Re: [ccp4bb] mosflm and pilatus 2M
Mosflm works fine with our Pilatus 2M at DLS - however you do need to be using the beta-test version. http://www.mrc-lmb.cam.ac.uk/harry/mosflm/betas/ best wishes, Graeme On 12 March 2012 19:57, Dean Derbyshire wrote: > Hi again, it's the 2M detector I'm having problems with. Got different data > from a 6M and yep that works a dream. > > ? > > :0) > > > > > From: Harry [ha...@mrc-lmb.cam.ac.uk] > Sent: 12 March 2012 20:30 > To: Dean Derbyshire > Cc: Harry; CCP4BB@JISCMAIL.AC.UK > Subject: Re: [ccp4bb] mosflm and pilatus 2M > > Hi Dean > > I'd get in touch with the Mosflm authors and ask them for help ;-) > > A copy of the mosflm.lp file (or the date-stamped version from iMosflm) would > be useful in diagnosing the problem. > > On 12 Mar 2012, at 18:22, Dean Derbyshire wrote: > > Has anyone successfully processed images from the new Pilatus detector? > I can visualize them and auto index but not refine the cell or integrate! > Oh I’m using version 7.0.7 > > Cheers > > Dean > > Harry > -- > Dr Harry Powell, MRC Laboratory of Molecular Biology, MRC Centre, Hills Road, > Cambridge, CB2 0QH
Re: [ccp4bb] Envelope Phasing.
Using an envelope or a mask to start phasing even with high NCS is still worse than using a low res model from cryoEM that is characterized by an (almost) proper density distribution. One has to measure the intensities of the very low res reflections (0 0 1 and the likes) precisely. The presence of high NCS does not guarantee a success even if your initial model is "good" as described in Section 9 here: http://www.ncbi.nlm.nih.gov/pubmed/11526317 Petr -- Petr Leiman EPFL IPSB-LBBS BSP-415 CH-1015 Lausanne Suisse
[ccp4bb] merge dataset
Hi CCP4bb, I have two dataset from one crystal with different distance.now i am wondering how to merge the two dataset into one file,and use it to refinement. thanks a lot! deng
Re: [ccp4bb] merge dataset
Hello Deng, Process them as usual with e.g. Mosflm, then sort them together (you may need to rebatch one of the runs) and do one Scala run - this will put all of the measurement on a common scale and write out data suitable for refinement. For pointgroups with ambiguous origin choices (e.g. P4) you should also run the data through pointless to confirm you have made the same choice with both sweeps. If you fancy, you can always run xia2 to do this, simply put all of the images into one directory and run xia2 -2d /here/are/the/images to use Mosflm and Scala or xia2 -3d /here/are/the/images to use XDS / XSCALE (provided you have those installed) Best wishes, Graeme On 13 March 2012 08:19, dengzq1987 wrote: > Hi CCP4bb, > > I have two dataset from one crystal with different distance.now i am > wondering how to merge the two dataset into one file,and use it to > refinement. > > > thanks a lot! > > > deng >
[ccp4bb] MR and pseudo-translationnal-symmetry
Dear ccp4, I have a case of PTS and wonder what's the best strategy to handle my data. I processed my data in C2 with a=161 b=109 c=225 beta=104. The data in 97% complete to 3,8A. xtriage detected a 40% peak in the patterson at fractional coordinates x=-0,001 y=0,055 z=0,5. I want to try to phase using MR. Should I: - leave the data in C2 (fully complete) and specify the program to use PST. - expand from C2 to P1 and run using PST. - re-index in P1 (a=98 b=97 c=225, alpha=78 beta=78, gamma=68) with only ca. 80% completeness, and specify PST. before shooting more crystals to increase compleness and going for HA phasing, i was wondering if i could do something with what i have. thank you for your input. vincent -- Vincent Chaptal, PhD Institut de Biologie et Chimie des Protéines Drug-resistance modulation and mechanism Laboratory 7 passage du Vercors 69007 LYON FRANCE +33 4 37 65 29 01 http://www.ibcp.fr
Re: [ccp4bb] MR and pseudo-translationnal-symmetry
