Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: > I have a string that is a random sequence like the following:- > > ACGTCGTCGTCACACACACGCGTCTCTATACGCG > > I want to be able to parse the string, picking out any TATA sequences, > colour them in red and make a not of where ther lie in the sequence. > > Is this possible with perl?
Yes, but you have to explain in what matter you want to colorize. As output in a terminal window, as html/xml, as a picture, as a word document ... . If you would have in a pseudo-xml with the tag <red>...</red>, you would perhaps do it as: $string =~ s/(TATA)/<red>$1</red>/g; Greetings, Janek -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
