Re: "temp" vs "my"

What you want is OUTER ... my $v = "original"; > { > my $v = OUTER::<$v>; > say $v; > $v = "new one"; > say $v; > } > say $v; It's how you access the outer scope from an inner scope. -Scott On Wed, Oct 3, 2018 at 1:10 AM yary wrote: > Reading and playing with https://docs.p

Re: using run

If you don't specify the :out adverb, then the output of the program you are running will be sent to standard output. Immediately when the program executes. If you specify the :out adverb, output from the program will be available for capture via the $proc.out method. A similar thing applies for

Re: need s/ help

On Tue, May 1, 2018 at 8:37 AM, ToddAndMargo wrote: > Hi All, > > I am trying to change the last three letters of a string > > $ perl6 -e 'my $x="abcabcabc"; $x ~~ s/"a.*"$/xyz/; say $x;' > The double quotes around your text make it a string literal, so it will only match the literal string "a.*

Re: Does words have a delimiter?

Looking at that page myself, it doesn't appear that you can specify the separator for .words. So ... no. Though, that would make an interesting addition IMHO -Scott On Sat, Apr 14, 2018 at 12:27 AM, ToddAndMargo wrote: > Hi All, > > I am over on > https://docs.perl6.org/routine/words > an

Re: [perl #130692] [BUG] IO::Socket::Async broken in 6.d.PREVIEW

Great, thanks for the update. On 15 Sep 2017 15:17, "jn...@jnthn.net via RT" wrote: > On Wed, 01 Feb 2017 13:11:21 -0800, j...@gellyfish.co.uk wrote: > > With 6.d.PREVIEW the simplest code for IO::Socket::Async mis-behaves: > > > > use v6.d.PREVIEW; > > > > react { > > whenever I

Re: [perl #131781] :?smth should construct a truthy pair (say (:?foo))

The OP said :?foo should work because :foo and :!foo work. I don't follow the logic. How are those things related? Why should :foo and :!foo imply :?foo? (In my head it makes as much sense as ":foo and :!foo implies :*foo", which is to say, none.) I don't see any benefit to adding a :?foo synt

Re: [perl #131781] :?smth should construct a truthy pair (say (:?foo))

The OP said :?foo should work because :foo and :!foo work. I don't follow the logic. How are those things related? Why should :foo and :!foo imply :?foo? (In my head it makes as much sense as ":foo and :!foo implies :*foo", which is to say, none.) I don't see any benefit to adding a :?foo synt

Re: [perl #125243] [SEGV] NativeCall segfault on rw struct pointer

No I think you're right. A naive ticket :) On Thu, 2016-10-06 at 13:45 -0700, Stefan Seifert via RT wrote: > I'm rejecting this ticket because the given example is simply wrong. > NativeCall translates a Str to char *, i.e. a pointer to a character > array. Thus it will reserve the memory to hold

Re: [perl #128469] [BUG] done() on first entry to whenever block does not exit react {}

Yep, Just confirmed here with all the original examples I gave, all good. Now to remember where it was I had hacked round this :-\ On Wed, 2016-09-07 at 10:40 -0700, Zoffix Znet via RT wrote: > This now appears to have been fixed by some of the recent async > fixes. > > Tests now pass and have b

Re: [perl #128469] [BUG] done() on first entry to whenever block does not exit react {}

Yep, Just confirmed here with all the original examples I gave, all good. Now to remember where it was I had hacked round this :-\ On Wed, 2016-09-07 at 10:40 -0700, Zoffix Znet via RT wrote: > This now appears to have been fixed by some of the recent async > fixes. > > Tests now pass and have b

Re: [perl #128628] problem using semaphore with many threads

On Fri, Jul 22, 2016 at 10:46 AM, mt1957 via RT < perl6-bugs-follo...@perl.org> wrote: > I'm afraid the test I've created still hangs in rakudo version > 2016.07.1-37-g60f256d built on MoarVM version 2016.07-3-gc01472d > implementing Perl 6.c. > > That's still a too old MoarVM version. You'd need

Re: [perl #127860] [BUG][PRECOMP] Wrapped method fails when precompiled

precompilation" On Sat, 2016-04-09 at 03:24 -0700, Lloyd Fournier via RT wrote: > For reference this is another related to: > > https://rt.perl.org/Public/Bug/Display.html?id=125634 > > On Sat, Apr 9, 2016 at 7:10 AM Jonathan Stowe rl.org> > wrote: > > > &

Re: learning perl6?

