Re: remove last 76 letters from string

On Aug 6, 11:34 am, MRAB wrote: > Iain King wrote: > >>      print >>nucleotides, seq[-76] > > >>      last_part = line.rstrip()[-76 : ] > > > You all mean:   seq[:-76]   , right? (assuming you've already stripped > > any junk off the end of the string) > > The OP said "cut out the last 76 letters

Re: remove last 76 letters from string

Iain King wrote: print >>nucleotides, seq[-76] last_part = line.rstrip()[-76 : ] You all mean: seq[:-76] , right? (assuming you've already stripped any junk off the end of the string) The OP said "cut out the last 76 letters (nucleotides) from each individual sequence and sen

Re: remove last 76 letters from string

On Thu, Aug 6, 2009 at 6:28 PM, Iain King wrote: > > print >>nucleotides, seq[-76] > > > last_part = line.rstrip()[-76 : ] > > You all mean: seq[:-76] , right? (assuming you've already stripped > any junk off the end of the string) > I think so, probably both of them typo'd. (What

Re: remove last 76 letters from string

> print >>nucleotides, seq[-76] >      last_part = line.rstrip()[-76 : ] You all mean: seq[:-76] , right? (assuming you've already stripped any junk off the end of the string) Iain -- http://mail.python.org/mailman/listinfo/python-list

Re: remove last 76 letters from string

PeroMHC wrote: Hi All, So here is the problem... I have a FASTA file (used for DNA analyses) that looks like this: ... gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152 NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC CGATATAGTGAAACTTCATTTCTACANTACCAAACG

Re: remove last 76 letters from string [sorry, errata]

Dnia 06-08-2009 o 01:54:46 PeroMHC wrote: This snippet represents 3 individual DNA sequences. Each sequences is identified by the line starting with > The complete file has about 10 million individual sequences. A simple enough problem, I want to read in this data, and cut out the last 76 lett

Re: remove last 76 letters from string

Dnia 06-08-2009 o 01:54:46 PeroMHC wrote: This snippet represents 3 individual DNA sequences. Each sequences is identified by the line starting with > The complete file has about 10 million individual sequences. A simple enough problem, I want to read in this data, and cut out the last 76 lett

remove last 76 letters from string

Hi All, So here is the problem... I have a FASTA file (used for DNA analyses) that looks like this: ... >gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152 NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC CGATATAGTGAAACTTCATTTCTACANTACCAAACGTCGCTCGGCAGAGCGTCG