On 12/26/18 7:31 AM, Mike Martin wrote:
Any ideas how to test for the existance of a file, when the file name
contains extended ascii characters
For example if the file contains emdash (U-2014) file -e always
returns false
-e should not be looking at the filename directly. it checks if
w to test for the existance of a file, when the file name
> contains extended ascii characters
>
> For example if the file contains emdash (U-2014) file -e always returns
> false
>
> thanks
>
> Mike
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Any ideas how to test for the existance of a file, when the file name
contains extended ascii characters
For example if the file contains emdash (U-2014) file -e always returns
false
thanks
Mike
Hi Lauren,
On Fri, 27 Jul 2018 11:28:42 +0800
"Lauren C." wrote:
> greetings,
>
> I was doing the log statistics stuff using perl.
> There are chinese characters in log items.
> I tried with regex to match them, but got no luck.
>
> $ perl -mstrict -le '
oops that's perfect. thanks Shlomi.
On 2018/7/27 星期五 PM 1:26, Shlomi Fish wrote:
Hi Lauren,
On Fri, 27 Jul 2018 11:28:42 +0800
"Lauren C." wrote:
greetings,
I was doing the log statistics stuff using perl.
There are chinese characters in log items.
I tried with regex to matc
greetings,
I was doing the log statistics stuff using perl.
There are chinese characters in log items.
I tried with regex to match them, but got no luck.
$ perl -mstrict -le 'my $char="汉语"; print "it is chinese" if $char =~
/\p{Han}+/'
$ perl -mstrict -mutf8 -l
"Chris Charley" writes:
> You could do that in 1 line - See the following small program.
> (The line using a 'grep' solution is commented out. It would work as well).
>
>
> #!/usr/bin/perl
> use strict;
> use warnings;
>
> while (my $id = ) {
>chomp $id;
>#if (grep /itemid=.*?[^\w-]/, spl
On Jan 26, 2016, at 11:22 AM, Chris Charley wrote:
>
> You could do that in 1 line - See the following small program.
Thanks, Chris. That'll do the trick. And the grep alternative is
interesting, too. I hadn't thought of that.
Regards,
Frank
--
To unsubscribe, e-mail: beginners-unsub
"SSC_perl" wrote in message
news:ef7499af-b4a5-4b07-8c69-3192ef782...@surfshopcart.com...
On Jan 25, 2016, at 4:59 PM, Shawn H Corey wrote:
Use the negative match operator !~
if( $QUERY_STRING !~ m{ itemid = [-0-9A-Za-z_]+? (?: \& | \z ) }msx ){
print "bad: $QUERY_STRING\n";
}
Tha
On Jan 25, 2016, at 4:59 PM, Shawn H Corey wrote:
>
> Use the negative match operator !~
>
> if( $QUERY_STRING !~ m{ itemid = [-0-9A-Za-z_]+? (?: \& | \z ) }msx ){
>print "bad: $QUERY_STRING\n";
> }
Thanks for that, Shawn. It works perfectly except for one criteria
that I inadver
On Mon, 25 Jan 2016 16:16:40 -0800
SSC_perl wrote:
> I'm trying to find a way to trap bad item numbers. I want to
> parse the parameter "itemid=" and then everything up to either an "&"
> or end-of-string. A good item number will contain only ASCII
> letters, numbers, dashes, and undersco
I'm trying to find a way to trap bad item numbers. I want to parse the
parameter "itemid=" and then everything up to either an "&" or end-of-string.
A good item number will contain only ASCII letters, numbers, dashes, and
underscores and may terminate with a "&" or it may not (see samp
On 12/28/2013 05:52 PM, Shawn Wilson wrote:
> The parser has done what its supposed to. IDK you can alter the
> encoding in it. Maybe you can and that's what you're looking for
> (encoding or character set). I'd first try binmode UTF-8 but you'll
> probably just end up handling this with a regex.
The parser has done what its supposed to. IDK you can alter the encoding in it.
Maybe you can and that's what you're looking for (encoding or character set).
