Re: Which branch of clojure-hadoop to use?
Hello I'm not working actively on clojure-hadoop, so maybe eslick's and clizzin's forks could be more advanced (although I hadn't looked onto changes). I think, that fragmentation of libraries is not so good thing, so I invite everybody who wants to participate in development to join mailing list https://groups.google.com/group/clojure-hadoop and I can give commit rights to repository Benny Tsai at "Fri, 4 Feb 2011 20:59:00 -0800 (PST)" wrote: BT> I have a bunch of older computers sitting at home, and thought I'd put BT> them to use for experimenting with clojure-hadoop and swarmiji. BT> However, I can't figure out which branch of clojure-hadoop to use. BT> Stuart Sierra's branch looks like the canonical one, but hasn't been BT> updated since March 2010. alexott's branch looks to be the most BT> frequently updated, but there are also more recent branches from BT> eslick and clizzin. If someone could shed light on this situation, BT> that'd be greatly appreciated! -- With best wishes, Alex Ott, MBA http://alexott.blogspot.com/http://alexott.net/ http://alexott-ru.blogspot.com/ Skype: alex.ott -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Time/size bounded cache?
A while back the discussion on the "bounded memoize" thread in this
forum lead to Meikel writing up a nice summary of how to do caching,
providing a pluggable strategy: lru, ttl, fifo, etc. Meikel's writeup
can be found at
http://kotka.de/blog/2010/03/memoize_done_right.html
It presents a bunch of different implementations, detailing whats good/
bad about each of them.
On Dec 31 2010, 3:35 am, Miki wrote:
> Hello,
>
> I'm wring a service that polls RSS feeds (using feedme). And I'd like to act
> only on the new entries in each feed.
> So far I have something like:
>
> (defn get-new-entries [seen]
> (let [seen? (complement seen)]
> (filter #(seen? (:id %)) (get-entries
>
> (defn poll [sleep-time]
> (loop [seen #{}]
> (let [entries (get-new-entries seen)]
> (doall (map process-entry entries))
> (println "")
> (Thread/sleep sleep-time)
> (recur (union seen (set (map :id entries)))
>
> (Full demo code athttps://gist.github.com/760094)
>
> The problem is that "seen" will grow without bounds.
> Is there a built in way to have some sort of LRU cache or should I use
> external libraries (like plru)?
>
> Thanks,
> --
> Miki
--
You received this message because you are subscribed to the Google
Groups "Clojure" group.
To post to this group, send email to clojure@googlegroups.com
Note that posts from new members are moderated - please be patient with your
first post.
To unsubscribe from this group, send email to
clojure+unsubscr...@googlegroups.com
For more options, visit this group at
http://groups.google.com/group/clojure?hl=en
Re: Time/size bounded cache?
And if you don't have time to read the whole blog post - it's very
detailed - and just read code, you could scroll down to cgrand's
memoize8 function at https://gist.github.com/330644
On Feb 6, 8:32 pm, Eugen Dück wrote:
> A while back the discussion on the "bounded memoize" thread in this
> forum lead to Meikel writing up a nice summary of how to do caching,
> providing a pluggable strategy: lru, ttl, fifo, etc. Meikel's writeup
> can be found athttp://kotka.de/blog/2010/03/memoize_done_right.html
>
> It presents a bunch of different implementations, detailing whats good/
> bad about each of them.
>
> On Dec 31 2010, 3:35 am, Miki wrote:
>
> > Hello,
>
> > I'm wring a service that polls RSS feeds (using feedme). And I'd like to act
> > only on the new entries in each feed.
> > So far I have something like:
>
> > (defn get-new-entries [seen]
> > (let [seen? (complement seen)]
> > (filter #(seen? (:id %)) (get-entries
>
> > (defn poll [sleep-time]
> > (loop [seen #{}]
> > (let [entries (get-new-entries seen)]
> > (doall (map process-entry entries))
> > (println "")
> > (Thread/sleep sleep-time)
> > (recur (union seen (set (map :id entries)))
>
> > (Full demo code athttps://gist.github.com/760094)
>
> > The problem is that "seen" will grow without bounds.
