On Tue, 02 Feb 2010 15:07:05 -0800, Aahz wrote:
>>If you have a problem and you think that regular expressions are the
>>solution then now you have two problems. Regex is really overkill for
>>the OP's problem and it certainly doesn't improve readability.
>
> If you're going to use a quote, it w
In article ,
D'Arcy J.M. Cain wrote:
>
>If you have a problem and you think that regular expressions are the
>solution then now you have two problems. Regex is really overkill for
>the OP's problem and it certainly doesn't improve readability.
If you're going to use a quote, it works better if y
Johann Spies wrote:
> On Thu, Jan 28, 2010 at 07:07:04AM -0800, evilweasel wrote:
> > Hi folks,
> >
> > I am a newbie to python, and I would be grateful if someone could
> > point out the mistake in my program. Basically, I have a huge text
> > file similar to the format below:
> >
> > AGACTC
On Fri, 29 Jan 2010 11:23:54 +0200
Johann Spies wrote:
> I know this is a python list but if you really want to get the job
> done quickly this is one method without writing python code:
> [...]
> $ grep -v 0 /tmp/y > tmp/z
There's plenty of ways to do it without writing Python. C, C++, Perl,
Fo
On Fri, Jan 29, 2010 at 10:04:33AM +, Steven D'Aprano wrote:
> > I know this is a python list but if you really want to get the job done
> > quickly this is one method without writing python code:
> >
> > $ cat /tmp/y
> > AGACTCGAGTGCGCGGA 0
> > AGATAAGCTAATTAAGCTACTGG 0
> >
On Fri, 29 Jan 2010 11:23:54 +0200, Johann Spies wrote:
> On Thu, Jan 28, 2010 at 07:07:04AM -0800, evilweasel wrote:
>> Hi folks,
>>
>> I am a newbie to python, and I would be grateful if someone could point
>> out the mistake in my program. Basically, I have a huge text file
>> similar to the f
On Thu, Jan 28, 2010 at 07:07:04AM -0800, evilweasel wrote:
> Hi folks,
>
> I am a newbie to python, and I would be grateful if someone could
> point out the mistake in my program. Basically, I have a huge text
> file similar to the format below:
>
> AGACTCGAGTGCGCGGA 0
> AGATAAGCTAATTAAG
nn writes:
> After posting I was thinking I should have posted a more
> straightforward version like the one you wrote. Now there is! It
> probably is more efficient too. I just have a tendency to think in
> terms of pipes: "pipe this junk in here, then in here, get output".
> Probably damage from
Arnaud Delobelle wrote:
> nn writes:
>
> > On Jan 28, 10:50 am, evilweasel wrote:
> >> I will make my question a little more clearer. I have close to 60,000
> >> lines of the data similar to the one I posted. There are various
> >> numbers next to the sequence (this is basically the number of t
Steven Howe wrote:
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
th
On Jan 28, 12:28 pm, Steven Howe wrote:
> On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
>
>
>
>
>
> > evilweasel wrote:
> >> I will make my question a little more clearer. I have close to 60,000
> >> lines of the data similar to the one I posted. There are various
> >> numbers next to the s
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been
D'Arcy J.M. Cain wrote:
On Thu, 28 Jan 2010 18:49:02 +0100
Jean-Michel Pichavant wrote:
Using regexp may increase readability (if you are familiar with it).
If you have a problem and you think that regular expressions are the
solution then now you have two problems. Regex is really o
On Thu, 28 Jan 2010 18:49:02 +0100
Jean-Michel Pichavant wrote:
> Using regexp may increase readability (if you are familiar with it).
If you have a problem and you think that regular expressions are the
solution then now you have two problems. Regex is really overkill for
the OP's problem and
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to ign
On 1/28/2010 10:50 AM, evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample).
nn writes:
> On Jan 28, 10:50 am, evilweasel wrote:
>> I will make my question a little more clearer. I have close to 60,000
>> lines of the data similar to the one I posted. There are various
>> numbers next to the sequence (this is basically the number of times
>> the sequence has been found i
On Jan 28, 10:50 am, evilweasel wrote:
> I will make my question a little more clearer. I have close to 60,000
> lines of the data similar to the one I posted. There are various
> numbers next to the sequence (this is basically the number of times
> the sequence has been found in a particular samp
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to ignore the ones contain
On Thu, Jan 28, 2010 at 4:31 PM, Krister Svanlund
wrote:
> On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
> wrote:
>> On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
>> wrote:
>>> Hi folks,
>>>
>>> I am a newbie to python, and I would be grateful if someone could
>>> point out the mistake in my p
On Thu, 28 Jan 2010 07:07:04 -0800 (PST)
evilweasel wrote:
> I am a newbie to python, and I would be grateful if someone could
Welcome.
> point out the mistake in my program. Basically, I have a huge text
> file similar to the format below:
You don't say how it isn't working. As a first step y
On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
wrote:
> On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
> wrote:
>> Hi folks,
>>
>> I am a newbie to python, and I would be grateful if someone could
>> point out the mistake in my program. Basically, I have a huge text
>> file similar to the format
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
wrote:
> Hi folks,
>
> I am a newbie to python, and I would be grateful if someone could
> point out the mistake in my program. Basically, I have a huge text
> file similar to the format below:
>
> AGACTCGAGTGCGCGGA 0
> AGATAAGCTAATTAAGCTACTGG
On Jan 28, 3:07 pm, evilweasel wrote:
> Hi folks,
>
> I am a newbie to python, and I would be grateful if someone could
> point out the mistake in my program.
> for j in range(0, b):
> if lister[j] == 0:
At a guess, this line should be:
if lister[j] == '0':
...
--
Mark
--
ht
* evilweasel:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
AGATAAGCTAATTAAGCTACTGG 0
AGATAAGCTAATTAAGCTACTGGGTT 1
A
25 matches
Mail list logo
