2.6.1-1
> libnemo-extension1 (2.2.4-2) to 2.6.5-1
> libobjc4 (5.1.1-8) to 5.1.1-9
> libperl4-corelibs-perl (0.003-1) to 0.003-2
> libpython3.4 (3.4.3-6) to 3.4

Bug#789475: udhcpc: valid rfc1123 hostname recognized as "bad"

[Bodo Eggert]

Package: busybox
Version: 1:1.22.0-9+deb8u1
Severity: normal
Tags: d-i

Dear Maintainer,

The valid hostname "52-54-0-12-34-56" is recognized as bad while it should be 
valid according to rfc1123 (Section 2.1).

-
Capture of the DHCP reply:
be1.lrz.bootps > 192.168.7.107.bootpc: BOOTP/DHCP, Reply, length 300, xid 
0x4cc35164, Flags [none]
  Client-IP 192.168.7.107
  Your-IP 192.168.7.107
  Client-Ethernet-Address 52:54:00:12:34:56 (oui Unknown)
  file "be1"
  Vendor-rfc1048 Extensions
Magic Cookie 0x63825363
DHCP-Message Option 53, length 1: ACK
Server-ID Option 54, length 4: be1.lrz
Lease-Time Option 51, length 4: 600
Subnet-Mask Option 1, length 4: 255.255.255.0
Default-Gateway Option 3, length 4: be2.lrz
Domain-Name-Server Option 6, length 4: be1.lrz
Hostname Option 12, length 16: "52-54-0-12-34-56"
Domain-Name Option 15, length 3: "lrz"


-- System Information:
Debian Release: 8.1
  APT prefers stable-updates
  APT policy: (500, 'stable-updates'), (500, 'stable')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 3.16.0-4-amd64 (SMP w/2 CPU cores)
Locale: LANG=C, LC_CTYPE=C.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages busybox depends on:
ii  libc6  2.19-18

busybox recommends no packages.

busybox suggests no packages.

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789476: liburi-find-perl: FTBFS with perl 5.22 (Module::Build)

[Dominic Hargreaves]

Source: liburi-find-perl
Version: 2003-1
Severity: important
User: debian-p...@lists.debian.org
Usertags: perl-5.22-transition
Tags: sid stretch

This package FTBFS with perl 5.22 (currently in experimental), since
Module::Build has been removed from perl core:

perl Build.PL --installdirs vendor
Can't locate Module/Build.pm in @INC (you may need to install the Module::Build 
module) (@INC contains: /etc/perl /usr/local/lib/x86_64-linux-gnu/perl/5.22.0 /u
sr/local/share/perl/5.22.0 /usr/lib/x86_64-linux-gnu/perl5/5.22 
/usr/share/perl5 /usr/lib/x86_64-linux-gnu/perl/5.22 /usr/share/perl/5.22 
/usr/local/lib/site_perl /usr/lib/x86_64-linux-gnu/perl-base .) at Build.PL 
line 3.
BEGIN failed--compilation aborted at Build.PL line 3.
dh_auto_configure: perl Build.PL --installdirs vendor returned exit code 2
make: *** [build] Error 2
debian/rules:4: recipe for target 'build' failed

The fix is probably to add a build dependency on libmodule-build-perl.

This bug will become release critical nearer the time of the perl 5.22
migration, expected during the (northern hemisphere) summer.

Cheers,
Dominic.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789477: libwiki-toolkit-perl: FTBFS with perl 5.22 (CGI build-dep)

[Dominic Hargreaves]

Source: libwiki-toolkit-perl
Version: 0.84-1
Severity: important
User: debian-p...@lists.debian.org
Usertags: perl-5.22-transition
Tags: sid stretch

This package FTBFS with perl 5.22 (currently in experimental), since CGI
has been removed from perl core:

Can't locate CGI.pm in @INC (you may need to install the CGI module) (@INC 
contains: /«PKGBUILDDIR»/blib/lib /«PKGBUILDDIR»/blib/arch /etc/perl 
/usr/local/lib/x86_64-linux-gnu/perl/5.22.0 /usr/local/share/perl/5.22.0 
/usr/lib/x86_64-linux-gnu/perl5/5.22 /usr/share/perl5 
/usr/lib/x86_64-linux-gnu/perl/5.22 /usr/share/perl/5.22 
/usr/local/lib/site_perl /usr/lib/x86_64-linux-gnu/perl-base .) at 
/«PKGBUILDDIR»/blib/lib/Wiki/Toolkit/Formatter/Default.pm line 10.
BEGIN failed--compilation aborted at 
/«PKGBUILDDIR»/blib/lib/Wiki/Toolkit/Formatter/Default.pm line 10.
Compilation failed in require at /«PKGBUILDDIR»/blib/lib/Wiki/Toolkit.pm line 
154.
# Looks like your test exited with 2 before it could output anything.

The fix is to add (build)-dependencies on

libcgi-pm-perl | perl (<< 5.19)

This bug will become release critical nearer the time of the perl 5.22
migration, expected during the (northern hemisphere) summer.

Note to pkg-perl: I would prefer to keep this one not team maintained
for now.

Cheers,
Dominic.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#702358: please enable SRS support

[Andreas Metzler]

Control: tags -1 wontfix

On 2013-03-05 Arkadiusz Miśkiewicz  wrote:
> Package: exim4-daemon-heavy 
> Version: 4.80-7
> Severity: wishlist

> Please enable SRS support in exim (by defining EXPERIMENTAL_SRS option at 
> build time).

Hello,

afaict all SRS C-libraries are unmaintained, dead upstream and
therefore not shipped in Debian, which is why I am marking this bug
wontfix.

libsrs - homepage gone, never packaged for Debian. (#261189)
libsrs_alt  - homepage gone, never packaged for Debian. See
  https://opsec.eu/src/srs/
libsrs2 - dead upstream (last GIT commit with actual code changes in
  2004), removed from Debian in 2012 (#661882)

Exim would require libsrs_alt.

Debian currently ships two SRS implementations, libmail-srs-perl (latest
upstream release 2004) and pysrs (latest upstream release 2010). Both of
these include command line utilities which could be used with exim's
string expansion facilities.

cu Andreas
-- 
`What a good friend you are to him, Dr. Maturin. His other friends are
so grateful to you.'
`I sew his ears on from time to time, sure'


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789374: missing license in debian/copyright

[Markus Koschany]

On Sat, 20. Jun 14:27 Thorsten Alteholz  wrote:
> Package: freeciv
> Version: 2.5.0-2
> Severity: serious
> User: alteh...@debian.org
> Usertags: ftp
> X-Debbugs-CC: ftpmas...@ftp-master.debian.org
> thanks
>
> Dear Maintainer,
>
> data/flags/sikkim.svg seems to be licensed under CC 2.0 which is
> incompatible with DFSG. Please remove this file from the source tarball.
>
> data/flags/saxony.svg is licensed under CC 3.0. Please mention this in your
> debian/copyright.

Hello,

what do you think about this bug report? According to the license they
are GPL-2+ but the svg metadata claims something different.

Regards,

Markus


signature.asc
Description: Digital signature

Bug#788471: elasticsearch: CVE-2015-4165: unspecified arbitrary files modification vulnerability

[Hilko Bengen]

* Salvatore Bonaccorso:

> Did you had a chance to get more details on it?

,[ http://seclists.org/bugtraq/2015/Jun/53 ]
| Elasticsearch versions 1.0.0 - 1.5.2 are vulnerable to an engineered
| attack on other applications on the system. The snapshot API may be used
| indirectly to place snapshot metadata files into locations that are
| writeable by the user running the Elasticsearch process. It is possible
| to create a file that another application could read and take action on,
| such as code execution.
`

Looking at upstream's commits leading to 1.6.0, this seems like a
candidate:

,
| commit dedbe528d5da95fdb6cccd1d0483aa0ca2c07563
| Author: jaymode 
| Date:   Fri May 29 11:14:46 2015 -0400
| 
| Snapshot/Restore: fix check for locations in a repository path
| 
| Currently, when trying to determine if a location is within one of the 
configured repository
| paths, we compare a canonical path against an absolute path. These are 
not always
| equivalent and this check will fail even when the same directory is used. 
This changes
| the logic to to follow that of master, where we use normalized absolute 
path comparisons. A
| test has been added that failed with the old code and now passes with the 
updated method.
`

Cheers,
-Hilko


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789475: udhcpc: valid rfc1123 hostname recognized as "bad"

[Geert Stappers]

Control: tag -1 moreinfo

On Sun, Jun 21, 2015 at 02:14:17PM +0200, Bodo Eggert wrote:
> 
> The valid hostname "52-54-0-12-34-56" is recognized as bad
> while it should be valid according to rfc1123 (Section 2.1).

What programma and/or device did recognize "52-54-0-12-34-56" as bad?

How was the error encountered?  Any error messages?

Please elaborate what the reason for this bugreport is.


> Capture of the DHCP reply:
> be1.lrz.bootps > 192.168.7.107.bootpc: BOOTP/DHCP, Reply, length 300, xid 
> 0x4cc35164, Flags [none]
>   Vendor-rfc1048 Extensions
> DHCP-Message Option 53, length 1: ACK
> Hostname Option 12, length 16: "52-54-0-12-34-56"

That is content from a network packet sent by a DHCP server,
which might be configured for providing such hostname.


Please provide more information.




Groeten
Geert Stappers
-- 
Leven en laten leven


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789478: nmu: mlpack_1.0.12-4

[Andreas Beckmann]

Package: release.debian.org
Severity: normal
User: release.debian@packages.debian.org
Usertags: binnmu

nmu mlpack_1.0.12-4 . amd64 . -m "Rebuild against libarmadillo5."

The maintainer upload was built against libarmadillo4 which is now gone.

Andreas

PS: @Barak (X-Debbugs-CCed): Please update your build environment.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789395: libdrm-nouveau2: pushbuf.c not found

[Julien Cristau]

Control: tag -1 moreinfo

On Sat, Jun 20, 2015 at 16:33:46 +0200, Heiko Ernst wrote:

> Package: libdrm-nouveau2
> Severity: important
> 
> Dear Maintainer,
> 
> My game supertuxkart 0.9-4 crash with "Program received signal SIGSEGV,
> Segmentation fault.
> pushbuf_dump (krec=0x11e43c0, krec_id=858524443, chid=-303376240)
> at ../../nouveau/pushbuf.c:296"
> 
Please provide complete information, not just tiny excerpts.

