Hi,

I seem to be having somewhat of an unusual data input problem with some of the 
data sets I'm working with and want to run a simulation on.

in the first data set I'm looking at, I have a text file where the spacing 
between columns varies. I've attached a snippet. Is there a way to read this 
into R? Basically, I want to ignore all the spaces to make new columns. 
In a slightly different case, I have a long sequence of nucleotides (the 
letters are always either g,a,t,c). Is there a way to get each letter into it's 
own column so that I can then use it as a data set?

I'm kind of loathe to program a java/C program to do this if I don't have to 
and was wondering if a way in R exists for this.

Thanks!
Greg

Case1:
ACE2_YEAST  0.42  0.37  0.59  0.20  0.50  0.00  0.52  0.29  NUC
ACH1_YEAST  0.40  0.42  0.57  0.35  0.50  0.00  0.53  0.25  CYT
ACON_YEAST  0.60  0.40  0.52  0.46  0.50  0.00  0.53  0.22  MIT
ACR1_YEAST  0.66  0.55  0.45  0.19  0.50  0.00  0.46  0.22  MIT
ACT_YEAST   0.46  0.44  0.52  0.11  0.50  0.00  0.50  0.22  CYT
ACT2_YEAST  0.47  0.39  0.50  0.11  0.50  0.00  0.49  0.40  CYT
ACT3_YEAST  0.58  0.47  0.54  0.11  0.50  0.00  0.51  0.26  NUC
ACT5_YEAST  0.50  0.34  0.55  0.21  0.50  0.00  0.49  0.22  NUC

Case2:
gtacagtacgtacgtacgatcgatctagcatgcatgcatgcatgcta
______________________________________________
[email protected] mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.

Reply via email to