Hello,
I am very much a novice at perl and probably bitten off more than I can chew
here.
I have a file, which is a dump of a database - so it is a fixed file format.
The problem is that I am struggling to manipulate it correctly. I have been
trying for two days now to get a program to work. The
Hi
I am working on a module that occasionally needs to raise alarms by sending
sms to concerned ppl.
For this, I would like to login to the site : www.sms.ac
The login page is http://www.sms.sc/login.asp
Then I have to go to the main page , fill the To: and Message: textboxes and
send sms.
I h
On Mon, Jun 23, 2003 at 10:43:07AM +0200 Denham Eva wrote:
> I am very much a novice at perl and probably bitten off more than I can chew
> here.
> I have a file, which is a dump of a database - so it is a fixed file format.
> The problem is that I am struggling to manipulate it correctly. I have
Denham Eva said:
> Hello,
>
> I am very much a novice at perl and probably bitten off more than I can
> chew
> here.
> I have a file, which is a dump of a database - so it is a fixed file
> format.
> The problem is that I am struggling to manipulate it correctly. I have
> been
> trying for two day
Hello. I am new to Perl. I used to program in C years ago (not C++ # etc)
I have the simplest question. I am running active state perl 5 on Win XP.
I'm using OpenPERL Ide 1.0
#!k:/perl/bin/perl.exe
#
# Camel-Learning Perl
# Exercise 2-4
# Input a & b from Console
# Then multiply & print them
#
I'm on the first few chapters of "Learning Perl" and came up with a
question. Given:
-
#!/usr/bin/perl
@array = qw ( one two three );
print @array . "\n";
print @array;
-
Can you explain why the first print statement print
How can I install the MD5 module on the server where I'm hosting my website?
_
MSN 8 helps eliminate e-mail viruses. Get 2 months FREE*.
http://join.msn.com/?page=features/virus
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For addi
Could anyone give me step by tep instructions on how to install a perl
module (MD5) on my host server. How come they don't have it installed? Isn't
popular enough?
Sorry if I sent the same message for the second time, but the prvious one
doesn't came through on my list.
Mariusz
__
Peter said:
> I'm on the first few chapters of "Learning Perl" and came up with a
> question. Given:
>
> -
>
> #!/usr/bin/perl
>
> @array = qw ( one two three );
> print @array . "\n";
> print @array;
>
> -
>
> Can you explai
Hi all,
I have a string that is a random sequence like the following:-
ACGTCGTCGTCACACACACGCGTCTCTATACGCG
I want to be able to parse the string, picking out any TATA sequences, colour them in
red and make a not of where ther lie in the sequence.
Is this possible with perl?
cheers
Rob.
=
Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100:
> I have a string that is a random sequence like the following:-
>
> ACGTCGTCGTCACACACACGCGTCTCTATACGCG
>
> I want to be able to parse the string, picking out any TATA sequences,
> colour them in red and make a not of where ther lie in the
Mario Kulka wrote at Mon, 23 Jun 2003 03:40:03 +:
> Could anyone give me step by tep instructions on how to install a perl
> module (MD5) on my host server. How come they don't have it installed? Isn't
> popular enough?
BTW, the MD5 module is deprecated. It is recommended to install
Digest:
what does shift do in perl?
cheers
Rob.
> -Original Message-
> From: Janek Schleicher [mailto:[EMAIL PROTECTED]
> Sent: 23 June 2003 08:52
> To: [EMAIL PROTECTED]
> Subject: Re: perl reg exp problem
>
>
> Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100:
>
> > I have a string th
Scott_g wrote at Sun, 22 Jun 2003 15:21:24 -0500:
> Hello. I am new to Perl. I used to program in C years ago (not C++ #
> etc)
>
> I have the simplest question. I am running active state perl 5 on Win
> XP.
>
> I'm using OpenPERL Ide 1.0
>
> #!k:/perl/bin/perl.exe
> #
> # Camel-Learning Perl
>
I don't have code to do what I want, but here's the pieces I'm trying to
string together:
Abbreviation dictionary consists of a file like this:
SRED. SREDNE
SEV. SEVERN
etc.
Each abbreviation is turned into four regexes, like this (doubtless they
could be made more efficient, but they work wel
Scott_G <[EMAIL PROTECTED]> wrote:
:
: Hello. I am new to Perl. I used to program in C
: years ago (not C++ # etc)
:
: I have the simplest question. I am running active
: state perl 5 on Win XP.
:
: I'm using OpenPERL Ide 1.0
:
It's probably your IDE.
This works from a console:
print
"Robin Garbutt" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
what does shift do in perl?
cheers
Rob.
> -Original Message-
> From: Janek Schleicher [mailto:[EMAIL PROTECTED]
> Sent: 23 June 2003 08:52
> To: [EMAIL PROTECTED]
> Subject: Re: perl reg exp problem
>
>
> Robin
Opps double clicked first time round, I blame my mouse :-)
Robin, perl has online documentation for all it's functions and much more.
try the following
perldoc -f shift
and
perldoc perldoc
for more general advice
HTH
"Rob Anderson" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Finally, some usefull stuff in Perl ;-))
>
Finally? This is the Perl list not the PHP list ;p
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Since I didn't get any responses on my last question about process creation
and the killing of child processes I thought that maybe I'd switch gears a
bit and ask:
On Unix does one know how I can get the process id of a process kicked off
from within a perl script via the back-tic ("`") syntax?