> > Is there a built in way to have some sort of LRU cache or should I use
> > external libraries (like plru)?
>
> > Thanks,
> > --
> > Miki
--
You received this message because you are subscribed to the Google
Groups "Clojure" group.
To post to this group, send email to clojure@googlegroups.com
Note that posts from new members are moderated - please be patient with your
first post.
To unsubscribe from this group, send email to
clojure+unsubscr...@googlegroups.com
For more options, visit this group at
http://groups.google.com/group/clojure?hl=en
Re: Time/size bounded cache?
On Feb 6, 12:32 pm, Eugen Dück wrote: > A while back the discussion on the "bounded memoize" thread in this > forum lead to Meikel writing up a nice summary of how to do caching, > providing a pluggable strategy: lru, ttl, fifo, etc. Meikel's writeup > can be found athttp://kotka.de/blog/2010/03/memoize_done_right.html > > It presents a bunch of different implementations, detailing whats good/ > bad about each of them. If you need to move function calls out of the cache there is cache-dot- clj which consists of minor changes to "memoize done right": https://github.com/alienscience/cache-dot-clj Saul -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
Hi Eugen, 2011/2/6 Eugen Dück : > scan -> email would be more convenient for me. > > @Chistopher >> people keep citing it as some unique requirement foisted upon the community >> by a power hungry dictator > > That's a generalization that lacks any relation to this thread, and I > guess even the clojure community in general. I'm not aware of any > criticism of our beloved dictator and I hope he'll serve many more > terms. As long as he doesn't torture his people (like force them into > signing CAs ;) > > Back to the git pull request question - nobody seems to know anything > about it, but that issue should not be related to legal issues, if > clojure maintainers pull only stuff from CA signers, right? Maybe there's a problem with this "pull request", in that the act of bringing the code into the open source project is then done by the maintainer itself. The guarantees of pulling the exact changest the pull requester wanted to be incorporated are less clear than if the contributor explicitly sends the bits he wants to contribute. But maybe I'm wrong. Cheers, -- Laurent -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
> Back to the git pull request question - nobody seems to know anything > about it, but that issue should not be related to legal issues, if > clojure maintainers pull only stuff from CA signers, right? Be careful about applying the word "should" to legal issues. I'm inclined to just trust Rich and Clojure/core regarding what is legally acceptable until I've done a similar amount of legal research myself (which will probably never happen). Also, anyone who wants to improve the patch process should first have enough experience with it to understand what, if anything, is wrong with it. If the patch process were a significant inconvenience, I would expect to see the issue raised on the clojure-dev mailing list by people who have actually been through that process. Instead, it seems that the issue is raised only by people who haven't actually tried it. As for the need to physically mail a CA... I wish to contribute to Clojure, and I was willing to spend a lot more than two hours on making it happen (related to my employer's intellectual property policy). I can certainly understand if some potential contributors aren't willing to spend two hours hiking in the snow, after waiting for good weather of course. On the other hand, it seems like much more time than that is spent discussing this issue on a mailing list. Why not just send the letter and get it over with? -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: overriding seq in defrecord
The problem is that defrecord explicitly defines the interface you are
trying to implement, so you are effectively attempting to declare the
interface twice. And since clojure.lang.seqable isnt a protocol, you
cant redefine it with extend. So, you will have to rewrite the
defrecord macro or similar that implements what defrecord does, except
it will actually look at your interfaces to see if you are attempting
to implement the same one, and then use the users interface if so.
Heres an example of a custom deftype i wrote which basically
reimplements defrecord + some more. It is an 'AtomHash', which means
it acts like a hash map (i.e. like a record),
but instead of accessing the record slots directly, it accesses an
atom, which itself contains the map. I never figured out how to make
(merge (atom-hash {:a 2}) {:a 4}) return an atom-hash, but oh well.