I'd first try binmode UTF-8 but you'll probably just end up handling this with
a regex.
"Lars Noodén" wrote:
>If there is a better list
If there is a better list for discussing HTML::TokeParser, I can post
there. I have a code snippet which successfully extracts a piece of a
web page. However, something goes south with the conversion to text.
What should come out as the following
Temperature 3.2°C
Humidity 94%
On 04/09/2013 03:58, Michael Rasmussen wrote:
On Wed, Sep 04, 2013 at 02:31:30AM +0100, Rob Dixon wrote:
John's solution:
next if /[^[:lower:]_\d\-. ]/;
Doesn't work in this test environment:
michael@bivy:~$ cat tpl && ./tpl
#!/usr/bin/perl
use strict;
use warnings;
>>>
>>>
>>> It skips to the next item in the while loop of the string begins with
>>> # and works fine. I would also like to skip to the next item in the
>>> loop if the string contains anything other then lowercase,
>>> underscores, numbers,
ing begins with
> ># and works fine. I would also like to skip to the next item in the
> >loop if the string contains anything other then lowercase,
> >underscores, numbers, dashes, periods, and spaces. I do not want
> >uppercase characters and any sort of other special ch
ntains anything other then lowercase,
>underscores, numbers, dashes, periods, and spaces. I do not want
>uppercase characters and any sort of other special characters. How
>would I do that?
The solution from John Krahn is superior by far, and there is no need for any
other suggestions
, and spaces. I do not want
> uppercase characters and any sort of other special characters. How
> would I do that?
Try this:
#!/usr/bin/perl
use strict;
while () {
#chomp;
next if /^#/;
next unless /^[a-z0-9 -\._]+$/;
print;
}
__DATA__
good
bAd
go-od.
#bad
JD
--
To u
; # and works fine. I would also like to skip to the next item in the
> loop if the string contains anything other then lowercase,
> underscores, numbers, dashes, periods, and spaces. I do not want
> uppercase characters and any sort of other special characters. How
> would I do that?
,
underscores, numbers, dashes, periods, and spaces. I do not want
uppercase characters and any sort of other special characters. How
would I do that?
next if /[^[:lower:]_\d\-. ]/;
John
--
Any intelligent fool can make things bigger and
more complex... It takes a touch of genius -
and a lot of
then lowercase,
underscores, numbers, dashes, periods, and spaces. I do not want
uppercase characters and any sort of other special characters. How
would I do that?
I dunno.. maybe:
while () {
chomp;
next if /^#/;
next unless /^[a-z0-9_-. ]+$/;
# do stuff
}
I didn&#
, dashes, periods, and spaces. I do not want
uppercase characters and any sort of other special characters. How
would I do that?
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
From: Gregory Machin
> Thanks Terry for responding.
>
> The files are very big and contain data I'd prefer not to be out in the
> wild. what parts of the file would be helpful , I can provide the lines
> with the text and say heard part of the xml ??
>
> Thanks
> G
Yep, that should be enough.
On Wed, Jun 26, 2013 at 7:45 AM, Peter Gordon wrote:
> On Wed, 26 Jun 2013 12:36:01 +1200, Gregory Machin wrote:
> >
> >Looks like the data already is utf8, but the header of the XML
> >specifies otherwise.
> >How do you parse the data? Can you give us a short example file?
> >
> >Jenda
>
> This
On Wed, 26 Jun 2013 12:36:01 +1200, Gregory Machin wrote:
>
>Looks like the data already is utf8, but the header of the XML
>specifies otherwise.
>How do you parse the data? Can you give us a short example file?
>
>Jenda
This is a bit of code I adapt to whichever encoding I require.
use open ":enc
gt; From: Gregory Machin
> > I'm debugging an application written in Perl that converse data exported
> > from the Nessus security scanner in xml format. I have narrowed down the
> > bug to an issue with special characters in names that are in the file
> such
> > a
From: Gregory Machin
> I'm debugging an application written in Perl that converse data exported
> from the Nessus security scanner in xml format. I have narrowed down the
> bug to an issue with special characters in names that are in the file such
> as Fr~A©d~A©ric and Gr~A©goi
Hi.