Hi all,
i have the following problem with the following script:
#!/usr/bin/perl -w
# $Id: cmd.pl,v 1.4 2001/02/22 00:14:48 btrott Exp $
use strict;
use Net::SSH::Perl;
use Net::SSH::Perl::Cipher;
chomp(my $this_host = `hostname`);
print "Enter a host name to connect to: [$this_host] ";
chomp(m
> > So if $q above is : hi=bye&love=hate&one=two&etc=etc
>
> Hmmm. Do you work for the State Department or something? Or
> the White House Press office?
That was a good one
> >
> > I want to remove, say 'love', so it'd be: hi=bye&one=two&etc=etc
> >
> > I know I could do a regex but I'd like
>
> Do I need to change the http header for transfering image
> urls? I get errors
Yes.
And what do you mean by 'transfer'?
You may want Net::FTP
> when I transfer a jpg:
> picture cannot be displayed because it contains errors.
>
Try this:
#!/usr/bin/perl -w
use strict;
use LWP::Simple;
On Jun 22, Peter said:
>print @array . "\n";
>print @array;
>
>Can you explain why the first print statement prints "3" (and a carriage
>return) while the second prints "onetwothree"? My understanding is that
>the first print sees the array in scalar context while the second sees
>it in list cont
I have a Publication Order Form, with checkboxes beside each title. The list needs to
be emailed to ONLY the department that carries the publication ordered (not all
departments).
I think I should I grab the form data, use CHOMP to get only "fire" from "fire-01" but
then how do I get it into {
In article <[EMAIL PROTECTED]>, Janek Schleicher
wrote:
> Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100:
>
>> I have a string that is a random sequence like the following:-
>>
>> ACGTCGTCGTCACACACACGCGTCTCTATACGCG
>>
>> I want to be able to parse the string, picking out any TATA seque
On Jun 23, [EMAIL PROTECTED] said:
>SRED. SREDNE
>SEV. SEVERN
># Match it at beginning of line
>$cgname =~ s/^SRED\.(?=[\W\s\-\d]+)/SREDNE:/g ;
Three things -- the + modifier on the [...] isn't needed, you don't need
to put \s and - in a character class you've already put \W in, and the /g
modi
I've got a script which opens a filehandle to write print statments to a file.
But, I'm also running some system commands, and I would also like to send
stdout and stderr to that filehandle. I could just echo text to a file, or I
could use a filehandle. Which would be "better?"
my $log
Hi, I really green to perl and would like suggestions on creating a script
that would allow users to modify a certain file from a web page. This file
is a list of customers a particular sales person will cover. So, the web
page will allow this sales person to add, delete and update this customer
> Hi, I really green to perl and would like suggestions on
> creating a script that would allow users to modify a certain
> file from a web page. This file is a list of customers a
> particular sales person will cover. So, the web page will
> allow this sales person to add, delete and update
On Mon, 23 Jun 2003 03:40:03 +, [EMAIL PROTECTED] (Mario Kulka)
wrote:
>Could anyone give me step by tep instructions on how to install a perl
>module (MD5) on my host server. How come they don't have it installed? Isn't
>popular enough?
>
>Sorry if I sent the same message for the second tim
(Apologies if this gets out to you more than once...)
I've got a script which opens a filehandle to write print statments to a file.
But, I'm also running some system commands, and I would also like to send
stdout and stderr to that filehandle. I could just echo text to a file, or I
could use a f
Steve Blumenkrantz wrote:
>
> Since I didn't get any responses on my last question about process creation
> and the killing of child processes I thought that maybe I'd switch gears a
> bit and ask:
>
> On Unix does one know how I can get the process id of a process kicked off
> from within a per
I think this is ok but I want to make sure I'm not missing some obvious thing.
If I do some headers with print and then do a CGI header(), that will work ok right?
IE:
use CGI qw(:standard);
print "Set-Cookie: $c\n";
print header();
...
OR
use CGI qw(:standard);
print "Set-Cookie: $c\n";
prin
hi, how can i use a real regex with this:
File::Find::name if -x?
the filetestops are working fine, but how can i filter things like
.gz$? i tried many ways, but all failed. any idea? thanks!!
bye andreas
--
.::Please visit my homepage::.
http://www.math55.de.vu
.::A very good JAVA site (wort
I'm still very green to perl, so please forgive this possibly stupid
question.
I want to setup a configuration file to have a list of alpha codes
delimiter and a unique number that will match the code e.g.
PACT | 23
PART | 24
etc
How is the best way to read such a file into my program (hash ?)
Hi,
I am new to using Perl to parse a file. What I am trying to do is parse a file that
is made of online orders. I have written some code using for and if statements that
will go through the file line by line and using regex I try to match the information
with the variables so that I can wri
Hi all,
I have this scenario:
I have a 'main' program that needs to call on progA under condtions A,
progB under conditions B, etc.