If, by "regular book", you mean "bound paper sheafs with ink on them", then the answer is currently "no". Is there something wrong with the documentation online? (besides there not being enough of it :) -Scott On Mon, Jan 4, 2016 at 9:55 PM, Yonghua Peng wrote: > Hello, > > Is there a regular

Re: [perl #125408] [BUG] CArray[num64] numiness optimised away

Good thing I didn't take the related TODO tests in my modules out :) On Fri, 2015-10-23 at 11:56 -0700, Will Coleda via RT wrote: > On Thu Sep 17 13:37:30 2015, FROGGS.de wrote: > > Fixed by jnthn++ with commit: > > > > https://github.com/MoarVM/MoarVM/commit/60a48e85b4928a9d66f2f8b87c5 > > fdb65

Re: grep changes?

The block does get the topic, but the regex isn't executing immediately. Another way to get what you want, rather than mentioning the topic explicitly, is to use the m// form of match. > grep { m/\.pl6/ }, (a.pl6) For sanity's sake, I would recommend writing your match-immediately regex like th

Re: Strict Rakudo version of this Perl5 one-liner

If you're not married to the "key : value" format, you could use this: scan +spam | perl6 -ne 'my %d; %d{.words[1]}++; END { .say for sort %d }' Here's another variation, but keeping your original format: scan +spam | perl6 -ne 'my %d; %d{.words[1]}++; END { say "$_.key() : $_.value()"

[perl #125408] [BUG] CArray[num64] numiness optimised away

This has come back again on Linux too with This is perl6 version 2015.07.1-88-gaf75bd7 built on MoarVM version 2015.07-8-gb8fdeae

[perl #125365] [BUG] Segfault on 0.^methods(:all).sort

gdb says: Program received signal SIGSEGV, Segmentation fault. 0x77952fb7 in push () from /home/jonathan/.rakudobrew/moar-nom/install/lib/libmoar.so and valgrind says: ==16279== Invalid write of size 8 ==16279==at 0x4FB4FB7: push (in /home/jonathan/.rakudobrew/moar-nom/install

Re: [perl #118865] Parameter '' requires an instance, LTA error

IMHO, the message is actually slightly worse. Now it's talking about an invocant when there are no classes or methods involved! -Scott On Wed, Mar 11, 2015 at 1:26 PM, Christian Bartolomaeus via RT < bugs-comm...@bugs6.perl.org> wrote: > The error message has changed slightly and now states th

Re: S02 mistake re Blob?

On Feb 21, 2015, at 2:45 AM, Moritz Lenz wrote: > Hi Darren, > > On 21.02.2015 08:51, Darren Duncan wrote: >> I notice from looking at http://design.perl6.org/S02.html that Blob is >> listed >> both as being a role and as a type. See >> http://design.perl6.org/S02.html#Roles >> for an e

Announce: Rakudo Compiler Release #81 ("Linz")

ell as those people who worked on Parrot, the Perl 6 test suite, MoarVM and the specification. The following people contributed to this release: Elizabeth Mattijsen, Jonathan Worthington, Tobias Leich, Moritz Lenz, Jonathan Scott Duff, Christian Bartolomäus, Brad Gilbert, Solomon Foster, Lar

Re: state and = vs :=

On 10/2/2014 16:03, Elizabeth Mattijsen wrote: On 01 Oct 2014, at 07:48, Father Chrysostomos wrote: Does ‘state’ govern ‘:=’ the way it governs ‘=’? In other words, just as this: state $x = 1; only assigns to $x once (per closure), does the same apply to this? state $x := $y; I can

