Steven Howe wrote:
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to ignore the ones containing '0' and write all other sequences
(excluding the number, since it is trivial) in a new text file, in the
following format:
seq59902
TTTTTTTATAAAATATATAGT
seq59903
TTTTTTTATTTCTTGGCGTTGT
seq59904
TTTTTTTGGTTGCCCTGCGTGG
seq59905
TTTTTTTGTTTATTTTTGGG
The number next to 'seq' is the line number of the sequence. When I
run the above program, what I expect is an output file that is similar
to the above output but with the ones containing '0' ignored. But, I
am getting all the sequences printed in the file.
Kindly excuse the 'newbieness' of the program. :) I am hoping to
improve in the next few months. Thanks to all those who replied. I
really appreciate it. :)
Using regexp may increase readability (if you are familiar with it).
What about
import re
output = open("sequences1.txt", 'w')
for index, line in enumerate(open(sys.argv[1], 'r')):
match = re.match('(?P<sequence>[GATC]+)\s+1')
if match:
output.write('seq%s\n%s\n' % (index, match.group('sequence')))
Jean-Michel
Finally!
After ready 8 or 9 messages about find a line ending with '1', someone
suggests Regex.
It was my first thought.
I'm a great fan of regexes, but I never though of using them for this
because it doesn't look like a regex type of problem to me.
--
http://mail.python.org/mailman/listinfo/python-list