Now, I would like the progA, progB, progC to remain independent of the
'main' program at all times. The only thing I would like to connect them
is the paramteres
In article <[EMAIL PROTECTED]>,
Robin Garbutt wrote:
> Hi all,
>
> I have a string that is a random sequence like the following:-
>
> ACGTCGTCGTCACACACACGCGTCTCTATACGCG
>
> I want to be able to parse the string, picking out any TATA sequences,
> colour them in red and make a not of where ther
> Hi all,
Howdy
>
> I have this scenario:
> I have a 'main' program that needs to call on progA under
> condtions A, progB under conditions B, etc.
>
> Now, I would like the progA, progB, progC to remain
> independent of the 'main' program at all times. The only
> thing I would like to conn
This will do ...
alpha_hash is u r hash...
-
my %alpha_hash = ();
open(FH_D,"$d_list") || die "File opening $d_list\n";
@file_list = ;
foreach $record (@file_list) {
@t_array = split(/\|/, $record);
$alpha_hash{$t_array[0]} = $t_array[1];
}
close(FH_D);
--- Tim
This will do ...
alpha_hash is u r hash...
-
my %alpha_hash = ();
open(FH_D,"$d_list") || die "File opening $d_list\n";
@file_list = ;
foreach $record (@file_list) {
@t_array = split(/\|/, $record);
$alpha_hash{$t_array[0]} = $t_array[1];
}
close(FH_D);
--- Tim
Deb wrote:
>
> I've got a script which opens a filehandle to write print statments to a file.
> But, I'm also running some system commands, and I would also like to send
> stdout and stderr to that filehandle. I could just echo text to a file, or I
> could use a filehandle. Which would be "bette
Hello all...
I've implemented the TCP/IP server at the top of p.441 of The Camel (3rd
edition) Chapter 16, and it's working fine. That is, it opens the port I
tell it to, and other processes connect to it and happily send it stuff.
(This is using IO::Socket::INET).
But now I'm a little c
[EMAIL PROTECTED] wrote:
>
> hi, how can i use a real regex with this:
>
> File::Find::name if -x?
>
> the filetestops are working fine, but how can i filter things like
> .gz$? i tried many ways, but all failed. any idea? thanks!!
File::Find puts the current file name into $_ in the callback s
Tim McGeary wrote:
>
> I'm still very green to perl, so please forgive this possibly stupid
> question.
>
> I want to setup a configuration file to have a list of alpha codes
> delimiter and a unique number that will match the code e.g.
>
> PACT | 23
> PART | 24
> etc
>
> How is the best way to
Something like this worked for me in the past:
use strict;
use IO::Socket::INET;
my $sock = IO::Socket::INET();
while(1) {
my $output;
my $n = sysread($sock,$output,1000);
last if(!defined($n));
print STDOUT $output;
}
And using syswrite() for writing.
perldo
Cool. I didn't know about the IPC::Open3 module. Will look at it.
Thanks for the pointer!
deb
At 15:04:25, on 06.23.03:
Cracks in my tinfoil beanie allowed John W. Krahn to seep these bits into my brain:,
> Deb wrote:
> >
> > I've got a script which opens a filehandle to write print statments
On Mon, Jun 23, 2003 at 01:39:49PM -0700, Madhu Reddy wrote:
A little unasked-for code review :-)
> my %alpha_hash = ();
> open(FH_D,"$d_list") || die "File opening $d_list\n";
^ ^
You don't need to quote the variable.
> @file_list = ;
> foreach $record (@file_list) {
And in
List,
I would like to write a script that would check the correct syntax of an XML
file. Need to check if the file is XML compliant. Is there a module that I
can use to do this? Thanks!
In article <[EMAIL PROTECTED]>, Janek Schleicher
wrote:
> Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100:
>
>> I have a string that is a random sequence like the following:-
>>
>> ACGTCGTCGTCACACACACGCGTCTCTATACGCG
>>
>> I want to be able to parse the string, picking out any TATA seque
Trevor Morrison wrote:
>
> Hi,
Hello,
> I am new to using Perl to parse a file. What I am trying to do is
> parse a file that is made of online orders. I have written some code
> using for and if statements that will go through the file line by line
> and using regex I try to match the informa
On Mon, Jun 23, 2003 at 10:04:22PM +0200 Hamish Whittal wrote:
> I have this scenario:
> I have a 'main' program that needs to call on progA under condtions A,
> progB under conditions B, etc.
>
> Now, I would like the progA, progB, progC to remain independent of the
> 'main' program at all times
I have a perl program that I need to be able to run on all kinds of machines.
However, I cannot install perl on each of these machines.
It has to be run locally, not over a network (too many issues with security)
How can this be done?
I know with several other languages, you can make an EXE or copy
I think there is something called perl2exe . Try googling it.
On Mon, 23 Jun 2003, Dave Mamanakis wrote:
> I have a perl program that I need to be able to run on all kinds of machines.
> However, I cannot install perl on each of these machines.
> It has to be run locally, not over a network (too
55 matches
Mail list logo