Rakudo Star Release 2014.04 - A useful, usable, "early adopter" distribution of Perl 6

perl6-langu...@perl.org perl6-compi...@perl.org parrot-us...@lists.parrot.org Cc: Bcc: Message-Id: <1399313885.8...@jnthn.net> X-Originating-IP: 62.220.188.70 X-Mailer: Webmin 1.550 Date: Mon, 05 May 2014 20:18:05 +0200 (CEST) MIME-Version: 1.0 Content-Type: multipart/mixed; boundary="bound139931

Re: static inline probing for MoarVM

either. I thought we might have one, then realized I'd set my TEST_JOBS to 8 instead of the usual 6, and that was to thank. Anyway, things perform no worse, and I agree it's cleaner and safer. Thanks! Jonathan

Re: MoarMV attempts to lock an already locked mutex

On 1/9/2014 22:40, Nicholas Clark wrote: On Thu, Jan 09, 2014 at 10:32:37PM +0100, Jonathan Worthington wrote: Hi, On 1/9/2014 22:00, Nicholas Clark wrote: I've been running with the appended for a few weeks now, and I think that it's the right fix. Unfortunately, releasing the mut

Re: MoarMV attempts to lock an already locked mutex

that should avoid the deadlock *and* not introduce a race. Trying the committed fix out under hg would be most welcome, if you've a moment to do so. Many thanks, Jonathan

Re: compiling Rakudo's Test.pm - i64 being written to a register marked as obj

GET_REG(cur_op, 0).i64 = ++tc->sc_wb_disable_depth; > cur_op += 2; > goto NEXT; > > > I don't know how to debug this further. > Great find! Fixed in 80a60fc09. Thanks, Jonathan

Re: Missing write barriers for MVM_string_find_encoding()

e, should that MVM_string_find_encoding(tc, enc_name) be yanked to a line > above and assigned to a local variable, so that any GC run has happened > before the arguments to MVM_string_decode() start to be put onto the CPU > stack for the C function call? > Yes; also fixed. Thanks! Jonathan

Re: Missing write barrier in MVM_sc_get_sc()

didn't get put in at the needed point. That's just speculation without going and looking through history, mind. Thanks, Jonathan

Re: Missing root in MVM_hll_set_config()

source code (MVM_NO_GC_ALLOC or so on the function declaration) rather than as separate documentation. Thanks, Jonathan

Re: Unexpected expansion of string with xx

On Dec 21, 2013, at 12:00 AM, Moritz Lenz wrote: > On 12/20/2013 04:52 AM, Richard Hainsworth wrote: >> OK x not xx. >> >> The doubling of operators is confusing. > > OTOH having a single operator which two different meanings is also confusing > (and very un-perlish). Sometimes, yeah. On a r

Re: detecting missing roots and other GC mistakes

a); } Again, I don't know what the fix should be, but having read the GC talk slides, my hunch is that it's "you can't be storing unpinned things in a C struct". Well, you can, just make sure you update it. 9f7714d should fix this one. Thanks! Jonathan

Re: Unexpected expansion of string with xx

On 12/19/2013 3:47, Richard Hainsworth wrote: Initially I though the following was a bug, but now I'm not sure. I got these results perl6 -v This is perl6 version 2013.09 built on parrot 5.5.0 revision 0 $ perl6 > say '0' xx 4 0 0 0 0 Are you sure you didn't want the x (string repetition) opera

Re: detecting missing roots and other GC mistakes

g moved. I presume that base_obj could get moved too. I don't know for sure what the right fix is. Hopefully, 191c383 is the right fix. Confirmation welcome. :-) Thanks, Jonathan

Re: [perl6/specs] 9c428a: /.sleep/.alarm/

On Nov 4, 2013, at 12:19 AM, GitHub wrote: > Branch: refs/heads/master > Home: https://github.com/perl6/specs > Commit: 9c428a98d060811fa086d3168321cfe437be695a > > https://github.com/perl6/specs/commit/9c428a98d060811fa086d3168321cfe437be695a > Author: Elizabeth Mattijsen > Dat

