wrote:
> On Tue, Jan 21, 2020 at 03:51:01PM +, Skylar Thompson wrote:
> > -V strips out PATH and LD_LIBRARY_PATH for security reasons, since prolog
>
> I don't think this is the case. I've just experimented with one of our 8.1.9
> clusters and I can set arbitrary PAT
> qsub -V ${other_options_omitted} ./my_command
>
> doesn't set $PATH on the remote job. Is that expected behavior?
>
> Thanks -
> Adam Shiel
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mail
eed something
> different in the GE configuration to enable this?
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- University of Washington School of Medicine
_
g
> > https://gridengine.org/mailman/listinfo/users
> >
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Scien
obs.
>
> Best regards,
> Mikhail Serkov
>
> > On Aug 29, 2019, at 10:20 AM, Skylar Thompson wrote:
> >
> > Load average gets high if the job spawns more processes/threads than
> > allocated CPUs, but we haven't seen any problem with node instability. W
elf.
> >
> > Dan
> >
> >
> > On Mon, Aug 26, 2019 at 12:46 PM Dietmar Rieder
> > wrote:
> > Hi,
> >
> > thanks for your reply. This sounds promising.
> > We are using Son of Grid Engine though. Can you point me to the right
> >
should be possible in slurm (which we don't have,
> and to which we don't want to switch to currently).
>
> Thanks
> Dietmar
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Buildi
> Is there something like "cgroups" for gpus?
>
> Thanks,
>
> -Dj
>
>
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar
> > users mailing list
> > users@gridengine.org
> > https://urldefense.proofpoint.com/v2/url?u=https-3A__gridengine.org_mailman_listinfo_users&d=DwIGaQ&c=mkpgQs82XaCKIwNV8b32dmVOmERqJe4bBOtF0CetP9Y&r=EKk3zFVROsf8w5OyB2T6u55jzploih3y7CaWIlGOLAY&m=m_wX_jPeroRg
by eliminating the "jclass" column, which
> doesn't contain any information, but I can only find ways to add columns,
> not take them away. Is there a way to make this column go away?
>
> _______
> users mailing list
> user
rs mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- University of Washington School of Medicine
__
*tar.gz
> do
>qsub -l h_vmem=4G -cwd -j y -b y -N tar -R y -q all.q,gpu.q "tar -xzf $i"
> done
>
> Hope to hear from you soon.
>
> Regards
> Varun
> ___
> users mailing list
> users@gridengine.org
> http
uld (UTIME + STIME) >= WALLCLOCK? It isn't in my case and is mainly
> why I am confused. Or perhaps process wait time is not included?
It's going to depend on your operating system, but STIME tends to include
I/O wait. Note, though, that user and system time are measured in terms
a complete reference (just bits
> and pieces here and there).
>
> Can anyone point me to a complete reference so that I can better
> understand the output of qacct?
>
> Thank you,
>
> --
> Mun
>
> ___
> users mailing
___
> From: users-boun...@gridengine.org on behalf of Skylar Thompson
>
> Sent: Tuesday, February 26, 2019 7:14 PM
> To: users@gridengine.org
> Subject: Re: [gridengine users] Different GDI version between client and
> qmaster
>
> Do you have different versions of GE insta
gt;
> Thanks in advance
>
> Rad
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-
> Cheers,
>
> On Thu, Feb 21, 2019 at 3:20 AM Skylar Thompson
> wrote:
>
> > We actually don't have a shared $SGE_ROOT, so that in the event of
> > network/storage trouble the binaries and libraries are still accessible. We
> > do have $SGE_ROOT/$SGE_CELL o
euti
> >
> >
> > ___
> > users mailing list
> > users@gridengine.org
> > https://gridengine.org/mailman/listinfo/users
> >
>
> ___
> users mailing list
> users@gridengine.org
> h
On Tue, Jan 29, 2019 at 12:06:47PM -0500, John Young wrote:
> On 1/29/19 11:15 AM, Skylar Thompson wrote:
> > Hi John,
> >
> > Have you looked at using the ${SGE_ROOT}/util/logchecker.sh script? There's
> > documentation on setting it up in doc/logfile-trimming.
have looked around in the Gridengine docs
> for information on how to close it and start another file
> but if it is there, I missed it.
>
> Does anyone know how to do this?
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege B
55m/s APT: 0.0011s/m idle: 99.94% wait: 0.00% time: 76.48s
> > >
> > > Joseph
> > >
> > >
> > > ___
> > > users mailing list
> > > users@gridengine.org
> > > https://gridengine.org/mailman/li
too new.
> >
> > Dan
> >
> >
> > _______
> > users mailing list
> > users@gridengine.org
> > https://gridengine.org/mailman/listinfo/users
>
> ___
New York, NY 10003
>
> "In an open world, who needs windows or gates ?"
>
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.
AAGAAGGTAACATGTTTTAAGAAACTATGTAGCATAGTGTCTT
>
> What is it that I am doing wrong here.