Actually, i think the new clojure 1.3 has internal protocols for
merge. Anyways, from this, you can build a macro which replaces user
defined sequences with any defaults. Or you could just use it as a
template.
(deftype AtomHash [val]
Object
(toString [this] (str ""))
clojure.lang.IPersistentMap
clojure.lang.ILookup
(valAt [this key] (get @val key))
(valAt [this key notfound] (get @val key notfound))
clojure.lang.IPersistentCollection
(count [this] (.count @val))
(empty [this] {})
(cons [this e] (.cons @val e))
(equiv [this gs] (or (identical? this gs)
(when (identical? (class this) (class gs))
(= val (.val gs)
clojure.lang.Associative
(containsKey [this k] (or (and (get @val k) true) false))
(entryAt [this k] (get @val k))
clojure.lang.Seqable
(seq [this] (seq @val))
clojure.lang.IPersistentMap
(assoc [this k g] (assoc @val k g))
(assocEx [this k g] (assoc this k g))
(without [this k] (.without @val k))
clojure.lang.IDeref
(deref [this] @val))
;;REPLACE namespace with implementation namespace
(defmethod print-dup AtomHash [o w]
(.write w "#=(util/atom-hash ") (print-dup @o w) (.write w ")"))
(defmethod clojure.core/print-method AtomHash [o w]
(.write w (.toString o)))
(defn atom-hash
([] (atom-hash {}))
([a] {:pre [(map? a)]} (AtomHash. (atom a
;;examples
(let [{:keys [a b]} (atom-hash {:a 2})] (list a b))
--
You received this message because you are subscribed to the Google
Groups "Clojure" group.
To post to this group, send email to clojure@googlegroups.com
Note that posts from new members are moderated - please be patient with your
first post.
To unsubscribe from this group, send email to
clojure+unsubscr...@googlegroups.com
For more options, visit this group at
http://groups.google.com/group/clojure?hl=en
Re: overriding seq in defrecord
I also found it useful to define my own clojure.core. This is because i wanted swap! and reset! to work on my AtomHash. So i did something like this, using clj-nstools. http://code.google.com/p/clj-nstools/ ns+ is sort of slow for large projects, but im sure that can be improved. (ns clj.core (:refer-clojure :exclude [swap! reset!]) (:import clojure.lang.APersistentMap java.io.Writer)) (defmulti swap! (fn [a & args] (class a))) (defmethod swap! clojure.lang.Atom [& args] (apply clojure.core/swap! args)) (defmulti reset! (fn [a & args] (class a))) (defmethod reset! clojure.lang.Atom [& args] (apply clojure.core/reset! args)) and then, using ns+ for another ns, we can do at the top of our file (clojure.core/use 'nstools.ns) (ns+ my.ns (:clone clj.core) anything else here ) Too bad something like ns+ isnt included in clojure core, its quite useful -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Time/size bounded cache?