Cheers,
Julien


signature.asc
Description: Digital signature

Bug#789466: libtest-prereq-perl: FTBFS with perl 5.22 (Module::Build)

[gregor herrmann]

Control: clone -1 -2
Control: retitle -2 libtest-prereq-perl: FTBFS with perl 5.22: test failures
Control: forwarded -2 https://rt.cpan.org/Public/Bug/Display.html?id=96099
Control: found -2 1.038-2

On Sun, 21 Jun 2015 10:09:11 +0100, Dominic Hargreaves wrote:

> Source: libtest-prereq-perl
> Version: 1.038-1
> Severity: important
> User: debian-p...@lists.debian.org
> Usertags: perl-5.22-transition
> Tags: sid stretch
> 
> This package FTBFS with perl 5.22 (currently in experimental), since
> Module::Build has been removed from perl core:
> 
> Can't locate Module/Build.pm in @INC (you may need to install the 
> Module::Build 
> module) (@INC contains: /«PKGBUILDDIR»/blib/lib /«PKGBUILDDIR»/blib/arch 
> /etc/pe
> rl /usr/local/lib/x86_64-linux-gnu/perl/5.22.0 /usr/local/share/perl/5.22.0 
> /usr
> /lib/x86_64-linux-gnu/perl5/5.22 /usr/share/perl5 
> /usr/lib/x86_64-linux-gnu/perl
> /5.22 /usr/share/perl/5.22 /usr/local/lib/site_perl 
> /usr/lib/x86_64-linux-gnu/pe
> rl-base .) at /«PKGBUILDDIR»/blib/lib/Test/Prereq/Build.pm line 25.
> BEGIN failed--compilation aborted at 
> /«PKGBUILDDIR»/blib/lib/Test/Prereq/Build.pm line 25.
> Compilation failed in require at t/get_prereqs.t line 7.
> BEGIN failed--compilation aborted at t/get_prereqs.t line 7.
> 
> The fix is probably to add a build dependency on libmodule-build-perl.

That's the easy part. But the package still fails with 5.22:

#   Failed test 'Right modules for modules and tests'
#   at t/get_loaded_modules.t line 10.
Didn't find right modules! Found < Module::Build Module::Info Test::Prereq 
Test::Prereq::Build >
# Looks like you failed 1 test of 1.
t/get_loaded_modules.t ..
1..1
not ok 1 - Right modules for modules and tests
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/1 subtests

#   Failed test 'Found some modules that didn't show up in PREREQ_PM or 
*_REQUIRES
# '
#   at /tmp/buildd/libtest-prereq-perl-1.038/blib/lib/Test/Prereq.pm line 294.
#   Module::Build
# Looks like you failed 1 test of 1.
t/prereq_ok.t ...
1..1
not ok 1 - Found some modules that didn't show up in PREREQ_PM or *_REQUIRES
# 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/1 subtests

#   Failed test 'Found some modules that didn't show up in PREREQ_PM or 
*_REQUIRES
# '
#   at /tmp/buildd/libtest-prereq-perl-1.038/blib/lib/Test/Prereq.pm line 294.
#   Module::Build
# Looks like you failed 1 test of 1.
t/prior_plan.t ..
1..1
not ok 1 - Found some modules that didn't show up in PREREQ_PM or *_REQUIRES
# 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/1 subtests

t/get_loaded_modules.t (Wstat: 256 Tests: 1 Failed: 1)
  Failed test:  1
  Non-zero exit status: 1
t/prereq_ok.t (Wstat: 256 Tests: 1 Failed: 1)
  Failed test:  1
  Non-zero exit status: 1
t/prior_plan.t(Wstat: 256 Tests: 1 Failed: 1)
  Failed test:  1
  Non-zero exit status: 1


In all 3 tests, Module::Build is found ...

This is also noted at
https://rt.cpan.org/Public/Bug/Display.html?id=96099
https://rt.cpan.org/Public/Bug/Display.html?id=98445


Cheers,
gregor, cloning a new bug

-- 
 .''`.  Homepage: http://info.comodo.priv.at/ - OpenPGP key 0xBB3A68018649AA06
 : :' : Debian GNU/Linux user, admin, and developer -  https://www.debian.org/
 `. `'  Member of VIBE!AT & SPI, fellow of the Free Software Foundation Europe
   `-   NP: U2: Grace


signature.asc
Description: Digital Signature

Bug#287876: Vacaciones en FAMILIA A PRECIOS DE LOCOS!!

[consultas]

Si no visualiza correctamente este E-Mail haga 

Click Aquí ( Link -> 
http://goto-5.net/track/click?u=web&p=36343936383a313a313a303a303a30&m=30163&s=76f8997d94bbb5741b98f2d3d88694cc
 ) | 

Reenvía a un amigo ( Link -> 
http://goto-5.net/track/click?u=forwardto&p=36343936383a313a313a303a303a30&m=30163&s=76f8997d94bbb5741b98f2d3d88694cc
 ) 

/*

*/

/*

*/

/*

*/

Ingresá a nuestro WEB-SITE, registrate y disfruta de importantes beneficios!!!

IMAGENES

IMAGENES ( Link -> http://www.filodelosmedanos.com/galeria.html ) CONOCENOS

( Link -> http://www.filodelosmedanos.com ) 

( Link -> 
http://goto-5.net/track/click?u=facebook&p=36343936383a313a313a303a303a30&m=30163&s=76f8997d94bbb5741b98f2d3d88694cc
 ) 

( Link -> 
http://goto-5.net/track/click?u=forwardto&p=36343936383a313a313a303a303a30&m=30163&s=76f8997d94bbb5741b98f2d3d88694cc
 ) 

Facebook ( Link -> https://www.facebook.com/profile.php?id=19898983236 ) 

Agréganos a tu lista de contactos 

Información de Contacto ( Link -> 
http://goto-5.net/track/click?u=vcard&p=36343936383a313a313a303a303a30&m=30163&s=76f8997d94bbb5741b98f2d3d88694cc
 ) 

Para desuscribirse de nuestra lista haga 

( Link -> 
http://goto-5.net/track/click?u=unsubscribe&p=36343936383a313a313a303a303a30&m=30163&s=76f8997d94bbb5741b98f2d3d88694cc
 )

Bug#789480: libmnl: FTBFS with clang instead of gcc

[Joseph Lee]

Source: libmnl
Version: 1.0.3
Severity: minor

Dear Maintainer,

Hello,

Using the rebuild infrastructure, your package fails to build with clang 
instead of gcc.

All errors are because of "undefined reference to 'xxx'".

Full build log is available here:
http://clang.debian.net/logs/2014-09-03/libmnl_1.0.3-5_unstable_clang.log

I found this is because  clang doesn't like the visibility definitions in this 
code. So I patches it by adding a conditional statement to make some change 
when building this package with clang.

Many Thanks,
Joseph

-- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (500, 'unstable')
Architecture: amd64 (x86_64)

Kernel: Linux 4.0.5-1-ARCH (SMP w/8 CPU cores; PREEMPT)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8) (ignored: LC_ALL 
set to en_US.UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: unable to detect
diff -Nru libmnl-1.0.3/debian/rules libmnl-1.0.3/debian/rules
--- libmnl-1.0.3/debian/rules	2014-08-04 03:00:32.0 +
+++ libmnl-1.0.3/debian/rules	2015-06-14 10:14:07.0 +
@@ -8,6 +8,9 @@
 _configure := --libdir=/lib/$(DEB_HOST_MULTIARCH) --enable-static
 
 CFLAGS += -fstack-protector-all

# clang doesnt like the visibility definitions in this code
+ifeq ($(shell $(CC) --version | grep -c "clang version"),1)
+CFLAGS += -fvisibility=default 
+endif
 
 %:
 	dh $@ -- --with autoreconf

Bug#766880: xscreensaver screensaver don't appear in mate-screensaver

[Tormod Volden]

Posted for broader discussion here:
https://lists.debian.org/debian-desktop/2015/06/msg0.html


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789481: musescore: FTBFS on architectures where char is not signed

[Andreas Beckmann]

Source: musescore
Version: 2.0.1+dfsg-1
Severity: serious

Many architectures FTBFS:
https://buildd.debian.org/status/package.php?p=musescore&suite=unstable

from the arm64 log:

[ 10%] Building CXX object mstyle/CMakeFiles/mstyle.dir/menubarengine.cpp.o
In file included from :0:0:
/usr/include/stdc-predef.h:59:1: warning: 
/«BUILDDIR»/musescore-2.0.1+dfsg/build.release/all.h.gch: not used because 
`_FORTIFY_SOURCE' is defined [-Winvalid-pch]
 #endif
 ^
In file included from 
/«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/stafftype.h:16:0,
 from /«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/xml.h:17,
 from /«BUILDDIR»/musescore-2.0.1+dfsg/fluid/sfont.cpp:30:
/«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/element.h:48:18: error: enumerator 
value -1 is outside the range of underlying type 'char'
   NO_GRIP = -1,
  ^
In file included from /«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/note.h:24:0,
 from 
/«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/durationtype.h:17,
 from /«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/stafftype.h:19,
 from /«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/xml.h:17,
 from /«BUILDDIR»/musescore-2.0.1+dfsg/fluid/sfont.cpp:30:
/«BUILDDIR»/musescore-2.0.1+dfsg/libmscore/pitchspelling.h:56:42: error: 
enumerator value -1 is outside the range of underlying type 'char'
 enum class NoteCaseType : char { AUTO = -1, CAPITAL = 0, LOWER, UPPER };
  ^

There is also another problem on x86:

musescore-soundfont-gm/amd64 unsatisfiable Depends: timgm6mb-soundfont
musescore-soundfont-gm/i386 unsatisfiable Depends: timgm6mb-soundfont


Andreas


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789482: libnetfilter-acct: FTBFS with clang instead of gcc

[Joseph Lee]

Source: libnetfilter-acct
Version: 1.0.2
Severity: minor

Dear Maintainer,

Hello,

Using the rebuild infrastructure, your package fails to build with clang 
instead of gcc.