I'm debugging an application written in Perl that converse data exported
from the Nessus security scanner in xml format. I have narrowed down the
bug to an issue with special characters in names that are in the file such
as Frédéric and Grégoire , thus é are most likely the guilty pa
Hi Bhanu,
On Fri, 2 Nov 2012 18:49:58 +0530
bhanu chaitanya abbaraju wrote:
> Hi All,
>
> Can any one help me, how can we create a file name with invalid characters
> ('?','/') in windows. Generally, Windows OS can not allow to create a file
> name with inv
Hi All,
Can any one help me, how can we create a file name with invalid characters
('?','/') in windows. Generally, Windows OS can not allow to create a file
name with invalid characters like '?,/' . But, I heard that we can able to
do with Perl script. If any one
On Tue, Oct 02, 2012 at 11:19:51PM +0100, Florian Huber wrote:
> The string is:
>
> >ENSG0112365|ENST0230122|109783797|109787053TGTTTCACAATTCACTACTAAATGTGTACCATTAAATTGAACAGAAAGCTGAGGAATGAACTTCAAGCATTACAAG
>
> So I'm trying to retrieve'ENSG0112365', 'ENST0230122
Flo
Original-Nachricht
> Datum: Tue, 2 Oct 2012 19:17:58 -0400
> Von: William Muriithi
> An: Florian Huber
> CC: beginners@perl.org
> Betreff: Re: Multiple matching of a group of characters
> Florian,
> >
> > The string is:
> >
>
>>> $string =~ /[ACGT]*/;
>>>
>>> and now it doesn't match anything. Shouldn't it try to match as
>>> many times as possible?
>>
>> It should match at least the once that you saw earlier (assuming
>> the same data).
>>
>>&g
2' and the
> sequence bit, starting with a 'T' and get rid of the junk in between.
>
> code:
>
> /#!/usr/bin/perl//
> //
> //use strict;//
> //use warnings;//
> //
> //my $gene;//
> //my @elements = <>;//
> //
> //foreach $gene (@elemen
it matches 5 letters, but this time from the beginning,
i.e.: ACGAC.
I'm guessing that the first 'NOTNEEDED' contains a 'G'. That
would explain the first match. The second result is nonesense
with the data we've seen. :-/ If 'NOTNEEDED' doesn't contain a
s
east the once that you saw earlier (assuming
the same data).
> My confusion was complete when I tried
>
> $string =~ /[ACGT]{5}/;
>
> now it matches 5 letters, but this time from the beginning,
> i.e.: ACGAC.
I'm guessing that the first 'NOTNEEDED' contains a
On Mon, Oct 1, 2012 at 5:15 PM, Florian Huber wrote:
>
> My confusion was complete when I tried
>
> $string =~ /[ACGT]{5}/;
>
> now it matches 5 letters, but this time from the beginning, i.e.: ACGAC.
>I'm trying to extract a DNA sequence out of a larger string, i.e. the string
>is of the follow
expression
/[ACGT]*/ can match anywhere in any string. Therefore, since the regular
expression matches at the first letter, the regular expression will declare a
match and stop.
If you want to match "one or more" characters, then use /[ACGT]+/.
>
> My confusion was complete when
Dear all,
I'm trying to extract a DNA sequence out of a larger string, i.e. the
string is of the following structure:
$string = "/NOTNEEDED/*ACGACGGGTTCAAGGCAG*/NOTNEEDED/"
But when I do
$string =~ /[ACGT]/;
it matches only the last letter, i.e. "G". Why doesn't it start at the
beginning?
At 8:37 PM -0800 3/9/12, Noah wrote:
Hi there,
I am trying to insert a '.' every four characters. Say I have a $it
= '123456789012' and want the result to be '1234.5678.9012'
whats one of the smoothest ways to do that?