do you really need that? How about an infinite lazy sequence? (defn infinite [arg] (lazy-seq (Thread/sleep 2000) ;;simulate 2 second retrieval time (concat (for [i (range 0 arg)] i) (infinite arg (def a (infinite 3)) (first a) ;;=> sleep 2 seconds, return 0 (take 3 (filter #(= % 2) a)) ;;wait a bit and return 3 twos (loop [i 0 a (infinite 3)] ;;wait a bit, process 3 twos, and return "done" (cond (= i 3) "done" (= (first a) 2) (recur (+ i 1) (rest a)) true (recur i (rest a -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
> Not every potential contributor lives in downtown > Megalopolis, Coastal State, USA. Agreed, but you must see that your particular case lays at the extreme. I'm of the opinion that if someone is inclined to contribute, then they will not be deterred by the cost of a postage stamp -- par avion or not. -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Importing defprotocol and deftype
Forgive me if I'm misunderstanding, but you don't need to import a protocol to use it. If you need to actually get ahold of the protocol (say, to implement another deftype/defrecord), you can just use `require` or `use` to get ahold of it: (ns stuff (:use [com.example-ns :only [IFoo]) (:import [com.example-ns Foo])) Then inside that ns, you can just refer to IFoo and Foo. I'm surprised that the underscored version of the import works for a protocol - I've never seen anyone use that before. I wonder if it's just an oversight on my part or if that's a non-recommended use of import... Micah Martin just showed me a behavior very similar to this recently, and since then I'd been thinking of protocols more like normal Clojure data structures, and deftypes/defrecords more like Java classes. Confirming that, if I look at the type of IFoo, it is a clojure.lang.PersistentArrayMap, and Foo is a java.lang.class. Colin On Feb 5, 1:20 pm, Shantanu Kumar wrote: > When I declare using defprotocol: > > (defprotocol IFoo > (bar [this] "some doc")) > > and then using deftype: > > (deftype Foo > IFoo > (bar [this] "from Foo::bar")) > > I noticed there is an interesting difference in the way I need to > import them in another namespace: > > (:import > (com.example_ns IFoo) ; importing Foo here gives error (notice > underscore) > (com.example-ns Foo)) ; importing IFoo here gives error (notice > dash) > > Can somebody explain the rationale behind this? The dash character is > not valid inside a Java package names so a protocol not supporting it > is understandable. But when I deftype something, is it not supposed to > be consumed from within Java-the-language? > > Shantanu -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
On Sun, Feb 6, 2011 at 3:55 PM, Fogus wrote: >> Not every potential contributor lives in downtown >> Megalopolis, Coastal State, USA. > > Agreed, but you must see that your particular case lays at the > extreme. Does it really? 20% of the population of the US still lives outside of major cities. That's not a majority but it's hardly an "extreme" minority either. > I'm of the opinion that if someone is inclined to contribute, then > they will not be deterred by the cost of a postage stamp -- par avion > or not. I mentioned other inconveniences than the cost of a postage stamp. -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Time/size bounded cache?
> A while back the discussion on the "bounded memoize" A truly classic thread, immortalized in JoC and at https://github.com/fogus/anamnesis :-) -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
> Does it really? 20% of the population of the US > still lives outside of major cities. That's > not a majority but it's hardly an "extreme" > minority either. I'm sorry, I was referring more to your description of a treacherous hike through a vast winter wonderland; not of the hordes of potential Clojure contributors living in the Appalachian mountains. -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
> Same here. In my case, snail-mail would mean a 2.5km hike through a > freezing winter wonderland to the nearest mailbox that's used to send > rather than being receive-only. So, 5 km there and back. It could > easily take over two hours and might even be dangerous depending on > the weather. This may be a solution. (Found via web search - I've never actually used it.) http://www.postful.com/ For $1, they will convert an email or PDF into an old fashioned letter and put it in the mail for you. If you try this service, I'm interested in hearing how well it works. -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
On Sun, Feb 6, 2011 at 4:44 PM, Eric Lavigne wrote: >> Same here. In my case, snail-mail would mean a 2.5km hike through a >> freezing winter wonderland to the nearest mailbox that's used to send >> rather than being receive-only. So, 5 km there and back. It could >> easily take over two hours and might even be dangerous depending on >> the weather. > > This may be a solution. (Found via web search - I've never actually used it.) > > http://www.postful.com/ > > For $1, they will convert an email or PDF into an old fashioned letter > and put it in the mail for you. > > If you try this service, I'm interested in hearing how well it works. If a snail-mail generated that way would be acceptable for submitting a CA, I can't fathom why a fax or an e-mail direct to Hickey (bearing a scanned signed written document) wouldn't also qualify. -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Any news on pull requests?
