Hi,
I seem to be having somewhat of an unusual data input problem with some of the data sets I'm working with and want to run a simulation on. in the first data set I'm looking at, I have a text file where the spacing between columns varies. I've attached a snippet. Is there a way to read this into R? Basically, I want to ignore all the spaces to make new columns. In a slightly different case, I have a long sequence of nucleotides (the letters are always either g,a,t,c). Is there a way to get each letter into it's own column so that I can then use it as a data set? I'm kind of loathe to program a java/C program to do this if I don't have to and was wondering if a way in R exists for this. Thanks! Greg Case1: ACE2_YEAST 0.42 0.37 0.59 0.20 0.50 0.00 0.52 0.29 NUC ACH1_YEAST 0.40 0.42 0.57 0.35 0.50 0.00 0.53 0.25 CYT ACON_YEAST 0.60 0.40 0.52 0.46 0.50 0.00 0.53 0.22 MIT ACR1_YEAST 0.66 0.55 0.45 0.19 0.50 0.00 0.46 0.22 MIT ACT_YEAST 0.46 0.44 0.52 0.11 0.50 0.00 0.50 0.22 CYT ACT2_YEAST 0.47 0.39 0.50 0.11 0.50 0.00 0.49 0.40 CYT ACT3_YEAST 0.58 0.47 0.54 0.11 0.50 0.00 0.51 0.26 NUC ACT5_YEAST 0.50 0.34 0.55 0.21 0.50 0.00 0.49 0.22 NUC Case2: gtacagtacgtacgtacgatcgatctagcatgcatgcatgcatgcta ______________________________________________ [email protected] mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.