All errors are because of "undefined reference to 'xxx'".

Full build log is available here:
http://clang.debian.net/logs/2015-03-25/libnetfilter-acct_1.0.2-1.1_unstable_clang.log

I found this is because clang doesn't like the visibility definitions in this 
code. So I patches it by adding a conditional statement to make some change 
when building this package with clang.

Many Thanks,
Joseph

-- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (500, 'unstable')
Architecture: amd64 (x86_64)

Kernel: Linux 4.0.5-1-ARCH (SMP w/8 CPU cores; PREEMPT)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8) (ignored: LC_ALL 
set to en_US.UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: unable to detect
diff -Nru libnetfilter-acct-1.0.2/debian/rules libnetfilter-acct-1.0.2/debian/rules
--- libnetfilter-acct-1.0.2/debian/rules	2014-09-10 11:10:01.0 +
+++ libnetfilter-acct-1.0.2/debian/rules	2015-06-21 05:43:00.0 +
@@ -1,5 +1,9 @@
 #!/usr/bin/make -f
 
# clang doesnt like the visibility definitions in this code
+ifeq ($(shell $(CC) --version | grep -c "clang version"),1)
+export CFLAGS += -fvisibility=default
+endif
+
 %:
 	dh $@ --with autoreconf 
 

Bug#546064: bzflag-client: aborts when run with no parameters

[Dominik George]

Package: bzflag
Version: 2.4.2+ds1-5
Followup-For: Bug #546064

The bug is still repeoducible.

I will now try to make an educated guess, please refrain from taking it
as the ultimate explanation:

I have connected a second monitor, and mirrored my first monitor there
(same screen on both). This results in the largest common solution being
used (which is 1024x768 here). Calling the X interface, however, yields
all available resolutions for each screen, then BZFlag tries to use the
best available resolution from there. However, this mode cannot be set,
because the first usable resolution is the largest one supported by
*both* screens.

-- System Information:
Debian Release: 8.1
  APT prefers stable-updates
  APT policy: (500, 'stable-updates'), (500, 'stable')
Architecture: i386 (i686)

Kernel: Linux 3.16.0-4-686-pae (SMP w/4 CPU cores)
Locale: LANG=de_DE.UTF-8, LC_CTYPE=de_DE.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages bzflag depends on:
ii  bzflag-client  2.4.2+ds1-5+b1
ii  bzflag-server  2.4.2+ds1-5+b1

bzflag recommends no packages.

bzflag suggests no packages.

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789483: nvidia-kermel-dkms: uvm driver builds but fails to load due to missing symbols

[Giuseppe Bilotta]

Package: nvidia-kernel-dkms
Version: 346.72-1
Severity: important

The nvidia-uvm driver (essential to run CUDA or OpenCL programs) builds
successfully, but fails to load due missing symbols

nvUvmInterfaceSessionCreate
nvUvmInterfaceChannelAllocate
nvUvmInterfaceGetGpuArch

(etc), at least on kernel 4.0.0-2 (Debian package)

This may be a rehash of issue #747366.


-- Package-specific info:
uname -a:
Linux oblomov 4.0.0-2-amd64 #1 SMP Debian 4.0.5-1 (2015-06-16) x86_64 GNU/Linux

/proc/version:
Linux version 4.0.0-2-amd64 (debian-ker...@lists.debian.org) (gcc version 4.9.2 
(Debian 4.9.2-21) ) #1 SMP Debian 4.0.5-1 (2015-06-16)

/proc/driver/nvidia/version:
NVRM version: NVIDIA UNIX x86_64 Kernel Module  346.72  Tue May  5 22:03:13 PDT 
2015
GCC version:  gcc version 4.9.2 (Debian 4.9.2-21) 

lspci 'VGA compatible controller [0300]':
00:02.0 VGA compatible controller [0300]: Intel Corporation 4th Gen Core 
Processor Integrated Graphics Controller [8086:0416] (rev 06) (prog-if 00 [VGA 
controller])
Subsystem: Dell Device [1028:05fe]
Control: I/O+ Mem+ BusMaster+ SpecCycle- MemWINV- VGASnoop- ParErr- 
Stepping- SERR- FastB2B- DisINTx+
Status: Cap+ 66MHz- UDF- FastB2B+ ParErr- DEVSEL=fast >TAbort- SERR-  [disabled]
Capabilities: 
Kernel driver in use: i915

dmesg:
[0.00] AGP: No AGP bridge found
[0.00] AGP: Checking aperture...
[0.00] AGP: No AGP bridge found
[0.475600] vgaarb: setting as boot device: PCI::00:02.0
[0.475603] vgaarb: device added: 
PCI::00:02.0,decodes=io+mem,owns=io+mem,locks=none
[0.475609] vgaarb: loaded
[0.475612] vgaarb: bridge control possible :00:02.0
[0.835527] Linux agpgart interface v0.103
[3.638764] [drm] Replacing VGA console driver
[3.661677] vgaarb: device changed decodes: 
PCI::00:02.0,olddecodes=io+mem,decodes=io+mem:owns=io+mem
[3.885426] [drm] GMBUS [i915 gmbus vga] timed out, falling back to bit 
banging on pin 2
[27019.265754] nvidia: module license 'NVIDIA' taints kernel.
[27019.274029] nvidia :02:00.0: enabling device (0006 -> 0007)
[27019.274357] [drm] Initialized nvidia-drm 0.0.0 20150116 for :02:00.0 on 
minor 1
[27019.274361] NVRM: loading NVIDIA UNIX x86_64 Kernel Module  346.72  Tue May  
5 22:03:13 PDT 2015
[27019.287547] nvidia_uvm: no symbol version for nvUvmInterfaceChannelDestroy
[27019.287551] nvidia_uvm: Unknown symbol nvUvmInterfaceChannelDestroy (err -22)
[27019.287553] nvidia_uvm: no symbol version for nvUvmInterfaceQueryCaps
[27019.287554] nvidia_uvm: Unknown symbol nvUvmInterfaceQueryCaps (err -22)
[27019.287559] nvidia_uvm: no symbol version for nvUvmInterfaceMemoryAllocSys
[27019.287559] nvidia_uvm: Unknown symbol nvUvmInterfaceMemoryAllocSys (err -22)
[27019.287561] nvidia_uvm: no symbol version for nvUvmInterfaceMemoryCpuMap
[27019.287561] nvidia_uvm: Unknown symbol nvUvmInterfaceMemoryCpuMap (err -22)
[27019.287563] nvidia_uvm: no symbol version for nvUvmInterfaceKillChannel
[27019.287564] nvidia_uvm: Unknown symbol nvUvmInterfaceKillChannel (err -22)
[27019.287566] nvidia_uvm: no symbol version for nvUvmInterfaceMemoryCpuUnMap
[27019.287567] nvidia_uvm: Unknown symbol nvUvmInterfaceMemoryCpuUnMap (err -22)
[27019.287569] nvidia_uvm: no symbol version for 
nvUvmInterfaceAddressSpaceCreateMirrored
[27019.287570] nvidia_uvm: Unknown symbol 
nvUvmInterfaceAddressSpaceCreateMirrored (err -22)
[27019.287592] nvidia_uvm: no symbol version for 
nvUvmInterfaceServiceDeviceInterruptsRM
[27019.287593] nvidia_uvm: Unknown symbol 
nvUvmInterfaceServiceDeviceInterruptsRM (err -22)
[27019.287594] nvidia_uvm: no symbol version for nvUvmInterfaceDeRegisterUvmOps
[27019.287595] nvidia_uvm: Unknown symbol nvUvmInterfaceDeRegisterUvmOps (err 
-22)
[27019.287596] nvidia_uvm: no symbol version for nvUvmInterfaceMemoryFree
[27019.287597] nvidia_uvm: Unknown symbol nvUvmInterfaceMemoryFree (err -22)
[27019.287598] nvidia_uvm: no symbol version for nvUvmInterfaceGetUvmPrivRegion
[27019.287599] nvidia_uvm: Unknown symbol nvUvmInterfaceGetUvmPrivRegion (err 
-22)
[27019.287602] nvidia_uvm: no symbol version for nvUvmInterfaceGetAttachedUuids
[27019.287603] nvidia_uvm: Unknown symbol nvUvmInterfaceGetAttachedUuids (err 
-22)
[27019.287606] nvidia_uvm: no symbol version for nvUvmInterfaceSessionDestroy
[27019.287607] nvidia_uvm: Unknown symbol nvUvmInterfaceSessionDestroy (err -22)
[27019.287608] nvidia_uvm: no symbol version for 
nvUvmInterfaceCheckEccErrorSlowpath
[27019.287609] nvidia_uvm: Unknown symbol nvUvmInterfaceCheckEccErrorSlowpath 
(err -22)
[27019.287611] nvidia_uvm: no symbol version for 
nvUvmInterfaceAddressSpaceCreate
[27019.287611] nvidia_uvm: Unknown symbol nvUvmInterfaceAddressSpaceCreate (err 
-22)
[27019.287613] nvidia_uvm: no symbol version for 
nvUvmInterfaceCopyEngineAllocate
[27019.287614] nvidia_uvm: Unknown symbol nvUvmInterfaceCopyEngineAllocate (err 
-22)
[27019.287615] nvidia_uvm: no symbol version for 
nvUvmInterfaceAddressSpa

Bug#789485: jruby: Don't bundle all jruby dependencies inside jruby-core jar file

[Miguel Landaeta]

Package: jruby
Severity: normal

This is a bad practice that can lead to bugs due to outdated
dependencies or security bugs when dependencies are patched
but jruby is not rebuild.

This also should reduce jruby binary package size.