>
> Thanks
>
> Regards
> Varun
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Sky
e server fixed this behavior.
>
> Thanks for sharing,
>
> Paul.
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Departme
n apply there.
>
> Stuart Barkley
> --
> I've never been lost; I was once bewildered for three days, but never lost!
> -- Daniel Boone
> ___
> users mailing list
> users@gri
p.
>
>
>
>
>
> -Noel Benitez, Salk iT Dept.
>
>
>
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
hen see that it was trying to do a memory map at the point where
> it died so I knew where to start playing.
>
> Thanks again for the help. I've learned some new techniques to try for next
> time!
>
> Simon.
>
>
> -Original Message-
> From: users-boun.
tem. The contents of this e-mail are the views of the
> sender and do not necessarily represent the views of the Babraham Institute.
> Full conditions at: www.babraham.ac.uk<http://www.babraham.ac.uk/terms>
> _______
> users mailing list
>
If you are trying to restrict users to only being able to access a node
> that they have a job running on, there is a PAM module for that.
>
> Ian
>
> On Thu, Mar 22, 2018 at 8:23 AM, Skylar Thompson
> wrote:
>
> > You'll need to make sure that your MPI implementa
sshd_config to do that, but now mpi is not working !
>
> What can I do to refuse ssh connexion on nodes to my user and to have mpirun
> working ???
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-
some web pages which stated that for some
> versions of gridengine and kernel this was a Bad Idea.
>
> Sincerely,
>
> Calvin Dodge
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listi
t;
> > ___
> > users mailing list
> > users@gridengine.org
> > https://gridengine.org/mailman/listinfo/users
>
>
> ___
> users mailing list
> users@gridengin
to do this?
>
>
> --Chet Langin, SIU
>
>
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Admi
"qw" to "r" even though nodes were
> available. He also had complained about a disk quota problem, so that may,
> or may not be related. (Although we have had other users run into disk
> quotas without this happening.)
>
>
> Can someone tell me how to
gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- University of Washington School of Medicine
_
nvironment: orte range: 8
> version:3
> scheduling info:cannot run in PE "orte" because it only
> offers 7 slots
>
>
> I've search on all of the configuration of SGE. I do too the
> reinstalation of the 2 nodes. But the same messag
situations where a combinations of
> > consumables and limits in RQS blocks the scheduling completely and showing
> > something like "... offers only (-l none)."
> >
> > In case you have to limit the usage per user you have to use them for sure.
> >
>
> OK
ntinue
> debugging? Thanks.
>
> -M
>
>
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
dd, make a filesystem on it, and mount it over a
loopback device at TMPDIR. A wrapper script executed through sudo would
probably be pretty secure to run as the user in prolog.
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Buil
>>
> >>
> > --
> > Alex Chekholko ch...@stanford.edu
> >
> > ___
> > users mailing list
> > users@gridengine.org
> > https://gridengine.org/mailman/listinfo/users
> >
> ___
gt; it really depends on the size of the dataset being worked on which often
> can't be predetermined.
>
> is there a way to do it? thanks!!!
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mai
,
> checking for files that indicate that a prerequisite job finished,
> checking for errors in the prereq, or loop over 'qstat' checking if a
> specific jobid has completed.
Yep, we recommend folks use -hold_jid whenever possible. Some of our labs
also use DRMAA but obviously that int
queue slots and not leaving room for analyze.month tasks which
> they will forever wait for), also besides dispatching they also do some
> logic so it's a strange animal, this "dispatching" queue..
>
> What's the "correct" practice here?
> ___
On Mon, Jan 25, 2016 at 10:17:16PM +0100, Reuti wrote:
>
> Am 25.01.2016 um 20:34 schrieb Skylar Thompson:
>
> > Yep, we use functional tickets to accomplish this exact goal. Every user
> > gets 1000 functional tickets via auto_user_fshare in sge_conf(5), though
> > yo
Thanks very much!
> Chris
>
>
>
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
ped to local disk? Will
> it restart (un-suspend) on that node when sufficient resources are free?
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- University of Wa
ven queue? Would this data be stored in the head
> node mySQL
> DB?
>
> Thanks again Reuti.
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- University of Washington School of Medicine
show this parameter at all, so can I assume it's
> false, which means qacct's maxvmem should actually reflect the actual max
> vmem usage? What might I be doing wrong or misunderstanding?
>
> Thanks.
>
> -M
> ___
> users ma
of nodes in a queue negatively affects the performance of the queue? Is there
> any general
> rule about how many nodes to have in a queue based on a given network
> backbone?
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege
to get around this? Would cgroups support help?
>
> Thanks,
> Brendan
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Science
elps. GE scheduling definitely can feel like black magic
sometimes.
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- University of Washington School of Medicine
>
> And my whole grid went down with the bootstrap message.
>
> I am asking for a restore from the other group, but I need to understand
> maybe what I did, and can I fix it. They can take days to do a restore
> and this is a production system arggg
>
> Thanks,
> Dan
other group is backing it up as
> requested).