You could adapt the method suggested b
> On 3/9/12 8:37 PM, Noah wrote:
>> Hi there,
>>
>> I am trying to insert a '.' every four characters. Say I have a $it
>> =
>> '123456789012' and want the result to be '1234.5678.9012'
>>
>> whats one of the smoothest
On 3/9/12 8:37 PM, Noah wrote:
Hi there,
I am trying to insert a '.' every four characters. Say I have a $it =
'123456789012' and want the result to be '1234.5678.9012'
whats one of the smoothest ways to do that?
okay I answered my own question. I am wonderin
Hi there,
I am trying to insert a '.' every four characters. Say I have a $it =
'123456789012' and want the result to be '1234.5678.9012'
whats one of the smoothest ways to do that?
Cheers,
Noah
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
F
Many good points, chomp resolved the issue but thanks for the
information in both posts, very helpful, so many things to learn yet.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Alex Ardin wrote:
Hi,
Hello,
I frequently have to review logs that are captured with 'script' using
terminal but these logs have many control characters.
The intent of the script is the following:
1. Get a listing of all the logs in a directory, storing the list of
files i
b.
-- iD
2012/1/5 Alex Ardin
> Hi,
> I frequently have to review logs that are captured with 'script' using
> terminal but these logs have many control characters.
>
> The intent of the script is the following:
>
> 1. Get a listing of all the logs in a directory
Hi,
I frequently have to review logs that are captured with 'script' using
terminal but these logs have many control characters.
The intent of the script is the following:
1. Get a listing of all the logs in a directory, storing the list of
files in an array.
2. For each filename in
hi,
thank you for your solution which works perfect for the data i have
given.
the trouble is: my data looks a little more complex as I have lots of
accented characters so with your code I need to specify each of those
characters in the tr/// part. I reckon the other way around would be
more
Frank Müller wrote:
dear all,
Hello,
i want to make some search and replace within a string where I can
define a set of characters, especially parenthesis, brackets etc.,
which are to be ignored.
For example, I have the following string:
sdjfh sdf sjkdfh sdkjfh sdjkf f[o]o(bar) hsdkjfh
dear all,
i want to make some search and replace within a string where I can
define a set of characters, especially parenthesis, brackets etc.,
which are to be ignored.
For example, I have the following string:
sdjfh sdf sjkdfh sdkjfh sdjkf f[o]o(bar) hsdkjfh sdkljfhs sjfh sdkj
sdjkfh sdjfh
On 11-08-02 01:26 PM, Brandon McCaig wrote:
By
then I just had to find the official documentation for the feature to
satisfy my curiosity. :\
Yes, it's the bane of restful nights and many a dead cat. :)
--
Just my 0.0002 million dollars worth,
Shawn
Confusion is the first step of unde
On Mon, Aug 1, 2011 at 6:29 PM, Jim Gibson wrote:
> Dr. Ruud is demonstrating the little-known but documented feature of Perl
> that the explicit empty regex // repeats the last, successful regex within
> its scope. Thus, in Dr. Ruud's sample program, the line
>
> my @result = $text =~ //g;
>
> i
On 01/08/2011 23:29, Jim Gibson wrote:
On 8/1/11 Mon Aug 1, 2011 11:20 AM, "Rob Dixon"
scribbled:
On 01/08/2011 19:00, Dr.Ruud wrote:
On 2011-08-01 15:52, Shlomi Fish wrote:
To convert a string to characters one can use split based on the empty
regex,
That should be "a p
.
>>
>> Say I have
>> $foo = "From Big Brother Africa";
>> I would want to print each of the characters of $foo on its own.
>>
>> In some languages string type is just array/list of characters. What is it
>> in Perl?
>>
>
> Hi Emeka
>
eka wrote:
>
>>
>> In some languages string type is just array/list of characters. What is it
>> in Perl?
>>
>>
> There's no string type in Perl, internals notwithstanding. There's scalars,
> and a scalar can hold a string - If you care to dig deeper, that
On Mon, Aug 1, 2011 at 9:14 AM, Emeka wrote:
>
> In some languages string type is just array/list of characters. What is it
> in Perl?