Dear Vincent, The easiest thing for you to do right now in the CCP4 context is to run Molrep, with the flag for PTS turned on. If that works and gives a clear solution, that's great. If not, then I'd suggest downloading a recent version of Phenix and trying the new version of Phaser that handles translational NCS, as in yesterday's discussion. I don't think there's an advantage to reindexing, unless you have some reason to suspect that the true space group is not C2. In some cases, if the translation is close enough to a lattice translation, you can assume an exact lattice translation and reindex in a smaller cell, throwing away the weak half of the data, but I think the y-component of your translation is too far from zero for that to be a reasonable alternative. Best wishes, Randy Read On 13 Mar 2012, at 09:21, vincent Chaptal wrote: > Dear ccp4, > > I have a case of PTS and wonder what's the best strategy to handle my data. > > I processed my data in C2 with a=161 b=109 c=225 beta=104. The data in 97% > complete to 3,8A. > xtriage detected a 40% peak in the patterson at fractional coordinates > x=-0,001 y=0,055 z=0,5. > > I want to try to phase using MR. > Should I: > - leave the data in C2 (fully complete) and specify the program to use PST. > - expand from C2 to P1 and run using PST. > - re-index in P1 (a=98 b=97 c=225, alpha=78 beta=78, gamma=68) with only ca. > 80% completeness, and specify PST. > > before shooting more crystals to increase compleness and going for HA > phasing, i was wondering if i could do something with what i have. > thank you for your input. > vincent > > > -- > Vincent Chaptal, PhD > Institut de Biologie et Chimie des Protéines > Drug-resistance modulation and mechanism Laboratory > 7 passage du Vercors > 69007 LYON > FRANCE > +33 4 37 65 29 01 > http://www.ibcp.fr > -- Randy J. Read Department of Haematology, University of Cambridge Cambridge Institute for Medical Research Tel: + 44 1223 336500 Wellcome Trust/MRC Building Fax: + 44 1223 336827 Hills RoadE-mail: rj...@cam.ac.uk Cambridge CB2 0XY, U.K. www-structmed.cimr.cam.ac.uk
Re: [ccp4bb] MR and pseudo-translationnal-symmetry
There are 3 options: 1) Use molrep. If you have two copies related with PST then it can give right solution 2) Take the latest version of phaser and use it. It can deal with PST with two related copies also 3) Reduce cell dimensions (it does not seem to be possible in your case. PST is not exactly on cell edges. But you can try). Work in c2 with smaller cell and then expand. but before going into all these trouble make sure that you really have PST. Calculating patterson (ccp4i, fft) and displaying using coot can give you some insight. Relation between origin and non-origin peaks can give you some insight. regards Garib On 13 Mar 2012, at 10:21, vincent Chaptal wrote: > Dear ccp4, > > I have a case of PTS and wonder what's the best strategy to handle my data. > > I processed my data in C2 with a=161 b=109 c=225 beta=104. The data in 97% > complete to 3,8A. > xtriage detected a 40% peak in the patterson at fractional coordinates > x=-0,001 y=0,055 z=0,5. > > I want to try to phase using MR. > Should I: > - leave the data in C2 (fully complete) and specify the program to use PST. > - expand from C2 to P1 and run using PST. > - re-index in P1 (a=98 b=97 c=225, alpha=78 beta=78, gamma=68) with only ca. > 80% completeness, and specify PST. > > before shooting more crystals to increase compleness and going for HA > phasing, i was wondering if i could do something with what i have. > thank you for your input. > vincent > > > -- > Vincent Chaptal, PhD > Institut de Biologie et Chimie des Protéines > Drug-resistance modulation and mechanism Laboratory > 7 passage du Vercors > 69007 LYON > FRANCE > +33 4 37 65 29 01 > http://www.ibcp.fr > Garib N Murshudov Structural Studies Division MRC Laboratory of Molecular Biology Hills Road Cambridge CB2 0QH UK Email: ga...@mrc-lmb.cam.ac.uk Web http://www.mrc-lmb.cam.ac.uk
