On Feb 7, 2011, at 12:37 PM, Bill James wrote:

Since this program eliminates so much of the work, it's disappointing
that
there wasn't more of a speedup.

Can you (or anyone) speed it up even further?


I spent some time doing some small tweaks.

On one machine I have, your version runs in as little as 4.43 sec of user + system CPU time (minimum time over about half a dozen separate runs).

My tweaked version below runs in as little as 2.55 sec.

An AOT compiled "Hello, world!" program in Clojure on this same machine takes 1.37 sec. (Clojure 1.2.0 for all of these results).

There might be something still left to shave off, but not a lot.

Thanks,
Andy


(ns fasta
  (:gen-class))

(set! *warn-on-reflection* true)


(def *width* 60)
(def *lookup-size* 222000)


(def *alu* (str "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
                "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
                "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
                "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
                "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
                "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
                "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"))

(def *codes* "acgtBDHKMNRSVWY")

(def *iub* [0.27 0.12 0.12 0.27 0.02 0.02 0.02 0.02
           0.02 0.02 0.02 0.02 0.02 0.02 0.02])

(def *homosapiens* [0.3029549426680 0.1979883004921
                   0.1975473066391 0.3015094502008])


(defn find-index [f coll]
  (loop [i (int 0)
         s (seq coll)]
    (if (f (first s))
      i
      (recur (unchecked-inc i) (rest s)))))


(def random-seed (int-array [42]))
(let [IM (int 139968)
      IA (int 3877)
      IC (int 29573)
      scale (double (/ *lookup-size* IM))]
  (defn gen-random-fast []
    (let [new-seed (unchecked-remainder
                    (unchecked-add (unchecked-multiply
(aget (ints random-seed) 0) IA) IC) IM)]
      (aset (ints random-seed) 0 new-seed)
      (int (* new-seed scale)))))


;; Takes a vector of probabilities.
(defn make-cumulative [v]
  (vec (map #(reduce + (subvec v 0 %)) (range 1 (inc (count v))))))


;; Takes a vector of cumulative probabilities.
(defn make-lookup-table [v]
  (let [sz (int *lookup-size*)
        lookup-scale (- sz 0.0001)
        ^ints a (int-array sz)]
    (dotimes [i sz]
      (aset a i (int (find-index #(<= (/ i lookup-scale) %) v))))
    a))


(defn cycle-bytes [source source-size n
                   ^java.io.BufferedOutputStream ostream]
  (let [source-size (int source-size)
        width (int *width*)
        width+1 (int (inc width))
        buffer-size (int (* width+1 4096))
        buffer (byte-array buffer-size (byte 10))]
    (loop [i (int 0)
           j (int 0)
           n (int n)]
      (System/arraycopy source i buffer j width)
      (if (> n width)
        (recur (int (unchecked-remainder
                     (unchecked-add i width) source-size))
               (int (let [j (unchecked-add j width+1)]
                      (if (== j buffer-size)
                        (do (.write ostream buffer) (int 0))
                        j)))
               (unchecked-subtract n width))
        (do
          (aset buffer (+ j n) (byte 10))
          (.write ostream buffer (int 0) (+ j n 1)))))))


(defn fasta-repeat [n ^java.io.BufferedOutputStream ostream]
  (let [source (.getBytes (str *alu* *alu*))]
    (cycle-bytes source (count *alu*) n ostream)))


(defn fasta-random [probs n ^java.io.BufferedOutputStream ostream]
  (let [codes (.getBytes (str *codes*))
        lookup-table (ints (make-lookup-table
                            (make-cumulative probs)))
        width (int *width*)
        buffer (byte-array 222000)
        seeds  (int-array  222000)
        first-seed (aget (ints random-seed) 0)]
    (loop [i (int 0)]
      (aset seeds i (aget (ints random-seed) 0))
      (aset buffer i
            (aget codes
                  (aget lookup-table
                        (gen-random-fast))))
      (if (== (aget (ints random-seed) 0) first-seed)
        (do
          (System/arraycopy  buffer 0  buffer (inc i)  *width*)
          (cycle-bytes buffer (inc i) n ostream)
          (aset (ints random-seed) 0 (aget seeds (mod n (inc i)))))
        (recur (unchecked-inc i))))))


(defn write-line [s ^java.io.BufferedOutputStream stream]
  (.write stream (.getBytes (str s "\n"))))


(defn -main [& args]
  (let [n (Integer/parseInt (nth args 0))
        ostream (java.io.BufferedOutputStream. System/out)
        start-time (System/currentTimeMillis)]
    (write-line ">ONE Homo sapiens alu" ostream)
    (fasta-repeat (* n 2) ostream)
    (write-line ">TWO IUB ambiguity codes" ostream)
    (fasta-random *iub* (* n 3) ostream)
    (write-line ">THREE Homo sapiens frequency" ostream)
    (fasta-random *homosapiens* (* n 5) ostream)
    (.flush ostream)))

--
You received this message because you are subscribed to the Google
Groups "Clojure" group.
To post to this group, send email to clojure@googlegroups.com
Note that posts from new members are moderated - please be patient with your 
first post.
To unsubscribe from this group, send email to
clojure+unsubscr...@googlegroups.com
For more options, visit this group at
http://groups.google.com/group/clojure?hl=en

Reply via email to