-- System Information:
Debian Release: 8.1
  APT prefers stable-updates
  APT policy: (500, 'stable-updates'), (500, 'stable')
Architecture: amd64 (x86_64)

Kernel: Linux 4.0.0-1-amd64 (SMP w/2 CPU cores)
Locale: LANG=en_US.UTF-8, LC_CTYPE=UTF-8 (charmap=UTF-8) (ignored: LC_ALL set 
to en_US.UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

-- 
Miguel Landaeta, nomadium at debian.org
secure email with PGP 0x6E608B637D8967E9 available at http://miguel.cc/key.
"Faith means not wanting to know what is true." -- Nietzsche


signature.asc
Description: Digital signature

Bug#570232: about later changes

[Ferenc Wagner]

Unfortunately, the above recipe stopped working under wheezy.
It was broken and later fixed upstream, see:
http://www.redhat.com/archives/lvm-devel/2012-March/msg00162.html

Lock conversion to exclusive is also problematic, as this patch isn't
included yet:
https://www.redhat.com/archives/lvm-devel/2013-December/msg00095.html

On the other hand, adding cmirrord to the LVM2 packages seems feasible.
I added it to the clvmd package locally, and after fixing some stack
smashing bugs we're starting to get encouraging test results.  Let's see
what upstream has to say on this...
-- 
Feri.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#742553: [Pkg-openssl-devel] Bug#742553: Need a bugfix

[Kurt Roeckx]

On Wed, Jun 10, 2015 at 11:39:10PM +0300, Niko Tyni wrote:
> On Sat, Jun 06, 2015 at 08:24:20PM +0200, Kurt Roeckx wrote:
> > On Sat, Jun 06, 2015 at 07:40:42PM +0200, Frank Eiche wrote:
> 
> > > Undefined subroutine &WWW::Curl::Easy::global_cleanup called at
> > > /usr/lib/ssl/misc/tsget line 196
> > 
> > For some reason it seems in wheezy both global_cleanup() and
> > curl_global_cleanup(), but in jessie only curl_global_cleanup()
> > works.
> 
> I don't see any reference to global_cleanup() in the documentation.
> 
> It looks to me like global_cleanup() "works" (as in doesn't croak)
> in squeeze (libwww-curl-perl 4.12-1) but not in wheezy (4.15-1)
> or later.
> 
> It's probably this change:
> 
> 4.13 Wed Sep 01 2010: - Balint Szilakszi 
> [...]
> - Modernized *.pm and AUTOLOAD now throws an error on unknown method 
> calls [Fuji, Goro].
> 
> The squeeze version seems to silently accept anything:
> 
>  squeeze% perl -w -Mstrict -MWWW::Curl::Easy -e 
> 'WWW::Curl::Easy::nosuchfunction()'; echo $?
>  0
> 
> but later versions correctly croak:
> 
>  wheezy% perl -w -Mstrict -MWWW::Curl::Easy -e 
> 'WWW::Curl::Easy::nosuchfunction()'; echo $?
>  Undefined subroutine &WWW::Curl::Easy::nosuchfunction called at -e line 1
>  22
> 
> So apparently global_cleanup() was always broken but error handling
> has improved after squeeze.

I'm getting confused.  Neither global_cleanup() nor
curl_global_cleanup() seems to exist in any version as far as I
can see.  I think at least that is missing functionality in
libwww-curl-perl.


Kurt


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789486: node-srs: Stop build depending on libgdal1-dev, use libgdal-dev instead

[Bas Couwenberg]

Package: node-srs
Version: 0.3.2+ds1-1
Severity: normal
Tags: patch
User: debian-...@lists.debian.org
Usertags: gdal-2.0

Dear Maintainer,

node-srs still build depends on the deprecated libgdal1-dev package.

Since gdal (1.9.0-1) libgdal-dev should be use instead.

In the upcoming gdal (2.0.0-1) the libgdal1-dev transitional package is
no longer available.

Your package will FTBFS with gdal (>= 2.0.0) when it enters the archive.

Please apply the attached patch to change the build dependency to
libgdal-dev.

Kind Regards,

Bas
>From 790c9651fea0745df3c7e3efb8003e14b0ab3b42 Mon Sep 17 00:00:00 2001
From: Bas Couwenberg 
Date: Sun, 21 Jun 2015 15:26:16 +0200
Subject: Use libgdal-dev instead of deprecated libgdal1-dev build dependency.

---
 debian/control | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/debian/control b/debian/control
index 8c98a7d..364b3ef 100644
--- a/debian/control
+++ b/debian/control
@@ -8,7 +8,7 @@ Build-Depends:
  debhelper (>= 9~)
  , dh-buildinfo
  , node-gyp
- , libgdal1-dev (>= 1.9.0~)
+ , libgdal-dev (>= 1.9.0~)
 Standards-Version: 3.9.4
 Homepage: https://github.com/springmeyer/node-srs
 Vcs-Git: git://anoncm.debian.org/collab-maint/node-srs.git
-- 
2.1.4

Bug#789374: [Debian] Bug#789374: missing license in debian/copyright [sikkim.svg/saxony.svg]

[Jacob Nevins]

Markus Koschany writes (in Debian BTS and to Marko/myself):
> what do you think about this bug report? According to the license they
> are GPL-2+ but the svg metadata claims something different.

> On Sat, 20. Jun 14:27 Thorsten Alteholz  wrote:
>> data/flags/sikkim.svg seems to be licensed under CC 2.0 which is
>> incompatible with DFSG. Please remove this file from the source tarball.

This was originally added to Freeciv upstream in
.
Flag is described as "PD image" in that ticket, but the version of

that was current at the time appears to have had a tag
{{self|cc-by-sa-2.5}}. This isn't quite the same as what the SVG
metadata claims, I think; don't know if that makes any difference.

The current version on Commons is described as "This file is ineligible
for copyright and therefore in the public domain because it consists
entirely of information that is common property and contains no original
authorship." So we could use that instead?

>> data/flags/saxony.svg is licensed under CC 3.0. Please mention this in your
>> debian/copyright.

This was added upstream under .
The then-current version of the Commons file

was described as "Permission=Own work, all rights released (Public
domain)". The current version is described as being in the public domain
for various being-a-state-symbol sorts of reasons.

If so, it looks like the embedded licence metadata for this file is in
error.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789487: libdevel-cover-perl: unexpected OP_PADRANGE at /usr/share/perl/5.20/B/Deparse.pm

[Jakub Wilk]

Package: libdevel-cover-perl
Version: 1.18-1

Running Devel::Cover against the attached test program provokes a 
warning from B::Deparse:


$ perl -MDevel::Cover=-silent,1 test.pl
unexpected OP_PADRANGE at /usr/share/perl/5.20/B/Deparse.pm line 1260.


-- System Information:
Debian Release: stretch/sid
 APT prefers unstable
 APT policy: (990, 'unstable'), (500, 'experimental')
Architecture: i386 (x86_64)
Foreign Architectures: amd64

Kernel: Linux 4.0.0-2-amd64 (SMP w/2 CPU cores)
Locale: LANG=C, LC_CTYPE=pl_PL.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: sysvinit (via /sbin/init)

Versions of packages libdevel-cover-perl depends on:
ii  libc6   2.19-18
ii  libhtml-parser-perl 3.71-2
ii  perl5.20.2-6
ii  perl-base [perlapi-5.20.2]  5.20.2-6

Versions of packages libdevel-cover-perl recommends:
ii  gcc   4:4.9.2-4
ii  libtemplate-perl  2.24-1.2+b1

Versions of packages libdevel-cover-perl suggests:
pn  libbrowser-open-perl  
ii  libcapture-tiny-perl  0.30-1
pn  libclass-xsaccessor-perl  
pn  libjson-xs-perl   
ii  libmoo-perl   1.006001-1
ii  libnamespace-clean-perl   0.25-1
pn  libpod-coverage-perl  
pn  libsereal-decoder-perl
pn  libsereal-encoder-perl
pn  libtest-differences-perl  
ii  perltidy  20140328-1

--
Jakub Wilk
if (my @x = 'foo' =~ m/(.)/) {
} else {
}

Bug#789483: Found a patch

[Giuseppe Bilotta]

The following patch to uvm/Kbuild seems to fix the problem for me
(hoping gmail doesn't wrap it)

--- uvm/Kbuild~ 2015-06-21 15:33:08.438616334 +0200
+++ uvm/Kbuild 2015-06-21 15:33:22.662669880 +0200
@@ -219,6 +219,8 @@
RM_MODULE_SYMVERS:= $(RM_OUT_DIR)/Module.symvers
UVM_MODULE_SYMVERS:= $(obj)/Module.symvers

+KBUILD_EXTRA_SYMBOLS += $(RM_MODULE_SYMVERS)
+
module $(MODULE_NAME).ko: $(UVM_MODULE_SYMVERS) debug_diagnostics_printing

$(MODULE_NAME)-y := $(MODULE_GLUE_OBJS)



-- 
Giuseppe "Oblomov" Bilotta


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789488: seqprep: FTBFS everywhere except on amd64/linux

[Andreas Beckmann]

Package: seqprep
Version: 1.1-1
Severity: serious
Justification: fails to build from source

Hi,

seqprep fails to build everywhere:
https://buildd.debian.org/status/package.php?p=seqprep&suite=unstable

either (e.g. arm64) with

 fakeroot debian/rules binary-arch
dh binary-arch
   dh_testroot -a
   dh_prep -a
   dh_auto_install -a
make -j1 install DESTDIR=/«PKGBUILDDIR»/debian/tmp AM_UPDATE_INFO_DIR=no
make[1]: Entering directory '/«PKGBUILDDIR»'
cp SeqPrep /sbuild-nonexistent/bin
cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or 
directory
make[1]: [install] Error 1 (ignored)
Makefile:16: recipe for target 'install' failed
make[1]: Leaving directory '/«PKGBUILDDIR»'
   debian/rules override_dh_install
make[1]: Entering directory '/«PKGBUILDDIR»'
dh_install
sed -i 's#../SeqPrep#/usr/bin/seqprep#' 
/«PKGBUILDDIR»/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh
sed: can't read 
/«PKGBUILDDIR»/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh: 
No such file or directory
make[1]: *** [override_dh_install] Error 2
debian/rules:28: recipe for target 'override_dh_install' failed
make[1]: Leaving directory '/«PKGBUILDDIR»'
make: *** [binary-arch] Error 2
debian/rules:5: recipe for target 'binary-arch' failed
dpkg-buildpackage: error: fakeroot debian/rules binary-arch gave error exit 
status 2

why is the install error ignored? this should fail earlier ...
why is it going to touch $HOME?