Re: [ccp4bb] Help! weird thing
That difference density looks too good to be true.. There is obviously a very strong non-crystallographic translation. Is the spacegroup and/or cell correct? Eleanor On Mar 11 2012, xiaoyazi2008 wrote: Hi All, I have an interesting thing to share. 2.3A dataset with good quality, P21 Partial model is available (~60% of the target protein). It seems that there are 4 copies in the ASU (Matthews_coef 2.6, 53%solvent) Molecular replacement gave two copies of the model (Z scores are R6.2, T6.2, R6.8, T13.4). The solution is very clear. It could not locate the rest two copies. However, a quick refmac5 refinement gave a very high R factor. The funny part is the symmetry operation in Coot. As shown in the JPEG figure, it looks like there should be another two copies (based on strong fo-fc green map), which locate in the empty space between models found by Phaser. Why is that Phaser could not find the remaining two copies even there are strong fo-fc density? Any suggestions... Thanks a lot! Zhihong -- Professor Eleanor Dodson YSNL, Dept of Chemistry University of York Heslington YO10 5YW tel: 00 44 1904 328259 Fax: 00 44 1904 328266
Re: [ccp4bb] Matthews coeff. from model
rwcontents xyzin my.pdb Eleanor It will not be able to guess the number og H atoms associated with the RNA so the answer will be a bit out. Eleanor On Mar 12 2012, james09 pruza wrote: Dear CCP4bbers, Is there any tool to calculate the Matthews coefficient from a crystallographic model of RNA-protein complex? Thanking you. James. -- Professor Eleanor Dodson YSNL, Dept of Chemistry University of York Heslington YO10 5YW tel: 00 44 1904 328259 Fax: 00 44 1904 328266
Re: [ccp4bb] MR and pseudo-translationnal-symmetry
I would try molrep - it will detect the NC translation and use it.. Eleanor On Mar 13 2012, vincent Chaptal wrote: Dear ccp4, I have a case of PTS and wonder what's the best strategy to handle my data. I processed my data in C2 with a=161 b=109 c=225 beta=104. The data in 97% complete to 3,8A. xtriage detected a 40% peak in the patterson at fractional coordinates x=-0,001 y=0,055 z=0,5. I want to try to phase using MR. Should I: - leave the data in C2 (fully complete) and specify the program to use PST. - expand from C2 to P1 and run using PST. - re-index in P1 (a=98 b=97 c=225, alpha=78 beta=78, gamma=68) with only ca. 80% completeness, and specify PST. before shooting more crystals to increase compleness and going for HA phasing, i was wondering if i could do something with what i have. thank you for your input. vincent -- Professor Eleanor Dodson YSNL, Dept of Chemistry University of York Heslington YO10 5YW tel: 00 44 1904 328259 Fax: 00 44 1904 328266
[ccp4bb] Postdoc position available at the University of Oregon
The Nolen lab in the Institute of Molecular Biology at the University of Oregon is seeking a highly motivated postdoctoral researcher to join our lab full time on a flexible start date. Our interest is in understanding the molecular basis for the regulation of the cytoskeleton. We are currently focusing on proteins that control the assembly and disassembly of actin filaments. Using a combination of x-ray crystallography, biochemistry, biophysics, cell biology, and single molecule fluorescence microscopy we seek to understand the structure-function relationships of these proteins and how their molecular mechanisms relate to their cellular activities. For full position information and application procedure, please see: http://hr.uoregon.edu/jobs (see posting # 12090). Candidates who promote and enhance diversity are strongly desired. The University of Oregon is an Equal Opportunity/Affirmative Action Institution committed to cultural diversity and compliance with the Americans with Disabilities Act.