>
> Dan
>
> On 06/02/2015 11:05 AM, Skylar Thompson wrote:
> > Did your SGE_ROOT and/or SGE_CELL environment variable settings change? All
> > the GE binaries expect to find the bootstrap file at
> > ${SGE_ROOT}/${SGE_CE
strap file does not exist.
>
> What did I do and how do I recover?
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- University of Washington School of Medicine
__
uting The Wharton School University
> > of Pennsylvania
> > The information contained in this electronic message and any attachments to
> > this message are intended for the exclusive use of the addressee(s) and may
> > contain proprietary, confidential or privileged information. If you are not
>
of viruses. The company accepts no liability for any damage caused
> by any virus transmitted by this email. www.wipro.com
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-
number of complete nodes?"
>
> We are not sure how to achieve this. Could you please give a any hint?
>
> TI & Kind Regards,
> Christian
>
> --
> No signature available.
> _______
> users mailing list
> users@gr
t only so many of these
> >> per user
> >>
> >> Any and all suggestions are welcome.
> >>
> >> Thank you!
> >>
> >> Best,
> >> --
> >> Stephen Spencer
> >> spen...@cs.washington.edu <mailto:spen...@cs.washi
any of it need to?
> Maybe just the var part would need to: /cm/shared/apps/sge/var ?
>
> Thanks,
> Eric
>
>
>
> _______
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Sk
ge and hypervisor kit.
>
> Allow me to say a very public "Thanks!" for maintaining such a great
> resource.
I'd like to second that. I've been scraping by with Google cache and the
Wayback Machine. It sounds like this is a volunteer operation too, which
makes me doub
ble.
>
> 40GB VIRT vs 100MB RES is a huge difference! I thought I had it bad with
> matlab using 4GB VIRT for 100MB RES.
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
-- Un
h_vmem value because Matlab
> won't launch.
>
> Thanks for any thoughts.
>
> -M
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- G
ow many tickets should be in the
> functional ticket pool? I've seen figures ranging from 100 to
> 1,000,000.
>
> Any advice and/or replies would be appreciated.
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Departm
; Robi
> ___
> users mailing list
> users@gridengine.org
> https://gridengine.org/mailman/listinfo/users
--
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrator
-- Foege Building S046, (206)-685-7354
--
mit jobs with slot ranges in the PE
> request? I'm also a big fan of schedd_job_info, but I'm a bigger fan
> of my scheduler not blowing up.
>
> --
> Joshua Baker-LePain
> QB3 Shared Cluster Sysadmin
> UCSF
> ___
>
any attachments for the presence of viruses. The organization
> accepts no liability for any damage caused by any virus transmitted by this
> email.
> =
>
>
> ___
> users mailing list
> users
t; of a gotcha).
>
> I've figured out in the meantime that it can be achieved by
> submitting an AR for a one-slot-per-node PE, and then submitting the
> array into that. Not sure which option I favour, still.
>
> Tina
>
> On 02/04/14 16:04, Skylar Thompson wrote:
>
the time, but only want one of mine
> (network IO intensive tasks, best use of file system would be lots
> of them but spread as far and wide as the can).
>
> I've thought about introducing a consumable - apart from there's no
> node-level consumables at the moment - but am un
On Tue, Jan 07, 2014 at 03:19:23PM -0800, Joshua Baker-LePain wrote:
> On Tue, 7 Jan 2014 at 3:09pm, Skylar Thompson wrote
>
> > Quick question - are you limiting memory usage for the job (i.e. h_vmem)?
>
> No. We have mem_free set to consumable (and the jobs include
erally ends up running anyway.
>
> Any ideas as to how to track this down? I'm a bit stumped...
>
> Thanks.
>
> --
> Joshua Baker-LePain
> QB3 Shared Cluster Sysadmin
> UCSF
> ___
> users mailing list
> users@gridengine.or
Oracle Java is particularly heinous when it comes to virtual memory
allocation. The Oracle Java that ships with RHEL6 x86_64 requests around
23GB of memory even when it's run with just "-version". IBM Java is a
bit more reasonable, only requesting around 3GB to report its versi
We tried doing that, and it fixed most of our issues, but not the SGE
ones. We're seeing very high CPU load on the sge_shepherd and sge_execd
processes. We were seeing high load on our sge_qmaster process until we
restarted.
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sci
s knowledgebase article for more info:
https://access.redhat.com/knowledge/articles/15145
We're not totally certain this is the issue, but it's highly correlated
in time with the leap second.
-- Skylar Thompson (skyl...@u.washington.edu)
-- Genome Sciences Department, System Administrat
We haven't done this (our cooling fails plenty often but is somewhat
independent of the outside temperature at this point), but I wonder if
you could use an advance reservation to accomplish this? Otherwise you
would have hardware that's idling before the forecast comes to pass.
75 matches
Mail list logo