or with testsuite output mismatch (e.g. i386):

   debian/rules override_dh_auto_test
make[1]: Entering directory '/«PKGBUILDDIR»'
# This checks that the tests run and produce byte-identical results.
cd Test && mkdir -p out info && \
bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh'
+ . RUNTEST.sh
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r 
./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B 
AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 
./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz 
-E ./info/alignments_merged.txt.gz
Processing reads... \
Pairs Processed:10
Pairs Merged:   14306
Pairs With Adapters:4091
Pairs Discarded:2228
CPU Time Used (Minutes):0.346382
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r 
./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B 
AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 
./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz
Processing reads... \
Pairs Processed:10
Pairs Merged:   0
Pairs With Adapters:4091
Pairs Discarded:2228
CPU Time Used (Minutes):0.342337
++ prog=gzcat
++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_1.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz
++ zcat ./out/pe_bad_contam_merged_s.fastq.gz
++ python seqlens.py
[ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ]
make[1]: *** [override_dh_auto_test] Error 1
debian/rules:19: recipe for target 'override_dh_auto_test' failed
make[1]: Leaving directory '/«PKGBUILDDIR»'
make: *** [build-arch] Error 2
dpkg-buildpackage: error: debian/rules build-arch gave error exit status 2
debian/rules:5: recipe for target 'build-arch' failed


Andreas


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789489: ncl: Stop build depending on libgdal1-dev, use libgdal-dev instead

[Bas Couwenberg]

Source: ncl
Version: 6.2.0-3
Severity: normal
Tags: patch
User: debian-...@lists.debian.org
Usertags: gdal-2.0

Dear Maintainer,

ncl still build depends on the deprecated libgdal1-dev package.

Since gdal (1.9.0-1) libgdal-dev should be use instead.

In the upcoming gdal (2.0.0-1) the libgdal1-dev transitional package is
no longer available.

Your package will FTBFS with gdal (>= 2.0.0) when it enters the archive.

Please apply the attached patch to change the build dependency to
libgdal-dev.

Kind Regards,

Bas
--- debian/control.orig	2015-06-21 15:38:32.483251227 +0200
+++ debian/control	2015-06-21 15:39:43.222886594 +0200
@@ -5,7 +5,7 @@
 Build-Depends: flex, bison, gfortran, zlib1g-dev, libbz2-dev, libxt-dev,
  libxaw7-dev, libxmu-headers, libcairo2-dev, libjpeg-dev, libpng12-dev,
  pkg-config, fontconfig, libfontconfig1-dev, libfreetype6-dev, libexpat1-dev,
- libpixman-1-dev,  libcurl4-gnutls-dev | libcurl-dev,  libgdal1-dev,
+ libpixman-1-dev, libcurl4-gnutls-dev | libcurl-dev, libgdal-dev,
  libnetcdf-dev, libudunits2-dev,
  libatlas-dev, liblapack-dev, libblas-dev, libatlas3-base,
  libgrib2c-dev, libsphere-dev, libhdf4-alt-dev, libhdfeos-dev,

Bug#789490: security-tracker: DSA-3290-1 vs. tracker

[Francesco Poli (wintermute)]

Package: security-tracker
Severity: normal

Hello!

DSA-3290-1 [1] states that CVE-2015-3636 is fixed in
linux/3.16.7-ckt11-1, but the tracker shows somewhat
self-inconsistent information about this vulnerability [2],
claiming that linux/3.16.7-ckt11-1 is fixed in jessie,
but vulnerable in stretch, despite being apparently the
same exact version.

Please clarify and/or fix the tracker data.

Thanks for your time!

[1] https://lists.debian.org/debian-security-announce/2015/msg00186.html
[2] https://security-tracker.debian.org/tracker/CVE-2015-3636


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789492: freetype: FTBFS with clang instead of gcc

[Joseph Lee]

Source: freetype
Version: 2.5.2
Severity: minor

Dear Maintainer,

Hello,

Using the rebuild infrastructure, your package fails to build with clang 
instead of gcc.

Full build log is available here:
http://clang.debian.net/logs/2015-03-25/freetype_2.5.2-4_unstable_clang.log

These errors are because some clang's warnig options which gcc doesn't have 
were turned to error by -Werror. I fix these by adding some things in 
debian/rules to deal with this situation. But there is a special one which I 
thought may be a mistake. So I modified a source code file, too.

Many Thanks,
Joseph

-- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (500, 'unstable')
Architecture: amd64 (x86_64)

Kernel: Linux 4.0.5-1-ARCH (SMP w/8 CPU cores; PREEMPT)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8) (ignored: LC_ALL 
set to en_US.UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: unable to detect
diff -u freetype-2.5.2/debian/patches-ft2demos/series freetype-2.5.2/debian/patches-ft2demos/series
--- freetype-2.5.2/debian/patches-ft2demos/series
+++ freetype-2.5.2/debian/patches-ft2demos/series
@@ -3,0 +4 @@
+ftcommon-null-pointer.patch
diff -u freetype-2.5.2/debian/rules freetype-2.5.2/debian/rules
--- freetype-2.5.2/debian/rules
+++ freetype-2.5.2/debian/rules
@@ -18,6 +18,10 @@
 endif
 export DEB_CFLAGS_MAINT_APPEND += $(shell dpkg-buildflags --get CPPFLAGS)
 
+ifeq ($(shell $(CC) --version | grep -c "clang version"),1)
+DEB_CFLAGS_MAINT_APPEND += -Wno-error=long-long -Wno-error=extended-offsetof -Wno-error=self-assign
+endif
+
 # always abort if there are any problems with the symbols file
 DPKG_GENSYMBOLS_CHECK_LEVEL = 4
 export DPKG_GENSYMBOLS_CHECK_LEVEL
only in patch2:
unchanged:
--- freetype-2.5.2.orig/debian/patches-ft2demos/ftcommon-null-pointer.patch
+++ freetype-2.5.2/debian/patches-ft2demos/ftcommon-null-pointer.patch
@@ -0,0 +1,13 @@
+Index: ft2demos-2.5.1.orig/src/ftcommon.c
+===
+--- ft2demos-2.5.1.orig/src/ftcommon.c
 ft2demos-2.5.1/src/ftcommon.c
+@@ -242,7 +242,7 @@
+ if ( has_extension )
+   memcpy( suffix, orig, 5 );
+ else
+-  suffix = '\0';
++  *suffix = '\0';
+   }
+ 
+   if ( (*aface)->charmaps )

Bug#789154: add uploader fails

[Stephan Sürken]

Hi Marc,

On Do, 2015-06-18 at 13:20 +0200, Marc Haber wrote:
(...)
> first thanks for the mini-buildd rewrite. This looks vastly better
> than the 0.9 series, especially regarding documentation.

thx, but it's obviously still lacking.

> However, the quickstart does not explain the role of an uploader too
> well. Checking and activating the default uploader didn't work (the
> text looked like some variable wasn't initialized), so I deleted it.
> 
> Adding a new uploader fails. I exported the public key:

yep, that isn't really well explained.

You should not delete (or add) Uploader instances yourself, they are
created automatically for each user (this is why, in the admin overview
page, I patched away the "add" button, but it's not really feasable to
patch it away from the whole django admin thing ;).

I have updated the Quickstart to hopefully make this more
understandable. See

http://mini-buildd.installiert.net/doc/quickstart.html#epilogue
http://mini-buildd.installiert.net/doc/quickstart.html#authorize-yourself-to-do-package-uploads

for a preview.

> [2/391]mh@spinturn:~$ sudo -H -u mini-buildd gpg --list-secret-keys
(...)
> Clicking "Save" leads to an "500 Internal Server Error: Sorry,
> something went wrong" without any further explanation.

Just ftr, when you set something like this (via dpkg-reconfigure)

--verbose --verbose --debug=exception,http,webapp

I am pretty sure you get a django trace with something moaning about
missing user id or such.

> What did I do wrong?

Don't add or delete Uploader instances.

Could you check if that (newly described) workflow works for a newly
created user?

Thx,

S


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789494: poedit: relative path on command line -> can't open file ... (error 13: Permission denied)

[Jakub Wilk]

Package: poedit
Version: 1.8.1-3

I run poedit from command line this way:

$ poedit pl.po

The program happily opened the PO file; but when I tried to save it, I 
got an error:


can't open file '/pl.temp.po' (error 13: Permission denied)
Couldn't save file pl.po.


-- System Information:
Debian Release: stretch/sid
 APT prefers unstable
 APT policy: (990, 'unstable'), (500, 'experimental')
Architecture: i386 (x86_64)
Foreign Architectures: amd64

Kernel: Linux 4.0.0-2-amd64 (SMP w/2 CPU cores)
Locale: LANG=C, LC_CTYPE=pl_PL.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: sysvinit (via /sbin/init)

Versions of packages poedit depends on:
ii  gettext0.19.4-1
ii  libatk1.0-02.16.0-2
ii  libboost-regex1.55.0   1.55.0+dfsg-3
ii  libboost-system1.55.0  1.55.0+dfsg-3
ii  libc6  2.19-18
ii  libcairo2  1.14.2-2
ii  libcld2-0  0.0.0~svn194-1
ii  libdb5.3++ 5.3.28-9
ii  libexpat1  2.1.0-6+b3
ii  libfontconfig1 2.11.0-6.3
ii  libfreetype6   2.5.2-4
ii  libgcc11:5.1.1-11
ii  libgdk-pixbuf2.0-0 2.31.4-2
ii  libglib2.0-0   2.44.1-1
ii  libgtk2.0-02.24.28-1
ii  libgtkspell0   2.0.16-1.1
ii  libicu52   52.1-9
ii  liblucene++0   3.0.7-3
ii  libpango-1.0-0 1.36.8-3
ii  libpangocairo-1.0-01.36.8-3
ii  libpangoft2-1.0-0  1.36.8-3
ii  libstdc++6 5.1.1-11
ii  libwxbase3.0-0 3.0.2-1+b1
ii  libwxgtk3.0-0  3.0.2-1+b1
ii  poedit-common  1.8.1-3

--
Jakub Wilk


--
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#788314: zyne: Zyne is not starting due to import error ("No module named zyne.Resources.variables")

[Greg Farough]

Package: zyne
Version: 0.1.2-1
Followup-For: Bug #788314

I get the same bug, even after installing the missing python-wxversion
dependency.