Re: Commensurability as Key

On Aug 23, 2013, at 2:41 AM, Steve Pitchford wrote: > How would you implement, in a robust way, the following things: > > 1 kg + 1 kg = 2 kg > 2 m * 3 m = 6 m^2 > 5 kg * (3 m/s)^2 = 45 J > > The answer is that you wouldn't - the problem domain is so vague as to be > meaningless. 1kg or 1m of w

Re: Building MoarVM on Solaris

using to get NQP bootstrapped atop of MoarVM. Once that is achieved (hopefully within the next month or two) it will go away; building NQP on MoarVM will simply need a build of MoarVM. Thanks, Jonathan

Re: Future Directions for Parrot and Rakudo

Howdy, The code must flow. I will not force decisions on anybody, but I intend to continue on my path. If it is not for you, I implore you to find your own. Duke On Sun, Jun 23, 2013 at 8:43 AM, Allison Randal wrote: > On 06/21/2013 10:07 AM, Jonathan "Duke" Leto wrote

Future Directions for Parrot and Rakudo

that is not deemed necessary by Parrot core developers will be removed. Duke [0] https://github.com/MoarVM/MoarVM -- Jonathan "Duke" Leto Leto Labs LLC http://letolabs.com 209.691.DUKE http://duke.leto.net @dukeleto

Fwd: [Passed] letolabs/parrot-libgit2#21 (nciupdate - 4d61364)

t: Re: [Passed] letolabs/parrot-libgit2#21 (nciupdate - 4d61364) To: Jonathan Duke Leto On Sat, Jun 1, 2013 at 8:12 PM, Jonathan "Duke" Leto wrote: > Howdy, > > Can you show me where (a link to Github is most useful) where you > think the NQP exit code bug is? > > Tha

Parrot Foundation has accepted 3 Google Summer of Code student proposals

urias/9002 [1] http://www.google-melange.com/gsoc/proposal/review/google/gsoc2013/saurabh_kgp/11002 [2] http://www.google-melange.com/gsoc/proposal/review/google/gsoc2013/chob_rock/9001 [3] http://www.google-melange.com/gsoc/homepage/google/gsoc2013 -- Jonathan "Duke" Leto

Parrot 5.0.0 "Johnny Five Alive" Released!

our sponsors for supporting this project. We would especially like to thank Google for donating $5000 to Parrot Foundation for participating in Google Code-In. Our next scheduled release is 19 Feb 2013. Enjoy! -- Jonathan "Duke" Leto Leto Labs LLC http://labs.leto.net 209.691.DUKE http://dukeleto.pl

Re: [perl #116280] [BUG] NaN, Inf, -Inf aren't padded with spaces in sprintf in Rakudo

On 1/8/2013 22:38, Patrick R. Michaud wrote: I wonder what it would take to write a version of sprintf in Perl 6 or NQP directly, ignoring all speed aspects for the time being. Then we'd at least have something portable, provably correct, easily modified, and that could be used as a reference i

Re: threads merged

ork is ongoing in the nqp branch: gh67-threads. This needs parrot > with threads and rurban/gh870-pmc_class. > > Long live perl6 > -- > Reini Urban > http://cpanel.net/ http://www.perl-compiler.org/ > ___ > http://lists.parrot.org/mailman/listinfo/parrot-dev > -- Jonathan "Duke" Leto Leto Labs LLC http://labs.leto.net 209.691.DUKE http://dukeleto.pl

Rakudo Star 2012.10 released

On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the October 2012 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the October 2012 release is available from . A Windows .MSI version of Rakudo

Re: s:g/T/U/ doesn't work ?