On Sat, 5 Feb 2011 20:42:54 -0500 Christopher Petrilli wrote: > On Sat, Feb 5, 2011 at 1:23 PM, Mike Meyer > wrote: > > On Sat, 5 Feb 2011 00:09:41 -0500 > > Christopher Petrilli wrote: > >> For example, the following projects REQUIRE contributor agreements, in > >> writing, signed and either scanned or on paper, prior to accepting any > >> patches or commits: > >> > >> - Free Software Foundation > >> - Apache, and everything under it > >> - Python > > I'm sorry, I'm going to call foul on this. I've contributed to Python > > without ever signing a CA. And the current developers guide page > > doesn't have anything on it about needing to sign a CA. > I do not know when you contributed, or whether it was before this > period, but from Certainly possible. My largest contributions were docs, which don't ship with Python and would be excluded. > http://wiki.python.org/moin/PythonSoftwareFoundationLicenseFaq: > > > If your code is going to end up in Python or the standard library, the PSF > > will require you to: > > * License your code under an acceptable open source license. These > > currently include only the Academic Free License and the Apache License > > 2.0, although this list may be expanded in the future. (No, the PSF License > > is not acceptable; see below) > > * Fill out and submit a contributor agreement. > > Perhaps they exclude some small amount of code in the form of patches, > but it certainly applies to libraries, etc. You can find the > contributor agreement here: > http://www.python.org/psf/contrib-form.html It's not that different > than the one for Clojure. Again, I'm not arguing whether it's a "good > thing" or not, simply that it's actually not as unheard of as people > think, nor is it poorly founded in US legal precedent. I find it odd that they don't mention this on the Developers Guide at http://www.python.org/dev/ or the developers FAQ at http://www.python.org/dev/faq/. Possibly this is a reflection of reality, in that most contributions will be small patches or docs that don't ship, and they don't enforce it until they want to include a library. Or maybe this was planned but never actually happened. I know that it's never been talked about on any of the Python lists I've hung out on. > > Seriously, the "snail-mail" requirement is the only one that's really > > objectionable. Most places are quite happy with a scanned image of the > > signed document (i.e. - the Chickasaw nation for my citizenship > > papers). > Then perhaps someone can offer to Rich to accept the scanned copies > and deal with them? One of the "joys" of an open source project is not > just contributing code, but helping out with the administrative > overhead of running a project. Exactly what has to happen to a PDF that was emailed to whoever would have gotten the snail-mail copy, beyond printing and then treating like the snail-mail'ed one? http://www.mired.org/consulting.html Independent Network/Unix/Perforce consultant, email for more information. O< ascii ribbon campaign - stop html mail - www.asciiribbon.org -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: ANN: Textmash - another IDE for Clojure
Hi Olek, I haven't found time to work more on it lately, but checked the current status of the codebase today. It appears that all new work is going into Textmash2, a rewrite in Clojure, if I understand it correctly ? I have some questions: * Is your intent to replace eventually the java version with the clojure version ? If so, how do you deal with the concern of "quick startup time" ? * If I find time to try to add paredit.clj support for it, is it worth continuing what I've started on the java branch, or should I hack on the clojure branch ? Cheers, -- Laurent 2011/1/23 Olek : > Yes, make a branch. > I seen many people are using "leiningened", so it is a good (main > stream) choice, especially that your parts of code are written in > Clojure. > > The layout of menus is made in pl/olek/textmash/menu/ > WorkspaceMenu.java. > > I have also started TextMash2 which is going to be entirely written in > Clojure, it is going to be written - 20 minutes a day, mainly in > fundamental (proof of