-g

-- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (500, 'unstable')
Architecture: amd64 (x86_64)

Kernel: Linux 4.0.0-2-amd64 (SMP w/2 CPU cores)
Locale: LANG=en_US.utf8, LC_CTYPE=en_US.utf8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: sysvinit (via /sbin/init)

Versions of packages zyne depends on:
ii  python  2.7.9-1
ii  python-pyo  0.7.5-2

zyne recommends no packages.

zyne suggests no packages.

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789461: ITP: runescape -- Complete quests and win enormous treasures in RuneScape

[Scott Howard]

On Sun, Jun 21, 2015 at 4:04 AM, Carlos Donizete  wrote:
> Package: wnpp
> Severity: wishlist
> Owner: Carlos Donizete 
>
> * Package name: runescape
>   Version : 0.1
>   Upstream Author : Jagex Limited 
> * URL : http://www.runescape.com/
> * License : GPL-2+
>   Programming Lang: Java
>   Description : Complete quests and win enormous treasures in RuneScape
>
>  The game is a unofficial Linux client Java-based. It makes sure that
>  OpenGL works when using Java7/OpenJDK7.
>  .
>  RuneScape offers players a huge variety of benefits such as hundreds
>  of additional quests and adventures, a larger game world to explore,
>  exclusive skills and master and access to a whole host of minigames.
>  .
>  Players can also access the most powerful weaponry and armour in the game,
>  create clan citadels with their friends and even build their very own house.

thanks for looking in to this, here are some comments

I agree with what Johannes Schauer asked (who is the author, where is
it from, what does this package actually do), and the short and long
description should be updated accordingly. The first paragraph of the
long description should be more informative to potential users.
1) I also don't like calling open source software "official" or
"unofficial." It just is what it is. If it is just checking for
library compatibilities, then you actually are playing the "official"
(proprietary) game anyways.
2) Whether it is java-based or not doesn't really matter for someone
installing the package (unless there is a non-java alternative,
perhaps).
3) The mechanisms of checking for OpenGL working with Java7 doesn't
really matter to someone wanting to play the game/

If the code is DFSG, but requires non-free content to be useful, it is
at best contrib.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789496: poedit: wrong timezone offest in PO-Revision-Date

[Jakub Wilk]

Package: poedit
Version: 1.8.1-3
Usertags: i18nspector

poedit updated revision date in my PO file to:

PO-Revision-Date: 2015-06-21 16:17+0100

The local time is correct, but in my timezone (Europe/Warsaw) we're 
observing daylight saving time and the offset is +0200:


$ date --rfc-3339=seconds
2015-06-21 16:17:44+02:00


-- System Information:
Debian Release: stretch/sid
 APT prefers unstable
 APT policy: (990, 'unstable'), (500, 'experimental')
Architecture: i386 (x86_64)
Foreign Architectures: amd64

Kernel: Linux 4.0.0-2-amd64 (SMP w/2 CPU cores)
Locale: LANG=C, LC_CTYPE=pl_PL.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: sysvinit (via /sbin/init)

Versions of packages poedit depends on:
ii  gettext0.19.4-1
ii  libatk1.0-02.16.0-2
ii  libboost-regex1.55.0   1.55.0+dfsg-3
ii  libboost-system1.55.0  1.55.0+dfsg-3
ii  libc6  2.19-18
ii  libcairo2  1.14.2-2
ii  libcld2-0  0.0.0~svn194-1
ii  libdb5.3++ 5.3.28-9
ii  libexpat1  2.1.0-6+b3
ii  libfontconfig1 2.11.0-6.3
ii  libfreetype6   2.5.2-4
ii  libgcc11:5.1.1-11
ii  libgdk-pixbuf2.0-0 2.31.4-2
ii  libglib2.0-0   2.44.1-1
ii  libgtk2.0-02.24.28-1
ii  libgtkspell0   2.0.16-1.1
ii  libicu52   52.1-9
ii  liblucene++0   3.0.7-3
ii  libpango-1.0-0 1.36.8-3
ii  libpangocairo-1.0-01.36.8-3
ii  libpangoft2-1.0-0  1.36.8-3
ii  libstdc++6 5.1.1-11
ii  libwxbase3.0-0 3.0.2-1+b1
ii  libwxgtk3.0-0  3.0.2-1+b1
ii  poedit-common  1.8.1-3

--
Jakub Wilk


--
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789497: RFS: python-requirements-detector/0.4-1 [ITP]

[Daniel Stender]

Package: sponsorship-requests
Severity: wishlist

Hi,

I'm looking for an uploader resp. sponsor for my package of 
(python-)requirements-detector [1].

It's a prerequisite for Prospector [2].

The package is already pushed to a new Git repo of the DPMT:
http://anonscm.debian.org/cgit/python-modules/packages/python-requirements-detector.git

The buildlog is here:
http://www.danielstender.com/buildlogs/python-requirements-detector_0.4-1_amd64-20150621-1611.build

Mentors upload is available here:
http://mentors.debian.net/package/python-requirements-detector
http://mentors.debian.net/debian/pool/main/p/python-requirements-detector/python-requirements-detector_0.4-1.dsc

Thanks,
Daniel Stender

[1] https://bugs.debian.org/788208
ITP: python-requirements-detector -- find and list requirements of a Python 
project

[2] https://bugs.debian.org/781165
ITP: prospector -- Python code analysis tool

--
http://qa.debian.org/developer.php?login=debian%40danielstender.com
4096R/DF5182C8
46CB 1CA8 9EA3 B743 7676 1DB9 15E0 9AF4 DF51 82C8


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#787635: jessie-pu: package libisocodes/1.2.1-1

[Dr. Tobias Quathamer]

Control: tags -1 - moreinfo

Am 20.06.2015 um 20:53 schrieb Adam D. Barratt:
> Control: tags -1 + moreinfo
> 
> On Wed, 2015-06-03 at 18:08 +0200, Dr. Tobias Quathamer wrote:
>> I'd like to update the library libisocodes in jessie.
>>
>> Paul Wise reported a bug which affects the build of www.debian.org.
>> Currently, there is a workaround in place, however, Paul suggested that
>> this bug should be fixed in stable as well (#787395).
> [...]
>> Would you consider such changes for a stable point release?
> 
> In principle, I'd be prepared to do so.
> 
> Before finally confirming that however, we'd need a debdiff of the
> proposed package (not just the upstream changes) and confirmation that
> the resulting package has been tested on jessie.

Hi Adam,

thanks for your reply. I've attached the output of debdiff for the
version currently in jessie and the proposed update.

I've just tried to install the newly built library in an up-to-date
jessie installation. It works fine for me and the bug is resolved.

@Paul:
Do you have the time to also try the new version and confirm that the
bug is resolved for you, too?

Regards,
Tobias

diff -Nru libisocodes-1.2.1/ChangeLog libisocodes-1.2.2/ChangeLog
--- libisocodes-1.2.1/ChangeLog	2014-07-08 20:21:51.0 +0200
+++ libisocodes-1.2.2/ChangeLog	2015-06-02 23:30:40.0 +0200
@@ -1,3 +1,12 @@
+libisocodes 1.2.2
+=
+2015-06-02
+
+* Fix GLib critical warning if the environment variable LANGUAGE
+  is not set. Thanks to Paul Wise for the bug report.
+  Closes: #787395
+
+
 libisocodes 1.2.1
 =
 2014-07-08
diff -Nru libisocodes-1.2.1/configure libisocodes-1.2.2/configure
--- libisocodes-1.2.1/configure	2014-07-08 20:20:53.0 +0200
+++ libisocodes-1.2.2/configure	2015-06-02 17:43:31.0 +0200
@@ -1,6 +1,6 @@
 #! /bin/sh
 # Guess values for system-dependent variables and create Makefiles.
-# Generated by GNU Autoconf 2.69 for libisocodes 1.2.1.
+# Generated by GNU Autoconf 2.69 for libisocodes 1.2.2.
 #
 # Report bugs to .
 #
@@ -650,8 +650,8 @@
 # Identity of this package.
 PACKAGE_NAME='libisocodes'
 PACKAGE_TARNAME='libisocodes'
-PACKAGE_VERSION='1.2.1'
-PACKAGE_STRING='libisocodes 1.2.1'
+PACKAGE_VERSION='1.2.2'
+PACKAGE_STRING='libisocodes 1.2.2'
 PACKAGE_BUGREPORT='to...@debian.org'
 PACKAGE_URL=''
 
@@ -1419,7 +1419,7 @@
   # Omit some internal or obsolete options to make the list less imposing.
   # This message is too long to be a string in the A/UX 3.1 sh.
   cat <<_ACEOF
-\`configure' configures libisocodes 1.2.1 to adapt to many kinds of systems.
+\`configure' configures libisocodes 1.2.2 to adapt to many kinds of systems.
 
 Usage: $0 [OPTION]... [VAR=VALUE]...
 
@@ -1489,7 +1489,7 @@
 
 if test -n "$ac_init_help"; then
   case $ac_init_help in
- short | recursive ) echo "Configuration of libisocodes 1.2.1:";;
+ short | recursive ) echo "Configuration of libisocodes 1.2.2:";;
esac
   cat <<\_ACEOF
 
@@ -1620,7 +1620,7 @@
 test -n "$ac_init_help" && exit $ac_status
 if $ac_init_version; then
   cat <<\_ACEOF
-libisocodes configure 1.2.1
+libisocodes configure 1.2.2
 generated by GNU Autoconf 2.69
 
 Copyright (C) 2012 Free Software Foundation, Inc.
@@ -1898,7 +1898,7 @@
 This file contains any messages produced by compilers while
 running configure, to aid debugging if configure makes a mistake.
 