Re: [ccp4bb] My protein precipitates at r.t and dissolves at 4 oC
Hi Min, Please try this way if you use your protein for crystallization. 1. collect the needle and run SDS page or FPLC to verify the presence of protein. Make sure it is not a buffer salt. 2. You don't need to do dialysis to remove b-ME, otherwise it will take too long and you may lose some protein. Here is what I did before: 1. Kee you stock protein solution with 2mM b-ME on ice-bath. 2. Use those eppendoff like tubue (~ 500ul) with membrane, which we use to concentrate protein with reasonable MW cut-off (I usually used 8KD). 3. Add protein solution with b-ME (2mM) in the tube, spin down (10K, eppendoff centrifuge) for 2mins, 4. Use your pipette to measure how much solution has been filted into the bottom tube. 5. add equal amount fresh buffer solution without b-ME to the top tube, Repeat 3~5 times, and make the fine concentration of b-ME to <0.5mM. Then use the protein immediately for crystallization. Actually, I used the same way for buffer exchange, instead of dialysis. Based on this way, I crystallized thiopurine methyltransferase with 2.0 Ang after folks' 5 years effort. The images is available here: http://www.jinkai.org/Crystal_imgs.html Best, Kevin On Tue, Mar 13, 2012 at 8:36 AM, Min-Kyu Cho wrote: > Thank you Kevin, > > I will try to remove b-ME as you suggested. > > Min-Kyu > > | -Original Message- > | From: Kevin Jin [mailto:kevin...@gmail.com] > | Sent: Monday, March 12, 2012 5:50 PM > | To: Min-Kyu Cho > | Subject: Re: [ccp4bb] My protein precipitates at r.t and dissolves at 4 > | oC > | > | Hi Min, > | > | I need to look back my note. Here is from my old memory: > | > | 1. The protein was loaded in FPLC column at 4 degree C and the collection > | was clear. In this case, i did not use Tris Buffer, 2. When the protein > | was warmed up in room temperature, ppt appeared. > | 3.In the buffer, only beta-mercaptoethanol problem was added, in addition > | to PBS buffer. > | > | In my case, I removed beta-mercaptoethanol just before assay and > | crystallization, it worked and no ppt. > | > | I could not remember the detail. > | > | I hope this would be helpful. > | > | Kevin > | > | > | > | > | On Mon, Mar 12, 2012 at 3:42 PM, Min-Kyu Cho > wrote: > | > Hi Kevin, > | > > | > Could you tell me more detail about beta-mercaptoethanol problem? > | > > | > Min-Kyu > | > > | > | -Original Message- > | > | From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf > | > Of > | > | Kevin Jin > | > | Sent: Monday, March 12, 2012 3:32 PM > | > | To: CCP4BB@JISCMAIL.AC.UK > | > | Subject: Re: [ccp4bb] My protein precipitates at r.t and dissolves > | > at 4 > | > | oC > | > | > | > | I remember I saw the similar problem caused by beta-mercaptoethanol. > | > | > | > | > | > | Kevin > | > | > | > | > | > | On Mon, Mar 12, 2012 at 1:29 PM, Artem Evdokimov > | > | wrote: > | > | > Could be one of those weird behaviors displayed by detergents > | > where > | > | > cloud point anomalously changes with temperature... > | > | > > | > | > Artem > | > | > > | > | > On Mar 12, 2012 1:11 PM, "Min-Kyu Cho" > | wrote: > | > | >> > | > | >> I am using KPi buffer at pH 5.5, 100mM KCl, 2mM > | > beta-mercaptoethanol, > | > | >> 0.02% NaN3. > | > | >> > | > | >> Yes, I agree I should check CD melting curve to see temperature > | > | >> preference of my protein. > | > | >> > | > | >> Min-Kyu > | > | >> > | > | >> | -Original Message- > | > | >> | From: Kevin Jin [mailto:kevin...