I imagine it's the same problem as this Perl 5 code: use Test::More; for ('GATGGAACTTGACTACGTAAATT') { s/T/U/g; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } Since $_ is an alias for each element of the list and the only element in the list is a constant string and you can't modify constan

Announce: Rakudo Perl 6 compiler development release #57 ("Tokyo")

release. For a more detailed list, see "docs/ChangeLog". The development team thanks all of our contributors and sponsors for making Rakudo Perl possible, as well as those people who worked on Parrot, the Perl 6 test suite and the specification. The following people contributed to

[Announce] Rakudo 2012.06 "Strasbourg"

The following people contributed to this release: Contributors to Rakudo since the release on 2012-05-17: Moritz Lenz, Jonathan Worthington, Patrick R. Michaud, kboga, Jonathan Scott Duff, Tadeusz Sośnierz, Carl Masak, Geoffrey Broadwell, diakopter, Solomon Foster, JimmyZ, TimToady If you would like

Re: [perl #113660] [BUG] rakudo build fails when building NQPCORE.setting.pir starting with rakudo git tag 0fde4a1e375a26da8d7b511aafdb6174e934b757

body who has this issue? I'll dig a bit deeper and see if I can spot anything that could be to blame between this bootstrap update and the previous one. Additionally, I just pushed an additional bootstrap update, just in case it helps, but I don't really see why it would. Feel free to try out 73ebd23 though. Thanks, Jonathan

Re: [perl #113660] [BUG] rakudo build fails when building NQPCORE.setting.pir starting with rakudo git tag 0fde4a1e375a26da8d7b511aafdb6174e934b757

hing that could be to blame between this bootstrap update and the previous one. Thanks, Jonathan

Re: sound distribution practices

ng due to the timing of the email; we didn't do a distribution release for March (so last interested one to package was in Feb), and the next one is due this month. Thanks, Jonathan

Re: How to make a new operator.

On Mar 24, 2012, at 6:36 PM, Stefan O'Rear wrote: > On Sat, Mar 24, 2012 at 06:16:58PM -0700, Jonathan Lang wrote: >> IMHO: if we're going to take loss of precision into account, we should do so >> explicitly. I'm a bit rusty, so forgive me if I misuse the termi

Re: How to make a new operator.

On Mar 24, 2012, at 5:26 PM, Damian Conway wrote: >> Actually, that one works fine in both niecza and rakudo, since those are >> Rats. > > Oh, that's good to hear. > > It doesn't change my underlying argument however. Any operations > performed on genuine floats are going to lose precision, an

Re: How to make a new operator.

What I want to know is whether there's a way to define a step function that's based in part or in whole on the current term's index. For example, how would I use infix:<...> to generate the perfect squares between 0 and 100? Namely, '0,1,4,9,16,25,36,49,64,81,100'. For example, is Perl 6 set

Re: How to make a new operator.

My understanding is if you want to count by threes, starting at 2 and ending at 14, you should be able to write: 2, 5 ... 14 That is, the list-building operator looks at the previous two or three terms preceding it to determine where to start and what "step function" to use, and then looks

Parrot 4.2.0 "Ornithopter" Released!

Andy Lester, Vasily Chekalkin, Jonathan "Duke" Leto, jkeenan, Alvis Yardley Whiteknight, Brian Gernhardt, Gerhard R, NotFound, Francois Perrad, Moritz Lenz and luben. Our next scheduled release is 17 April 2012. Enjoy! -- Jonathan "Duke" Leto Leto Labs LLC 209.691.DUKE //

Announce: Rakudo Star 2012.02 released

On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the February 2012 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the February 2012 release is available from . In the Perl 6 world, we make

Re: Setting private attributes during object build

Why must we use 'submethod BUILD' instead of 'method BUILD'? Is it some sort of chicken-and-egg dilemma?

Announce: Rakudo Star 2012.01 released

On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the January 2012 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the January 2012 release is available from . In the Perl 6 world, we make a

Re: Perl6/Catalyst on Cloud Foundry?

g > Perl6/Catalyst to run on it? > > Where would Parrot/LLVM fit in? > > What about Perl 6 package managers (similar to RubyGems)? > > Thanks, > Juan -- Jonathan "Duke" Leto Leto Labs LLC 209.691.DUKE // http://labs.leto.net NOTE: Personal email is only check

PL/Perl6 Hague Grant

Howdy, I recently wrote a Hague grant for PL/Perl6 and it just went live for review: http://news.perlfoundation.org/2011/11/hague-grant-application-plperl.html Feedback on the grant would be awesomely appreciated! Duke -- Jonathan "Duke" Leto Leto Labs LLC 209.691.DU