-It was created by libisocodes $as_me 1.2.1, which was
+It was created by libisocodes $as_me 1.2.2, which was
 generated by GNU Autoconf 2.69.  Invocation command line was
 
   $ $0 $@
@@ -2767,7 +2767,7 @@
 
 # Define the identity of the package.
  PACKAGE='libisocodes'
- VERSION='1.2.1'
+ VERSION='1.2.2'
 
 
 cat >>confdefs.h <<_ACEOF
@@ -2860,6 +2860,7 @@
   fi
 fi
 
+
 { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether to enable maintainer-specific portions of Makefiles" >&5
 $as_echo_n "checking whether to enable maintainer-specific portions of Makefiles... " >&6; }
 # Check whether --enable-maintainer-mode was given.
@@ -11515,7 +11516,7 @@
 # Only expand once:
 
 
-LIBISOCODES_LT_VERSION="2:0:1"
+LIBISOCODES_LT_VERSION="2:1:1"
 
 
 # Check for compilers and pkg-config
@@ -15379,7 +15380,7 @@
 # report actual input values of CONFIG_FILES etc. instead of their
 # values after options handling.
 ac_log="
-This file was extended by libisocodes $as_me 1.2.1, which was
+This file was extended by libisocodes $as_me 1.2.2, which was
 generated by GNU Autoconf 2.69.  Invocation command line was
 
   CONFIG_FILES= $CONFIG_FILES
@@ -15445,7 +15446,7 @@
 cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
 ac_cs_config="`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/&/g'`"
 ac_cs_version="\\
-libisocodes config.status 1.2.1
+libisocodes config.status 1.2.2
 configured by $0, generated by GNU Autoconf 2.69,
   with options \\"\$ac_cs_config\\"
 
diff -Nru libisocodes-1.2.1/configure.ac libisocodes-1.2.2/configure.ac
--- libisocodes-1.2.1/configure.ac	2014-07-08 20:13:05.0 +0

Bug#772621: link-monitor-applet: uses deprecated panel_applet_gconf_* functions

[Dmitry Shachnev]

Hi Joachim,

On Tue, 09 Dec 2014 10:47:27 +0100, Joachim Breitner wrote:
> Am Dienstag, den 09.12.2014, 08:51 + schrieb Dmitry Shachnev:
>> Package: link-monitor-applet
>> Version: 3.0-11
>> Severity: important
>> Justification: will FTBFS soon
>
> thanks. JFTR, I’m not using l-m-a any more and am looking for someone to
> take it over: #762008
>
> If noone steps up before this hits unstable, I guess we’ll have to
> remove the package :-(.

gnome-panel 3.16 is now in unstable, which effectively means that l-m-applet
FTBFS with it.

As the last upstream release was in 2008, and nobody wants to maintain it
(in upstream or in Debian), I think removing it will be the best choice.

--
Dmitry Shachnev

signature.asc
Description: OpenPGP digital signature

Bug#787714: cups-client: inconsistent ordering for lpstat jobs

[Brian Potkin]

found 787714 2.0.3-2
severity 787714 minor
tags 787714 upstream
thanks



Thank you for your report, Santiago,


On Thu 04 Jun 2015 at 13:17:32 +0200, Santiago Vila wrote:

> When I do this:
> 
> lpstat -W completed myprinter
> 
> I get a list of jobs in reverse chronological order. However, when I do this:
> 
> lpstat -W not-completed myprinter
> 
> I get a list of jobs in chronological order.
> 
> This makes no sense. Previously, both things were in chronological
> order, and it was ok. If we are going to reverse the order, it should
> be done in a consistent way. If not, it would be better to keep things
> as they originally were (chronological order always).

Using version 2.0.3-2 from experimental:

  With lpstat   Order
  ---

  lpstat -W completed myprinter Reverse chronological
  lpstat -W not-completed myprinter Chronological
  lpstat -W all myprinter   Chronological

  Web interface (using lynx)
  -

  Completed JobsChronological
  Active Jobs (pending) Chronological
  All Jobs  Reverse chronological

Santiago, it would be very helpful if you would report this upstream and
provide a link to the report here.

  https://www.cups.org/str.php

Regards,

Brian.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789485: jruby: Don't bundle all jruby dependencies inside jruby-core jar file

[Emmanuel Bourg]

Le 21/06/2015 15:31, Miguel Landaeta a écrit :

> This is a bad practice that can lead to bugs due to outdated
> dependencies or security bugs when dependencies are patched
> but jruby is not rebuild.
> 
> This also should reduce jruby binary package size.

It looks like the embedded dependencies are also relocated under the
org.jruby namespace. Removing them could lead to incompatibilities with
applications importing them.

I'd rather document the inclusion with a Built-Using field rather than
diverging from upstream.

Emmanuel Bourg


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789498: mkvtoolnix-gui: Fails to load files given on the commandline

[Peter Keel]

Package: mkvtoolnix-gui
Version: 8.0.0-1
Severity: important

Dear Maintainer,

Since the new GUI, mkvtoolnix-gui fails to parse the commandline.

Beforehand, it was possible to give the files to mux from the 
commandline. 

This is a regression, making the program very awkward to use.


-- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (700, 'unstable'), (10, 'experimental')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 4.0.5 (SMP w/4 CPU cores; PREEMPT)
Locale: LANG=en_GB, LC_CTYPE=en_GB.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages mkvtoolnix-gui depends on:
ii  libboost-filesystem1.55.0  1.55.0+dfsg-3
ii  libboost-regex1.55.0   1.55.0+dfsg-3
ii  libboost-system1.55.0  1.55.0+dfsg-3
ii  libc6  2.19-18
ii  libcurl3-gnutls7.43.0-1
ii  libebml4   1.3.1-dmo2
ii  libgcc11:5.1.1-11
ii  libmagic1  1:5.22+15-2
ii  libmatroska6   1.4.2-dmo2
ii  libqt5core5a   5.3.2+dfsg-5
ii  libqt5gui5 5.3.2+dfsg-5
ii  libqt5widgets5 5.3.2+dfsg-5
ii  libstdc++6 5.1.1-11
ii  mkvtoolnix 8.0.0-1
ii  zlib1g 1:1.2.8.dfsg-2+b1

mkvtoolnix-gui recommends no packages.

mkvtoolnix-gui suggests no packages.

-- no debconf information


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789499: busybox: FTBFS with clang instead of gcc

[Joseph Lee]

Source: busybox
Version: 1.22.0
Severity: minor

Dear Maintainer,

Hello,

Using the rebuild infrastructure, your package fails to build with clang 
instead of gcc.

The error message is like this:
>>debianutils/lib.a(mktemp.o): In function `mktemp_main':
>>/home/builder/workspace/busybox/busybox-1.22.0/build/udeb/debianutils/mktemp.c:96:
>> warning: the use of `mktemp' is dangerous, better use `mkstemp' or `mkdtemp'
>>archival/lib.a(tar.o): In function `tar_main':
>>/home/builder/workspace/busybox/busybox-1.22.0/build/udeb/archival/tar.c:1180:
>> undefined reference to `unpack_Z_stream'
>>/usr/bin/ld: busybox_unstripped: hidden symbol `unpack_Z_stream' isn't defined
>>/usr/bin/ld: final link failed: Bad value
>>clang: error: linker command failed with exit code 1 (use -v to see 
>>invocation)

I found this is because of one recipe's dependency wasn't satisfied when
building this package with clang. I found a similar case here 
http://lists.busybox.net/pipermail/busybox/2013-January/078871.html.
But changing optimization level which was mentioned in this thread wasn't
worked for this package. So I fixed it by simply add a conditional statement
in makefile to deal with this difference.

Many thanks,
Joseph.

-- System Information:
Debian Release: stretch/sid
  APT prefers unstable
  APT policy: (500, 'unstable')
Architecture: amd64 (x86_64)

Kernel: Linux 4.0.5-1-ARCH (SMP w/8 CPU cores; PREEMPT)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8) (ignored: LC_ALL 
set to en_US.UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: unable to detect
diff -Nru busybox-1.22.0/debian/patches/clang_built.patch busybox-1.22.0/debian/patches/clang_built.patch
--- busybox-1.22.0/debian/patches/clang_built.patch	1970-01-01 00:00:00.0 +
+++ busybox-1.22.0/debian/patches/clang_built.patch	2015-06-05 11:10:25.0 +
@@ -0,0 +1,12 @@
+--- a/archival/libarchive/Kbuild.src
 b/archival/libarchive/Kbuild.src
+@@ -45,6 +45,9 @@
+ lib-$(CONFIG_AR)+= get_header_ar.o unpack_ar_archive.o
+ lib-$(CONFIG_CPIO)  += get_header_cpio.o
+ lib-$(CONFIG_TAR)   += get_header_tar.o
++ifeq ($(shell $(CC) --version | grep -c "clang version"),1)
++lib-$(CONFIG_TAR)   += get_header_tar.o decompress_uncompress.o
++endif
+ lib-$(CONFIG_FEATURE_TAR_TO_COMMAND)+= data_extract_to_command.o
+ lib-$(CONFIG_LZOP)  += lzo1x_1.o lzo1x_1o.o lzo1x_d.o
+ lib-$(CONFIG_LZOP_COMPR_HIGH)   += lzo1x_9x.o
diff -Nru busybox-1.22.0/debian/patches/series busybox-1.22.0/debian/patches/series
--- busybox-1.22.0/debian/patches/series	2015-03-04 16:02:27.0 +
+++ busybox-1.22.0/debian/patches/series	2015-06-05 11:08:37.0 +
@@ -29,3 +29,4 @@
 update-deb-format-support.patch
 
 CVE-2014-9645.patch
+clang_built.patch

Bug#789500: RM: link-monitor-applet -- ROM; Unmaintained, FTBFS

[Joachim Breitner]

Package: ftp.debian.org
Severity: normal

-BEGIN PGP SIGNED MESSAGE-
Hash: SHA1

Hi,

although I am kind of sad to see it go, I have to request its removal,
as there is noone to maintain it, and it is holding up other things (see
#772621).

