I have long run into this problem with various versions of lyx, up to 1.2.0. I am writing a scientific paper which includes sequence data on DNA oligonucleotides of the form: 5'-ACCGATAACAACCCCGAC....-3' with variable lengths from 60 to 80 characters. Upon either previewing the text or printing, invariably lyx improperly formats these sequences such that they blow right past the right page margin. It appears that lyx is unable to properly apply margin settings appropriately to such text.
Attached is a short segment of the offending lyx document. If you preview it or print it out, the oligos will be misformatted with hyphens placed haphazardly before a newline. I have tried inserting hard breaks in the oligos but this is really suboptimal as I usually end up having to make other document adjustments to margins, etc, or add text as I edit or re-edit and this, of course, screws up the formatting all over again. Why does lyx have such a problem with placing a hyphen at the proper page margin? Is there a way to fix this? praedor
#LyX 1.1 created this file. For more info see http://www.lyx.org/ \lyxformat 218 \textclass article \language english \inputencoding auto \fontscheme default \graphics default \paperfontsize default \spacing single \papersize Default \paperpackage a4 \use_geometry 0 \use_amsmath 0 \paperorientation portrait \secnumdepth 3 \tocdepth 3 \paragraph_separation indent \defskip medskip \quotes_language english \quotes_times 2 \papercolumns 1 \papersides 1 \paperpagestyle default \layout Standard Mutagenesis reactions. The mutagenesis protocol and solutions derive from the Bio-Rad Muta-Gene Mutagenesis Kit, version 2. Six mutants were generated containing \begin_inset Quotes sld \end_inset silent \begin_inset Quotes srd \end_inset base substitutions that reduced the local A-bias in a short segment of pol without altering the amino acid sequence using the following, partially overlapping 5' phosphorylated oligos (numbers in parentheses indicate 5' coordinate): H2 (2712) 5'-CCATACAACACCCCCGTGTTCGCCATCAAGAAGAAGGACAGTACCAAATGGAG -3', H3 (2748) 5'-GACAGTACCAAGTGGCGCAAGCTGGTGGACTTCAGGAGCTGAACAAGAGGACCCACTGG-3' , H4 (2808) 5'-TGGGAAGTGCAGCTGGGCATCCCCCACCCCGCCGGGTTAAAGCAGAAGAAGTCCGTAACAGTACT G-3', H5 (2865) 5'-GTAACAGTGCTGGATGTGGGCGATGCCTACTTCTCCGTGCCCCTGGATAAAGAC-3', H6 (2922) 5'-AGGAAGTACACCGCCTTCACCATCCCCAGTATCAACAACGAGACCCCAGGG-3', and H7 (2967) 5'-CCAGGGATCCGCTACCAAGGGCTCCCCCGCAATATTC-3'. Mutagene kit annealing buffer was added to 0.6 pmol ssDNA template to a final volume of 10 ul. Reactions were heated in a heating block to 94 \begin_inset Formula \( ^{\circ } \) \end_inset and then cooled at a rate of 2 degrees/minute until 40 \begin_inset Formula \( ^{\circ } \) \end_inset was reached, then they were \the_end
