Hello, Gregory,
for your first data set see
?read.table
and for you second
?read.fwf
may help solving your problem.
Hth -- Gerrit
On Thu, 3 Mar 2011, Gregory Ryslik wrote:
Hi,
I seem to be having somewhat of an unusual data input problem with some
of the data sets I'm working with and want to run a simulation on.
in the first data set I'm looking at, I have a text file where the
spacing between columns varies. I've attached a snippet. Is there a way
to read this into R? Basically, I want to ignore all the spaces to make
new columns. In a slightly different case, I have a long sequence of
nucleotides (the letters are always either g,a,t,c). Is there a way to
get each letter into it's own column so that I can then use it as a data
set?
I'm kind of loathe to program a java/C program to do this if I don't
have to and was wondering if a way in R exists for this.
Thanks!
Greg
Case1:
ACE2_YEAST 0.42 0.37 0.59 0.20 0.50 0.00 0.52 0.29 NUC
ACH1_YEAST 0.40 0.42 0.57 0.35 0.50 0.00 0.53 0.25 CYT
ACON_YEAST 0.60 0.40 0.52 0.46 0.50 0.00 0.53 0.22 MIT
ACR1_YEAST 0.66 0.55 0.45 0.19 0.50 0.00 0.46 0.22 MIT
ACT_YEAST 0.46 0.44 0.52 0.11 0.50 0.00 0.50 0.22 CYT
ACT2_YEAST 0.47 0.39 0.50 0.11 0.50 0.00 0.49 0.40 CYT
ACT3_YEAST 0.58 0.47 0.54 0.11 0.50 0.00 0.51 0.26 NUC
ACT5_YEAST 0.50 0.34 0.55 0.21 0.50 0.00 0.49 0.22 NUC
Case2:
gtacagtacgtacgtacgatcgatctagcatgcatgcatgcatgcta
______________________________________________
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
______________________________________________
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