@gmail.com] > | > | >> | Sent: Monday, March 12, 2012 11:16 AM > | > | >> | To: Min-Kyu Cho > | > | >> | Cc: CCP4BB@jiscmail.ac.uk > | > | >> | Subject: Re: [ccp4bb] My protein precipitates at r.t and > | > dissolves > | > | >> at 4 > | > | >> | oC > | > | >> | > | > | >> | Which kind of buffer you use? If it is Tris, then temperature > | > | >> change will > | > | >> | cause pH change. > | > | >> | > | > | >> | Actually, this is a good way for crystallization. > | > | >> | > | > | >> | Kevin > | > | >> | > | > | >> | On Mon, Mar 12, 2012 at 9:02 AM, Min-Kyu Cho > | > | >> > | > | >> wrote: > | > | >> | > Hi all, > | > | >> | > > | > | >> | > I have a homotetrameric coiled-coil domain sample with 45aa > | > per > | > | each. > | > | >> | > While I store this sample at 4oC, the sample looks clear > | > w/o any > | > | >> | > particles. But when I took out the sample to my bench at > | > r.t, I > | > | >> can > | > | >> | > see there are precipitates (as stack of needle like > | > particles) > | > | >> at the > | > | >> | > bottom of the tube after several hours. Interestingly, when > | > I > | > | >> put it > | > | >> | > back into 4oC fridge, the precipitates disappeared and the > | > | >> solution > | > | >> | turned into clear again. > | > | >> | > > | > | >> | > Does anyone have knowledg
Re: [ccp4bb] My protein precipitates at r.t and dissolves at 4 oC
Min, I forgot one more thing. If you try to grow crystall of membrane protein and get tiny crystal, you may try to add 5~10% IPA + 5mM NH4SO4 to addjuct the surface charge of your protein. The crystall may get larger. Folks like this trick. Good luck. Kevin On Tue, Mar 13, 2012 at 10:38 AM, Kevin Jin wrote: > Hi Min, > > Please try this way if you use your protein for crystallization. > > 1. collect the needle and run SDS page or FPLC to verify the presence > of protein. Make sure it is not a buffer salt. > > 2. You don't need to do dialysis to remove b-ME, otherwise it will > take too long and you may lose some protein. > > Here is what I did before: > 1. Kee you stock protein solution with 2mM b-ME on ice-bath. > > 2. Use those eppendoff like tubue (~ 500ul) with membrane, which we > use to concentrate protein with reasonable MW cut-off (I usually used > 8KD). > > 3. Add protein solution with b-ME (2mM) in the tube, spin down (10K, > eppendoff centrifuge) for 2mins, > > 4. Use your pipette to measure how much solution has been filted into > the bottom tube. > > 5. add equal amount fresh buffer solution without b-ME to the top tube, > > Repeat 3~5 times, and make the fine concentration of b-ME to <0.5mM. > > Then use the protein immediately for crystallization. > > Actually, I used the same way for buffer exchange, instead of > dialysis. Based on this way, I crystallized thiopurine > methyltransferase with 2.0 Ang after folks' 5 years effort. > > The images is available here: > http://www.jinkai.org/Crystal_imgs.html > > Best, > > Kevin > > > > > > > On Tue, Mar 13, 2012 at 8:36 AM, Min-Kyu Cho wrote: >> Thank you Kevin, >> >> I will try to remove b-ME as you suggested. >> >> Min-Kyu >> >> | -Original Message- >> | From: Kevin Jin [mailto:kevin...