>
>
There's no string type in Perl, internals notwithstanding. There's scalars,
and a scalar can hold a string - If you care to dig deep
On 8/1/11 Mon Aug 1, 2011 11:20 AM, "Rob Dixon"
scribbled:
> On 01/08/2011 19:00, Dr.Ruud wrote:
>> On 2011-08-01 15:52, Shlomi Fish wrote:
>>
>>> To convert a string to characters one can use split based on the empty
>>> regex,
>>
>&
On 01/08/2011 19:00, Dr.Ruud wrote:
On 2011-08-01 15:52, Shlomi Fish wrote:
To convert a string to characters one can use split based on the empty
regex,
That should be "a pattern matching the empty string".
The "empty regex" works differently:
perl -wle '
my $
On 2011-08-01 15:52, Shlomi Fish wrote:
To convert a string to characters one can use split based on the empty regex,
That should be "a pattern matching the empty string".
The "empty regex" works differently:
perl -wle '
my $text = "abcdefghi";
$text
On 01/08/2011 13:14, Emeka wrote:
I would like to know how to access character from string lateral.
Say I have
$foo = "From Big Brother Africa";
I would want to print each of the characters of $foo on its own.
In some languages string type is just array/list of characters. What is
Shlomi,
Yea, that makes sense now.
Emeka
On Mon, Aug 1, 2011 at 2:52 PM, Shlomi Fish wrote:
> On Mon, 1 Aug 2011 13:49:22 +0100
> AKINLEYE wrote:
>
> > my @characters = split /[\s]/, $foo;
> > foreach my $letter(@characters )
> > {
> >print $letter
On Mon, 1 Aug 2011 13:49:22 +0100
AKINLEYE wrote:
> my @characters = split /[\s]/, $foo;
> foreach my $letter(@characters )
> {
>print $letter ;
>
> }
>
> or
>
> my @characters = split /[\s]/, $foo;
> print join("\n" , @characters);
>
That
om Big Brother Africa";
>> I would want to print each of the characters of $foo on its own.
>>
>> In some languages string type is just array/list of characters. What is it
>> in Perl?
>>
>
> A string.
>
> In Perl there are a few ways to do what you wa
Emeka wrote:
Hello All,
Hello,
I would like to know how to access character from string lateral.
Say I have
$foo = "From Big Brother Africa";
I would want to print each of the characters of $foo on its own.
In some languages string type is just array/list of characters. What is
my @characters = split /[\s]/, $foo;
foreach my $letter(@characters )
{
print $letter ;
}
or
my @characters = split /[\s]/, $foo;
print join("\n" , @characters);
Untested code though.
OP
Hello All,
I would like to know how to access character from string lat
On 11-08-01 08:14 AM, Emeka wrote:
Hello All,
I would like to know how to access character from string lateral.
Say I have
$foo = "From Big Brother Africa";
I would want to print each of the characters of $foo on its own.
In some languages string type is just array/list of charac
Hello All,
I would like to know how to access character from string lateral.
Say I have
$foo = "From Big Brother Africa";
I would want to print each of the characters of $foo on its own.
In some languages string type is just array/list of characters. What is it
in Perl?
Emeka
--
Irene Zweimueller wrote:
Dear list,
Hello,
I´m relatively new to Perl, so please be patient.
Welcome to Perl and the beginners list.
I tied to get rid of whitespace characters by the following programme:
my $i=" USEFUL ";
if ($i =~ /\s/)
On Tue, May 10, 2011 at 1:32 PM, Leo Susanto wrote:
> http://en.wikipedia.org/wiki/Trim_%28programming%29
>
> $string =~ s/^\s+|\s+$//g ; # remove both leading and trailing whitespace
>
1. don't do that. search on perlmonks and you'll find a long
discussion with benchmarks. that takes quite a
Zweimueller
wrote:
> Dear list,
>
> I´m relatively new to Perl, so please be patient.