Announce: Rakudo Perl 6 compiler development release #45 ("Houston")

ot, the Perl 6 test suite and the specification. The following people contributed to this release: Jonathan Worthington, Moritz Lenz, Will "Coke" Coleda, Tadeusz Sośnierz, Patrick R. Michaud, Jonathan Scott Duff, Carl Masak, Geoffrey Broadwell, mls, snarkyboojum, gfldex, TimToady, TiMBuS,

Parrot 3.9.0 "Archaeopteryx" Released

fbababff44bfad parrot-3.9.0.tar.bz2 568bfffad0bc7595164f342cd39c33ac967286423844491e85a8f9767f15871c parrot-3.9.0.tar.gz Many thanks to all our contributors for making this possible. This release comprises 182 commits by 17 authors on the master branch since the previous release: Michael Schroeder, Whiteknight, soh_cah_toa, Jonathan "Duke

Re: [perl #77202] [BUG] "Method 'foo' not found" error is missing class name

A, so the error message is appropriate. The invocant just happens to be the instance of class A that serves as the type object. Thanks, Jonathan

Re: Parrot/Perl6 BOF at YAPC::NA 2011

raged to > attend either or both sessions.  It's a great time to get to know your > fellow hackers and get some good hacking in. > > If you have any questions, let me know.  See you there! > > -Jon Gentle > -- Jonathan "Duke" Leto 209.691.DUKE // http://leto.net NOTE

Re: Current vs future Perl 6 binary size

On Thu, Apr 21, 2011 at 6:33 PM, gvim wrote: > This is not a criticism of anything. I am not a core developer but need to > be aware of what to expect when Perl 6 settles down into a production-ready > state. The Perl 6 binary within the January release of Rakudo Star is 10Mb > on my Snow Leopard

Announce: Rakudo Perl 6 compiler development release #40 ("ZA")

e following people contributed to this release: Moritz Lenz, Tadeusz Sośnierz, Martin Berends, Andy Lester, Jonathan Scott Duff, flussence, Patrick Abi Salloum, Carl Masak, Jarrod If you would like to contribute, see <http://rakudo.org/how-to-help>, ask on the perl6-compi...@perl.org mailing list,

Re: PDL datastructure in the core spec

have in implementing it. Jonathan Worthington is working on a new meta object system for Rakudo, which for example should enable natively typed arrays, and other goodies. This would be an excellent foundation for PDL. A bunch of the stuff that needs to happen to get the S09 PDL-ish bits implement

Re: [perl #80694] [BUG] Strange stateful results when calling a method containing a .^can call in Rakudo

On 13/12/2010 21:08, Carl Mäsak (via RT) wrote: # New Ticket Created by "Carl Mäsak" # Please include the string: [perl #80694] # in the subject line of all future correspondence about this issue. #http://rt.perl.org/rt3/Ticket/Display.html?id=80694> rakudo: class A { method foo { 'abc' };

Re: Implementations until Perl 6.0.0 released?

On 27/11/2010 18:37, Jonathan Worthington wrote: On 26/11/2010 17:17, gvim wrote: I'm new to the Perl 6 lists so can someone tell me if the "implementations" of Perl 6 will eventually transition to a Perl 6.0.0 standard or will TIMTOWTDI apply to the language itself inde

Re: Implementations until Perl 6.0.0 released?