Greetings,
Joachim

-BEGIN PGP SIGNATURE-
Version: GnuPG v1

iEYEARECAAYFAlWGz6oACgkQ9ijrk0dDIGxbDgCbBprlSi/IRrPdzgukv2kJpoxh
6nwAmQG2o64e9P+n66fv3UFAxyjdZgVp
=dlLx
-END PGP SIGNATURE-


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789501: Useless in Debian

[David Prévot]

Package: php-propel-runtime
Version: 1.6.9-1
Severity: serious
Tags: sid stretch

[Filled as RC by the maintainer to see it autoremoved from testing if
 nobody disagrees. Please, do downgrade it with an explanation if you
 disagree. If so, you may wish to adopt it (#782861). ]

I initially packaged php-propel-runtime as used by symfony, but the
current version of symfony doesn’t use Propel anymore.

I intend to follow up with an RM request in a few months if nobody
objects (but feel free to beat me to it).

Regards

David


signature.asc
Description: Digital signature

Bug#789395: libdrm-nouveau2: pushbuf.c not found

[Heiko Ernst]

Am Sonntag, 21. Juni 2015, 15:03:10 schrieben Sie:
> Control: tag -1 moreinfo
> 
> Please provide complete information, not just tiny excerpts.
> 
> Cheers,
> Julien

my motherboard is a asus rampage 2 extreme it have a pci-e 2.0 and 
my graphics
card is a geforce gtx 670, pci 3.0. since i have install this graphics card 
i
have this warnings on my /var/log/messages

May 19 09:52:26 debian kernel: [8.474107] ACPI Warning: SystemIO 
range
0x0828-0x082f conflicts with OpRegion
0x0800-0x084f (\PMRG) 
(20140424/utaddress-258)
May 19 09:52:26 debian kernel: [8.474113] ACPI: If an ACPI driver is
available for this device, you should use it instead of the native driver
May 19 09:52:26 debian kernel: [8.474116] ACPI Warning: SystemIO 
range
0x0530-0x053f conflicts with OpRegion
0x0500-0x053f (\GPS0) 
(20140424/utaddress-258)
May 19 09:52:26 debian kernel: [8.474118] ACPI: If an ACPI driver is
available for this device, you should use it instead of the native driver
May 19 09:52:26 debian kernel: [8.474119] ACPI Warning: SystemIO 
range
0x0500-0x052f conflicts with OpRegion
0x0500-0x050f (\SBG6) 
(20140424/utaddress-258)
May 19 09:52:26 debian kernel: [8.474122] ACPI Warning: SystemIO 
range
0x0500-0x052f conflicts with OpRegion
0x0500-0x053f (\GPS0) 
(20140424/utaddress-258)
May 19 09:52:26 debian kernel: [8.474124] ACPI: If an ACPI driver is
available for this device, you should use it instead of the native driver
May 19 09:52:26 debian kernel: [8.474125] lpc_ich: Resource 
conflict(s)
found affecting gpio_ich
May 19 09:52:26 debian kernel: [8.512924] EDAC MC: Ver: 3.0.0


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#754229: lxpanel: sound volume plugin does not start alsamixer

[Andriy Grytsenko]

control: tag -1 + fixed moreinfo

Well, this very much likely is fixed now, we just need a feedback reply.
Thank you.


-- 
To UNSUBSCRIBE, email to debian-bugs-dist-requ...@lists.debian.org
with a subject of "unsubscribe". Trouble? Contact listmas...@lists.debian.org

Bug#789502: Useless in Debian

[David Prévot]

Package: php-guzzlehttp-message-integrity-subscriber
Version: 0.2.0-2
Severity: serious

[Filled as RC by the maintainer to see it autoremoved from testing if
 nobody disagrees. Please, do downgrade it with an explanation if you
 disagree. This package is not part of Jessie. ]

I initially packaged php-guzzlehttp-message-integrity-subscriber as used
by php-aws-sdk 3.0.0~beta1, but php-aws-sdk 3 doesn’t use it anymore.

I intend to follow up with an RM request in a few months if nobody
objects (but feel free to beat me to it).

Regards

David


signature.asc
Description: Digital signature

Bug#789503: Useless in Debian

[David Prévot]

Package: php-guzzlehttp-log-subscriber
Version: 1.0.1-2
Severity: serious


[Filled as RC by the maintainer to see it autoremoved from testing if
 nobody disagrees. Please, do downgrade it with an explanation if you
 disagree. This package is not part of Jessie. ]

I initially packaged php-guzzlehttp-log-subscriber as used by
php-aws-sdk 3.0.0~beta1, but php-aws-sdk 3 doesn’t use it anymore.

I intend to follow up with an RM request in a few months if nobody
objects (but feel free to beat me to it).

Regards

David


signature.asc
Description: Digital signature

Bug#788689: u-boot: Please add support for Tegra (Jetson TK1)

[Vagrant Cascadian]

On 2015-06-14, Ian Campbell wrote:
> Attached is a patch to enable support for the Jetson Tegra K1 board via a new
> u-boot-tegra package. It is based on the experimental-2015.07 branch of git. I
> can push it myself if you prefer but I thought I'd best have it reviewed 
> first.

Looks fine to me. Feel free to commit it!

One question this brings up, though: According to wikipedia, there is
also a 64-bit variant; would that use a different u-boot?

All the u-boot packages are marked "multi-arch: same", but if there's
the possibility of both an armhf and amd64 u-boot-tegra package
containing different builds, maybe we'll need to reconsider how to
handle multi-arch with u-boot packaging...


> I'm not entirely happy with the requirement (documented in the README) to use
> L4T to do the flashing but I've not yet worked out a fully working alternative
> (I think something must be possible using some combination of tegracrm and
> cbotimage both of which are in Debian, but I've not figured out the exact 
> steps
> yet).

You could perhaps include a TODO item in the README (or a separate TODO
file); that might stir someone else to submit improved docs...


live well,
  vagrant

>>From 7a667f75db13d80e68179554f344774132c4a7fd Mon Sep 17 00:00:00 2001
> From: Ian Campbell 
> Date: Sun, 7 Jun 2015 22:40:20 +0100
> Subject: [PATCH] Add support for Tegra Jetson TK-1
>
> ---
>  debian/control| 15 +++
>  debian/targets|  3 +++
>  debian/u-boot-tegra.README.Debian | 13 +
>  debian/u-boot-tegra.install   |  2 ++
>  debian/u-boot-tegra.lintian-overrides | 11 +++
>  5 files changed, 44 insertions(+)
>  create mode 100644 debian/u-boot-tegra.README.Debian
>  create mode 100755 debian/u-boot-tegra.install
>  create mode 100644 debian/u-boot-tegra.lintian-overrides
>
> diff --git a/debian/control b/debian/control
> index 1433227..292241d 100644
> --- a/debian/control
> +++ b/debian/control
> @@ -36,6 +36,21 @@ Description: A boot loader for imx systems
>   .
>   This package includes boot loaders for various imx platforms.
>  
> +Package: u-boot-tegra
> +Architecture: armhf
> +Multi-Arch: same
> +Depends: ${misc:Depends}
> +Breaks: u-boot (<< 2014.10~rc2+dfsg1-2~)
> +Replaces: u-boot (<< 2014.10~rc2+dfsg1-2~)
> +Description: A boot loader for tegra systems
> + Das U-Boot is a cross-platform bootloader for embedded systems,
> + used as the default boot loader by several board vendors.  It is
> + intended to be easy to port and to debug, and runs on many
> + supported architectures, including PPC, ARM, MIPS, x86, m68k,
> + NIOS, and Microblaze.
> + .
> + This package includes boot loaders for various tegra platforms.
> +
>  Package: u-boot-omap
>  Architecture: armhf
>  Multi-Arch: same
> diff --git a/debian/targets b/debian/targets
> index ab1e2e4..95f2d84 100644
> --- a/debian/targets
> +++ b/debian/targets
> @@ -44,6 +44,9 @@ armhf   imx usbarmory   u-boot.imx
>  # Robert Nelson 
>  armhfimx wandboard   u-boot.img spl/u-boot-spl.bin 
> SPL
>  
> +# Ian Campbell 
> +armhftegra   jetson-tk1  u-boot-dtb-tegra.bin
> +
>  # Vagrant Cascadian 
>  # Andrew M.A. Cater 
>  armhfomapam335x_boneblack u-boot.img spl/u-boot-spl.bin 
> MLO
> diff --git a/debian/u-boot-tegra.README.Debian 
> b/debian/u-boot-tegra.README.Debian
> new file mode 100644
> index 000..3d5d79f
> --- /dev/null
> +++ b/debian/u-boot-tegra.README.Debian
> @@ -0,0 +1,13 @@
> +== Installation ==
> +
> +At this point, you must install U-Boot to flash yourself from a host
> +system using the Linux_For_Tegra tools.
> +
> +sudo ./flash.sh -L /usr/lib/u-boot/jetson-tk1/u-boot-dtb-tegra.bin 
> jetson-tk1 mmcblk1p1
> +
> +It seems that L4T R19.3.0 is currently required (image does not boot
> +if flashed with L4T R21.X).
> +
> +== U-Boot environment tools ==
> +
> +fw_printenv / fw_setenv read /etc/fw_env.config for configuration.
> diff --git a/debian/u-boot-tegra.install b/debian/u-boot-tegra.install
> new file mode 100755
> index 000..15b8ab9
> --- /dev/null
> +++ b/debian/u-boot-tegra.install
> @@ -0,0 +1,2 @@
> +#!/bin/sh
> +debian/bin/u-boot-install-targets tegra
> diff --git a/debian/u-boot-tegra.lintian-overrides 
> b/debian/u-boot-tegra.lintian-overrides
> new file mode 100644
> index 000..3884f10
> --- /dev/null
> +++ b/debian/u-boot-tegra.lintian-overrides
> @@ -0,0 +1,11 @@
> +
> +# There are no file conflicts across architectures for u-boot, as each
> +# target is only installed on a single architecture. In theory, some
> +# targets could be built on multiple architectures, but could instead install
> +# the package for the architecture needed.
> +u-boot-tegra [armhf]: arch-dependent-file-not-in-arch-specific-directory 
> usr/lib/u-boot/jetson-tk1/uboot.elf
> +
> +# These bootloaders need to be statically linked.
> +u-boot-tegra [armhf]: statically-linked-binary 
> usr/lib/u-boo