>
> I tied to get rid of whitespace characters by the following programme:
>
> my $i=" USEFUL ";
>
>
> if ($i =~ /\s/)
> {
> $i =~ s/
On 11-05-10 01:25 PM, Irene Zweimueller wrote:
I tied to get rid of whitespace characters by the following programme:
my $i=" USEFUL ";
$i =~ s/\s//g;
The /g modifier means to repeatly look for the pattern.
See:
perldoc perlretut and search f
Dear list,
I´m relatively new to Perl, so please be patient.
I tied to get rid of whitespace characters by the following programme:
my $i="USEFUL ";
if ($i =~ /\s/)
{
$i =~ s/\s*//;
}
print "xx $i xx\n";
and it re
Hi eventual,
On Monday 25 Apr 2011 06:22:54 eventual wrote:
> Hi,
> I am using windows operating system.
> I wanted to rename some files within certain directories and my files
> contain chinese characters. After renaming, I could not see those chinese
> characters, what must I do
Tks Brian,
with the link you provide, I then change the control panel/regional and
language
settings/language for non-unicode programs to "chinese (simplified prc)" and
now
I can change files with chinese characters.
Thanks
From: Brian Fraser
To
Hi,
I am using windows operating system.
I wanted to rename some files within certain directories and my files contain
chinese characters. After renaming, I could not see those chinese characters,
what must I do to retain those chinese characters. Below is the file name and
the script. Thanks
> "Barry-Home" == Barry-Home writes:
Barry-Home> I am working on a script where I have strings that contain
an English string Barry-Home> followed by the Cyrillic translation.
"perldoc perluniintro" would be a good start, since you're gonna be
knee-deep in unicode issues. And if you have i
I don't really know the first thing about Cyrillic, so you'll probably have
to play around with this before making it work like you want it to. It makes
use of Unicode character properties, which you can start learning from
perluniprops[0]:
$text =~ s/[\p{Cyrillic}\p{Block: Cyrillic}\p{Block:
Cyri
Hi,
I am working on a script where I have strings that contain an English
string followed by the Cyrillic translation. For now, I am looking for a
way to strip out the Cyrillic characters and and leave the English ones.
I have tried a simple regular expression such as :
$text =~ s/Surname
Thanks for the reading suggestions!
Brian Fraser wrote:
On Wed, Mar 9, 2011 at 2:22 PM, Brian F. Yulga
mailto:byu...@langly.dyndns.org>> wrote:
Uri and Jim have hit upon one of my major stumbling blocks with
learning Perl. There seems to be a difference of opinion on the
proper ti
On Wed, Mar 9, 2011 at 2:22 PM, Brian F. Yulga wrote:
> Uri and Jim have hit upon one of my major stumbling blocks with learning
> Perl. There seems to be a difference of opinion on the proper times to use
> hashes vs. arrays/lists...and how best to use them.
http://perldoc.perl.org/perlfaq4.ht
Ben Lavery wrote:
> there must be a slight trade-off... the processing required to
> initialize the hash table with it's keys and values is probably
> more intensive than defining an array with its respective values?
> Unless, internally, Perl stores arrays as hashes, with the indexes
> as the ke
> there must be a slight trade-off... the processing required to initialize the
> hash table with it's keys and values is probably more intensive than defining
> an array with its respective values? Unless, internally, Perl stores arrays
> as hashes, with the indexes as the keys.
I would have
On 9 Mar 2011, at 03:01, Ben Lavery wrote:
> I shall change from a hash to an array and use grep, or looking into it I may
> use List::MoreUtils as it has a "first_value" sub which should make it
> somewhat more efficient.