@gmail.com] >> | Sent: Monday, March 12, 2012 5:50 PM >> | To: Min-Kyu Cho >> | Subject: Re: [ccp4bb] My protein precipitates at r.t and dissolves at 4 >> | oC >> | >> | Hi Min, >> | >> | I need to look back my note. Here is from my old memory: >> | >> | 1. The protein was loaded in FPLC column at 4 degree C and the collection >> | was clear. In this case, i did not use Tris Buffer, 2. When the protein >> | was warmed up in room temperature, ppt appeared. >> | 3.In the buffer, only beta-mercaptoethanol problem was added, in addition >> | to PBS buffer. >> | >> | In my case, I removed beta-mercaptoethanol just before assay and >> | crystallization, it worked and no ppt. >> | >> | I could not remember the detail. >> | >> | I hope this would be helpful. >> | >> | Kevin >> | >> | >> | >> | >> | On Mon, Mar 12, 2012 at 3:42 PM, Min-Kyu Cho >> wrote: >> | > Hi Kevin, >> | > >> | > Could you tell me more detail about beta-mercaptoethanol problem? >> | > >> | > Min-Kyu >> | > >> | > | -Original Message- >> | > | From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf >> | > Of >> | > | Kevin Jin >> | > | Sent: Monday, March 12, 2012 3:32 PM >> | > | To: CCP4BB@JISCMAIL.AC.UK >> | > | Subject: Re: [ccp4bb] My protein precipitates at r.t and dissolves >> | > at 4 >> | > | oC >> | > | >> | > | I remember I saw the similar problem caused by beta-mercaptoethanol. >> | > | >> | > | >> | > | Kevin >> | > | >> | > | >> | > | On Mon, Mar 12, 2012 at 1:29 PM, Artem Evdokimov >> | > | wrote: >> | > | > Could be one of those weird behaviors displayed by detergents >> | > where >> | > | > cloud point anomalously changes with temperature... >> | > | > >> | > | > Artem >> | > | > >> | > | > On Mar 12, 2012 1:11 PM, "Min-Kyu Cho" >> | wrote: >> | > | >> >> | > | >> I am using KPi buffer at pH 5.5, 100mM KCl, 2mM >> | > beta-mercaptoethanol, >> | > | >> 0.02% NaN3. >> | > | >> >> | > | >> Yes, I agree I should check CD melting curve to see temperature >> | > | >> preference of my protein. >> | > | >> >> | > | >> Min-Kyu >> | > | >> >> | > | >> | -Original Message- >> | > | >> | From: Kevin Jin [mailto:kevin...@gmail.com] >> | > | >> | Sent: Monday, March 12, 2012 11:16 AM >> | > | >> | To: Min-Kyu Cho >> | > | >> | Cc: CCP4BB@jiscmail.ac.uk >> | > | >> | Subject: Re: [ccp4bb] My protein precipitates at r.t and >> | > dissolves >> | > | >> at 4 >> | > | >> | oC >> | > | >> | >> | > | >> | Which kind of buffer you use? If it is Tris, then temperature >> | > | >> change will >> | > | >> | cause pH change. >> | > | >> | >> | > | >> | Actually, this is a good way for crystallization. >> | > | >> | >> | > | >> | Kevin >> | > | >> | >> | > | >> | On Mon, Mar 12, 2012 at 9:02 AM, Min-Kyu Cho >> | > | >> >> | > | >> wrote: >> | > | >> | > Hi all, >> | > | >> | > >> | > | >> | > I have a homotetrameric coiled-coil domain sample with 45aa >> | > per >> | > | each. >> | > | >> | > While I store this sample at 4oC, the sample looks clear >> | > w/o any >> | > | >> | > par
[ccp4bb] endotoxin removal: Triton X-114 dissociates protein oligomers?
Dear ALL; Thanks a lot for all the instructive suggestions. As my first trial, I tried 0.1%Triton X-114 plus Ni-column binding buffer. However, the oligomer of my protein got dissociated in to monomers as indicated by gel-filtration. Does anyone know how to rescue the oligomer? Simply lower the concentration of Triton X-114 to 0.02-0.05%? Thanks again, Jerry
[ccp4bb] mammalian expression vector
Dear ALL; As an alternative strategy to avoid endotoxin, I plan to express the protein in mammalian cells. As suggested by others, the typical vector is pcDNA3.1(+). Does anyone have comments on this vector or recommend some other powerful vectors? I am new to mammalian expression. I designed a Kozak sequence followed by a BSA signal peptide in order to clone the target into pcDNA3.1(+). Is it right? Tentative Kozak sequence: GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCCT Thanks a lot, Jerry
