On Fri, Jun 18, 2021 at 01:45:13AM +0530, Nilesh Patra wrote:
> > 
> >   $ efetch -db nuccore -id CP014688.1 -format fasta | head -n175
> >   >CP014688.1 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, 
> > complete sequence
> >   ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC
> >   [...]
> > 
> > or, with a slightly different defline, ncbi-tools-bin:
> > 
> >   $ idfetch -t5 -s 'gb|CP014688.1' | head -n175
> >   >gi|1149544201|gb|CP014688.1| Acetobacter persici strain TMW2.1084
> >   ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC
> >   [...]
> 
> I didn't know about this, thank you tons for the help! :-)
> Just added in a script for getting data

I wonder whether we should put that hint somewhere prominently since it
will be helpful also in other packages, thought.  May be we should write
some kind of autopkgtest howto?
 
Thanks a lot

      Andreas.


-- 
http://fam-tille.de

Reply via email to