concept) parts so It will be easier to other to > add/fullfill project with new features. > > > On 23 Sty, 20:49, Laurent PETIT wrote: >> 2011/1/23 Olek >> >> > I have added you to committers group, so you can commit your work. >> > Later I will switch to github since SVN with its "central repository" >> > scenario is not very useful in situation where I'm lack of time. >> >> OK, thanks. >> >> What I've achieved is more a "proof of concept" right now. Maybe I should >> put it in a branch. >> I'll quickly describe what I'm talking about, so you can choose: >> >> * I've "leiningened" the project. Maybe I could "mavenize" it instead. >> What are your guts here ? >> * I've "leiningened" it to test the "mavenization", on my side, of >> paredit.clj. >> * paredit.clj uses clojure and clojure contrib. So the feature currently >> shows a delay when it is first invoked. Since the point of my demo was not >> clojure integration but paredit.clj integration, I've not tried to make this >> happen in the background, etc. To the contrary, I've tried to compact the >> "proof of concept" code as much as possible in one place, so it can be >> easily spotted and reviewed. >> * Currently, I've just demonstrated the "raise over sexpr" command I >> described in an earlier post in this same thread. >> >> What I've not been able to achieve (but I admit I haven't spent too much >> time right now on it) is how to make the command appear in the menu. I >> thought at first that it was derived from the "actions" map in the >> TextEditor class, but the layout of the menus must live somewhere else ... >> If you can help me spot the right place ? >> >> I also still have to finish proper bundling of paredit.clj in the first >> place, half done and should not last 'til the end of this week. >> >> Cheers, >> >> -- >> Laurent >> >> >> > > -- > You received this message because you are subscribed to the Google > Groups "Clojure" group. > To post to this group, send email to clojure@googlegroups.com > Note that posts from new members are moderated - please be patient with your > first post. > To unsubscribe from this group, send email to > clojure+unsubscr...@googlegroups.com > For more options, visit this group at > http://groups.google.com/group/clojure?hl=en -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: Time/size bounded cache?
On Feb 6, 2:08 pm, Seth wrote:
> (filter #(= % 2) a)
Another way:
(filter #{2} a)
--
You received this message because you are subscribed to the Google
Groups "Clojure" group.
To post to this group, send email to clojure@googlegroups.com
Note that posts from new members are moderated - please be patient with your
first post.
To unsubscribe from this group, send email to
clojure+unsubscr...@googlegroups.com
For more options, visit this group at
http://groups.google.com/group/clojure?hl=en
Re: Anyone want to take a crack at making the fasta shootout program faster?
On Feb 3, 12:22 am, Andy Fingerhut wrote: > I've done a pass through most of the Clojure programs on the shootout > web site recently, making some of them faster, and choosing -Xmx > command line arguments when running them to keep the memory usage down > to a reasonable level -- not always the smallest heap size that works, > mind you -- just one that avoids exorbitantly large memory usage. > > http://shootout.alioth.debian.org > > The Clojure program for the "fasta" problem, with source code, AOT > compilation command, and execution command given on this web page: > > http://shootout.alioth.debian.org/u32/program.php?test=fasta&lang=clo... > > still takes about 6x to 8x more time than the best Java 6 -server > program here, depending upon which of the four machines it is run on: > > http://shootout.alioth.debian.org/u32/program.php?test=fasta&lang=jav... > > I'm sure the Clojure program can be made faster, e.g. by doing fewer > calls to write to the output file, with more bytes per call. Most of > the time seems to be file writing and generating random numbers in gen- > random!, at least on my systems where I've done testing and > profiling. I'm also seeing a fair amount of time spent in calls to > java.lang.Double.valueOf, according