On 26/11/2010 17:17, gvim wrote: I'm new to the Perl 6 lists so can someone tell me if the "implementations" of Perl 6 will eventually transition to a Perl 6.0.0 standard or will TIMTOWTDI apply to the language itself indefinitely? The implementations are aiming towards passing a common test s

Google Code-In brings fresh blood to the Perl and Parrot communities

evant or interesting information, please pass it on! PS: You can see a list of all 20 accepted organizations here: http://google-opensource.blogspot.com/2010/11/announcing-accepted-organizations-for.html Duke -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

Packed arrays and assignment vs binding

assignment semantics like binding ones" is not so simple, since it'd seem that we do not get anything we could call .STORE on back from @x[0] from a natively typed array. Any thoughts? (Same questions/answers apply for natively typed attributes in objects, or at least I'd be very surprised if they are different.) Thanks, Jonathan

Re: Problem with NativeCall

(a.k.a PMC). There is a call to isa_pmc(), which is checking what kind of object it is, but since it is NULL, you get the above error. Hopefully this helps you debug this issue. Good Luck! Duke -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

Announce: Rakudo Perl 6 compiler development release #34 ("Paris")

s all of our contributors and sponsors for making Rakudo Perl possible, as well as those people who worked on Parrot, the Perl 6 test suite and the specification. The following people contributed to this release: Moritz Lenz, Kodi Arfer, Patrick R. Michaud, Bruce Gray, Carl Masak, Ronald Schmidt,

Re: [perl6/specs] 58fe2d: [S12] spec setting and getting values of attribute...

On 30/09/2010 10:49, Damian Conway wrote: As long as C<.perl> works the way it does, there can be no real privacy. Sigh. That is indeed badly broken. Surely it ought to default to C, and require class architects to override .perl explicitly if they wish to break encapsulation. I see/use .perl

Re: not using get/set (was Re: [perl6/specs] 4d77c0: ...)

ve different operators for them). In the REPR API I called this thing bind_attr to be clear that's what it's doing. Thanks, Jonathan

[perl #77820] [BUG] NaN.Rat

# New Ticket Created by "Jonathan Leto" # Please include the string: [perl #77820] # in the subject line of all future correspondence about this issue. # http://rt.perl.org/rt3/Ticket/Display.html?id=77820 > Howdy, $ git rev-parse HEAD 9993bb24d7d109485fe78a6afd463671912c6

[perl #77778] spec test failures on rakudo 7517e39, parrot r48909 (using --gen-parrot) on 64bit linux

# New Ticket Created by "Jonathan Leto" # Please include the string: [perl #8] # in the subject line of all future correspondence about this issue. # http://rt.perl.org/rt3/Ticket/Display.html?id=8 > Howdy, I am seeing these spectest failures: Test S

Re: Buf.pm: FIFO and grammar

Nicholas Clark wrote: On Thu, Aug 12, 2010 at 03:38:31PM +0200, Carl Mäsak wrote: In fact, jnthn++ had a talk at YAPC::EU the other week where he showed how nested signatures can be used to make hierarchical matches. A proof-of-concept module could simply be some sugar around this already ex

Re: Performance: ... vs ..

On Tue, Aug 3, 2010 at 1:18 AM, Aaron Sherman wrote: > I know that Rakudo isn't well tuned for performance right now, but this is > still probably worth noting because it's such a specific difference between > two similar ways of doing one task. > > The recent thread about "..." and ".." had me d

Re: Perl 6 User Documentation

ted you to know about prior art and possibly helpful and related work. Good luck and thanks for your efforts! Duke -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

Re: Smart match isn't on Bool

tch. They should only compare alike when cast into the same type such as with a ? or +. Right, which happens in given/when. Jonathan

Re: Array membership test?

Mark J. Reed wrote: Possibly a FAQ, but is there a simple way of asking if an item is contained in an array? I know of $x ~~ any(@array) and @array.grep({ $_ ~~ $x}), but those both seem a bit complicated for a conceptually simple test, so I'm wondering if I'm missing something. Note that grep d

Re: r31627 -[S32/Temporal] Changed to use a different way of specifying time zones, which is hopefully saner than my last proposal.