OK, so about an hour after I wrote this I was on the train home thinking
Jim Gibson wrote:
On 3/9/11 Wed Mar 9, 2011 9:22 AM, "Brian F. Yulga"
scribbled:
>
> foreach ( @word_list ) { if ( /^$temp_word$/i ) { push(
> @all_combinations, ( $_ )); } }
That is pretty much what the grep function is doing. It has to
iterate over the entire array and evaluate its code
On 3/9/11 Wed Mar 9, 2011 9:22 AM, "Brian F. Yulga"
scribbled:
> Uri and Jim have hit upon one of my major stumbling blocks with learning
> Perl. There seems to be a difference of opinion on the proper times to
> use hashes vs. arrays/lists...and how best to use them. For those that
> have he
Uri Guttman wrote:
>> "BL" == Ben Lavery writes:
>
>
> BL> #Here, using a hash looks much cleaner than
iterating through an array
>
> hashes are almost always better for token lookups than scanning
> arrays. don't doubt yourself in this area.
>
>
Jim Gibson wrote:
> On 3/8/
Hi Jim, thanks for replying :)
>>
>> $word_list{$_} = 0;
>
> If you assign 1 to the hash value, you can dispense with the 'exists' in
> your test, below.
>> #Here, using a hash looks much cleaner than iterating through an array
>> push(@all_combinations, $temp_word) if (exists $word_list{$temp_w
#x27;exists' in
your test, below.
> }
> close(WORDFILE);
>
> #Set up letters
> my @letters = split(//, $ARGV[0]);
>
> #Used to hold all valid combinations of characters
> my @all_combinations;
>
> #Iterate through the letters
> #We then calculate all combinatio
> "BL" == Ben Lavery writes:
BL> use warnings;
BL> use strict;
good!
BL> use Math::Combinatorics;
BL> #Read list of valid words into hash
BL> my $WORDFILE='Words';
BL> open(WORDFILE, "$WORDFILE") or die "can't open $WORDFILE: $!";
BL> while () {
BL> chomp;
BL> $word_l
Hi Rob,
Thank you for your response, sorry it wasn't as clear as I thought it might
have been.
> I have a script, and I want to feed it a special thing to let it know that
> any character (A-Z or a-z does upper lower case matter?) is valid, but I
> also want to use other characte
Hi Ben,
Not sure I get your point... but this is what it sounds like to me.
I have a script, and I want to feed it a special thing to let it know that
any character (A-Z or a-z does upper lower case matter?) is valid, but I
also want to use other characters at the same time. So ./script.pl -s
Hi all,
I have a script which takes a string of alphabetic characters as an argument,
generates all combinations of the characters and all permutations of the
combinations, then looks up each result in a list of valid words, if the result
is a valid word it gets stored in an array.
I would
On 2011-03-06 17:22, Shlomit Afgin wrote:
I have a data that contain unseen characters that I want to delete.
The unseen characters can be ^L, ^N and other sign that I cannot copy but I
see them in my data.
Is someone know which regular can help me.
See perldoc perlre, specifically
On 06/03/2011 16:22, Shlomit Afgin wrote:
I have a data that contain unseen characters that I want to delete.
The unseen characters can be ^L, ^N and other sign that I cannot
copy but I see them in my data.
Is someone know which regular can help me.
Hi Shlomit.
It would be better to list
>
> I have a data that contain unseen characters that I want to delete.
> The unseen characters can be ^L, ^N and other sign that I cannot copy but I
> see them in my data.
>
> Is someone know which regular can help me.
May you try the "dos2unix" command?
Hi,
I have a data that contain unseen characters that I want to delete.
The unseen characters can be ^L, ^N and other sign that I cannot copy but I
see them in my data.
Is someone know which regular can help me.
Shlomit.
At 18:52 +0800 03/02/2011, Jeff Pang wrote:
2011/2/2 Shlomit Afgin :
> I tried to convert html special characters to their real character.
> For example, converting ” to " .
>
> I had the string
> $str = "“ test ” ÈÒÈÂÔ†¢ª
> The string contain
On 11-02-02 04:25 AM, Shlomit Afgin wrote:
I tried to convert html special characters to their real character.
For example, converting” to " .
I had the string
$str = "“ test” ניסיון ";
The string contain also Hebrew letters.
This seems to work:
#!/usr/bin/perl
1 - 100 of 717 matches
Mail list logo