to the built-in profiler that > comes with the Hotspot JVM. > > Note: The web site is Clojure 1.2 only right now, so don't expect a > tweaked-out program using things that only work in Clojure 1.3 to work > there yet. This program is considerably faster on my computer: (set! *warn-on-reflection* true) (def *width* 60) (def *lookup-size* 222000) (def *alu* (str "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" "CCAGCCTGGCCAACATGGTGAAAGTCTCTACTAT" "ACATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" "AGCCTGGGCGACAGAGCGAGACTCCGTCTCA")) (def *codes* "acgtBDHKMNRSVWY") (def *iub* [0.27 0.12 0.12 0.27 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02]) (def *homosapiens* [0.3029549426680 0.1979883004921 0.1975473066391 0.3015094502008]) (defn find-index [f coll] (first (keep-indexed #(if (f %2) %1) coll))) (def random-seed (int-array [42])) (let [ IM (int 139968) IA (int 3877) IC (int 29573) scale (double (/ *lookup-size* IM)) ] (defn gen-random-fast [] (let [ new-seed (unchecked-remainder (unchecked-add (unchecked- multiply (aget (ints random-seed) 0) IA) IC) IM) ] (aset (ints random-seed) 0 new-seed) (int (* new-seed scale) ;; Takes a vector of probabilities. (defn make-cumulative [v] (vec (map #(reduce + (subvec v 0 %)) (range 1 (inc (count v)) ;; Takes a vector of cumulative probabilities. (defn make-lookup-table [v] (let [ lookup-scale (- *lookup-size* 0.0001) tmp (map (fn [n] (find-index #(<= (/ n lookup-scale) %) v)) (range *lookup-size*)) ] (int-array tmp))) (defn cycle-bytes [source source-size n ^java.io.BufferedOutputStream ostream] (let [ source-size (int source-size) width (int *width*) width+1 (int (inc width)) buffer-size (int (* width+1 4096)) buffer (byte-array buffer-size (byte 10)) next-i (fn[i] (unchecked-remainder (unchecked-add (int i) width) source- size)) next-j (fn[j] (let [j (+ j width+1)] (if (= j buffer-size) (do (.write ostream buffer) 0) j))) ] (loop [i (int 0) j (int 0) n (int n)] (System/arraycopy source i buffer j width) (if (> n width) (recur (int (next-i i)) (int (next-j j)) (- n width)) (do (aset buffer (+ j n) (byte 10)) (.write ostream buffer 0 (+ j n 1))) (defn fasta-repeat [n ^java.io.BufferedOutputStream ostream] (let [ source (.getBytes (str *alu* *alu*)) ] (cycle-bytes source (count *alu*) n ostream))) (defn fasta-random [probs n ^java.io.BufferedOutputStream ostream] (let [ codes (.getBytes (str *codes*)) lookup-table (ints (make-lookup-table (make-cumulative probs))) width (int *width*) buffer (byte-array 222000) seeds (int-array 222000) first-seed (aget (ints random-seed) 0) ] (loop [i (int 0)] (aset seeds i (aget (ints random-seed) 0)) (aset buffer i (aget codes (aget lookup-table (gen-random-fast (if (= (aget (ints random-seed) 0) first-seed) (do (System/arraycopy buffer 0 buffer (inc i) *width*) (cycle-bytes buffer (inc i) n ostream) (aset (ints random-seed) 0 (aget seeds (mod n (inc i) (recur (unchecked-inc i)) (defn write-line [s
Re: Any news on pull requests?
>> For $1, they will convert an email or PDF into an old fashioned letter >> and put it in the mail for you. >> > If a snail-mail generated that way would be acceptable for submitting > a CA, I can't fathom why a fax or an e-mail direct to Hickey (bearing > a scanned signed written document) wouldn't also qualify. That's a good point. I don't know where the line is on this issue. -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
Re: ANN: Textmash - another IDE for Clojure
> * Is your intent to replace eventually the java version with the > clojure version ? If so, how do you deal with the concern of "quick > startup time" ? An idea: jEdit optionally lets you start a background server during system startup so that firing up jEdit can be fast later. Maybe something similar can help? Regards, Shantanu -- You received this message because you are subscribed to the Google Groups "Clojure" group. To post to this group, send email to clojure@googlegroups.com Note that posts from new members are moderated - please be patient with your first post. To unsubscribe from this group, send email to clojure+unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/clojure?hl=en