On Sun, Jul 11, 2010 at 12:56 PM, wrote: > Author: Kodi > Date: 2010-07-11 19:56:33 +0200 (Sun, 11 Jul 2010) > New Revision: 31627 > > Modified: > docs/Perl6/Spec/S32-setting-library/Temporal.pod > Log: > [S32/Temporal] Changed to use a different way of specifying time zones, > which is hopeful

Re: [perl #76442] [BUG} say ?1..2 # prints ones indefinitively

weight. If you defined the above and passed in (True,2), then it'd just be a dispatch fail because no candidates were found that matched. Which may not actually be a bad response... Jonathan

Re: [perl #76330] MONKEY_TYPING cannot add method named invoke

Paweł Pabian (via RT) wrote: # New Ticket Created by Paweł Pabian # Please include the string: [perl #76330] # in the subject line of all future correspondence about this issue. # http://rt.perl.org/rt3/Ticket/Display.html?id=76330 > [19:53] rakudo: use MONKEY_TYPING; augment class Any { m

Re: S06 -- grammatical categories and macros

certainly would want to be written in terms of self, not have a parameter. So something is wonky with the spec here. Hope this helps a little, Jonathan

Question about @_ for a sub given no arguments

ng related to this. This behavior seems slightly unintuitive to me, I would expect something like Nil. For reference, I ran into this hacking on PL/Perl 6, which allows writing stored procedures for PostgreSQL in Rakudo Perl 6. Duke -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

Re: underscore in numbers

just keeps compiled copies of that in its repo. That can be found at: http://github.com/perl6/nqp-rx/ And likely just needs a tweak to a Perl 6 grammar rule rather than some PIR hacking. :-) Thanks! Jonathan

[perl #75650] [PATCH] Add test for loading perl6.pbc as bytecode

I've made a new patch that does not require TAP::Harness 3.x, and uses a Rakudo test with a call to run() to run the Parrot test which loads the bytecode. >From 039c18b01b2c12b95de560c5a26bdc7ac9dd7a32 Mon Sep 17 00:00:00 2001 From: Duke Leto Date: Wed, 9 Jun 2010 13:44:41 -0700 Subject: [PATCH] A

[perl #75650] [PATCH] Add test for loading perl6.pbc as bytecode

# New Ticket Created by "Jonathan Leto" # Please include the string: [perl #75650] # in the subject line of all future correspondence about this issue. # http://rt.perl.org/rt3/Ticket/Display.html?id=75650 > Howdy, I have attached a small patch that adds a test for loading

Re: Loading Rakudo's perl6.pbc from the Parrot embedding API

Howdy, This PIR code .sub main load_bytecode '/Users/leto/svn/parrot/installed_parrot/lib/2.4.0-devel/languages/perl6/perl6.pbc' .end gives the exact same error message, so this issue does not appear to be specific to the Parrot embedding API. Duke -- Jonathan "D

Loading Rakudo's perl6.pbc from the Parrot embedding API

s. What am I missing? Any hints would be greatly appreciated. I am currently using Parrot trunk ( revision 47312 ) and Rakudo master ( a0b6d74d ). Duke -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

Re: underscores vs hyphens (was Re: A new era for Temporal)

On Sat, Apr 10, 2010 at 5:14 AM, Mark J. Reed wrote: > I'd much rather see a single consistent style throughout the setting > than backwards compatibility with p5 naming conventions. > > If Temporal is the first setting module to use multiword identifiers, > I vote for hyphens. As another data

Re: expression of seconds (was Re: A new era for Temporal)

ies a constraint, *not* a coercion. That's: $dt.seconds.Int Though even clearer and same number of characters as whole_seconds is: $dt.seconds.round Jonathan

Re: [perl #59118] Class attributes without accessors don't work in Rakudo

is always unambiguously an instance attribute. Jonathan

Re: ^[[A^[[A

e [0] http://leto.net/dukeleto.pl/2010/03/google-summer-of-code-2010.html > > -- > Kiffin Gish > Gouda, The Netherlands > > > -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

Re: Symbol '$x' not predeclared in

gt;  my $x = 8 >> say $x > Symbol '$x' not predeclared in > > How can I define variables and use them later? > > -- > Kiffin Gish > Gouda, The Netherlands > > > -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

Calling All Google Summer of Code Mentors

as a mentor last year and you are not interested this year, please remove yourself from the page. -- Jonathan "Duke" Leto jonat...@leto.net http://leto.net

  1   2   3   4   5   6   7   8   9   10   >