Hi everyone, I wanted to revive this discussion with a fresh paper from Cell journal: https://www.cell.com/cell/fulltext/S0092-8674(20)31623-8 So one could use a smartphone camera for SARS-CoV-2 detection but you still need some extra tools, like 488 nm laser.
пт, 10 апр. 2020 г. в 20:14, James Holton <jmhol...@lbl.gov>: > > It looks to me that in this norovirus test the phone is acting as nothing > more than a camara attached to a conventional microscope. Light source is > 3rd party, and the microscope body is 3D printed. 3D printing is cool and > all, but it does not scale well. Antibodies are also expensive to make. > You will go through a lot of rabbits to make the 1 kg needed for a billion > tests. This isn't quite the price point I had in mind. > > I agree that agglomeration of fluorescent beads is very sensitive. > However, my experience with beads and other small objects is that they love > to stick together for all kinds of reasons. And once they do it is hard to > get them to separate. Assaying for virus particles in otherwise pure water > is one thing, it is quite another when there is other stuff around. > > Personally, I've tried several different phone-based microscopes and the > hardest thing about them is aligning the camera. I'm a beamline scientist, > so aligning things is second nature, but your average person might have a > hard time. The most annoying part is if you bump it you have to start > over. Image quality is also never all that great, I expect because the > optics of a smartphone camera are wide-angle, and you are fighting against > that. Eventually I bought a self-contained wifi microscope for $50, and > that works MUCH better. In fact, I'd say its competitive with the $5k > microscope we use to look at crystals. However, $50 is a lot in the third > world. I've heard that drugs that cost more than $1/pill are essentially > unobtainable in many countries. > > I'm still thinking that using the camera as nothing more than a big > photodiode is the right way to go. By positioning the sample right in front > of the camera lens you will get maximum light-collection efficiency. In > fact, one might be able to get excellent time resolution out of the > rolling-shutter mode. That is, unlike the CCD or PAD detectors we are used > to these CMOS sensors read out one row of pixels while the others are still > exposing. This means that the whole image is acutally one big time series > with individual pixels only a few nanoseconds apart. It should be possible > to differentiate the light from a long-lived fluorophore from background. > However, I don't think anyone has tried that yet. > > -James Holton > MAD Scientist > > > On 4/4/2020 5:48 PM, Jurgen Bosch wrote: > > Here’s another link I found that should make this project feasible: > > https://physicsworld.com/a/smartphone-based-device-detects-norovirus/ > > Jürgen > > On Apr 2, 2020, at 3:52 PM, Patrick Shaw Stewart <patr...@douglas.co.uk> > wrote: > > Jurgen, that *was *interesting. (Strange how your hair came and went > during the talk, leaving you bald sometimes - but of course that didn't > matter ! ;) > > Did you know that coronavirus was first isolated at 33C and that this > temperature may be required for isolation? > https://www.bmj.com/content/3/5568/767 > https://www.sciencedirect.com/science/article/pii/S019665531730901X > > We don't know why the virus stays in the throat in many people, but at > other times it goes to the lungs. ACE2 is predicted to be highly expressed > in the mouth and nose as well as the lungs. > https://www.researchsquare.com/article/rs-16992/v1 > > A recent Nature paper noted that "sequence-distinct virus populations > were consistently detected in throat and lung samples from the same > patient, proving independent replication" > https://www.nature.com/articles/s41586-020-2196-x > > It would be very interesting to know whether the lung samples were less > temperature-sensitive than the throat ones, and whether this could explain > the observed divergent tropism - (which you also noted). > https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/ > > Thx and stay warm (see my blog) > > Patrick > > > > On Thu, Apr 2, 2020 at 4:57 PM Jurgen Bosch <jxb...@case.edu> wrote: > >> I’m sharing a laymen’s talk I recently gave on some aspects of Corona. >> I’m not claiming to be an expert, but there is useful information in the >> presentation. I skipped the intro and zoomed directly to the start of my >> presentation. >> >> https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204 >> >> I can make the slides available if anybody wants them. >> >> Jürgen >> >> On Apr 2, 2020, at 11:27 AM, James Holton <jmhol...@lbl.gov> wrote: >> >> Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd >> still like to know that. >> >> It is most certainly true that the primer design must be done right: >> checking for self-annealing, low genomic variability, cross-reactivity to >> potential contaminants etc. Fortunately, we have tools for this that can >> be used at home. >> >> I agree the CRISPR-based tests are very exciting, as are many of the >> other new tests being rolled out. Assay times of 15 minutes, 5 minutes, >> and now 2 minutes have been claimed. The problem I see is they all rely on >> specialized equipment, skilled technicians and expensive reagents. Ramping >> up production to the billion-test scale may not be feasible. Even if it >> were, all the PPE needed to extract those samples safely would be >> prohibitive, as would be the sample-tracking logistics. >> >> For reasons such as this, I am curious to see if an at-home >> do-it-yourself test is possible. It may serve no purpose other than to >> satisfy indiviual curiosity, but I think it would go a long way to defusing >> the fear that comes from not knowing. This would not just be for sputum, >> but possibly doorknobs, packages, and, yes, mobile phones. >> >> And for those wondering about those nasal swabs: I've done a little >> research on them and I think the reason for going full "Total Recall" and >> sticking it way up inside your head is not because the virus is more >> concentrated there (we don't even know what the concentration is), but >> rather because potential contaminants are minimized. Think about it: PCR >> is a very sensitive technique, and you want to make sure the sample came >> from the intended patient, not the other patient who walked through the >> door just before you did after sneezing in their hand and touching the >> doorknob. If you touched that same doorknob and then <ahem> "scratched" >> your nose, then a swab of your nostrils might pick up a virus or two. That >> would be a false positive. >> >> I expect there are many aspects of current test that don't have to be the >> way they are, but nonetheless are "required" because they were inherited >> from previous tests. I expect we all have learned the hard way that in >> biological science when you are handed a protocol you follow that protocol >> to the letter. How many times have you had to teach a student that? It is >> not a bad policy, but eventually there comes a time for "assay >> development". This is when you start asking "why do we do it that way, >> again?" >> >> For example, swabs with calcium alginate are not allowed becuase they >> can "kill the virus". If all we want is genomic RNA, then why do we care? >> Possibly because the traditional method of identifying most pathogens is to >> culture them. The CDC protocol also recommends against cotton swabs with >> wood handles. Why? Perhaps because they contain DNA, and for PCR you >> always worry about contamination. Is there any chance the probes will >> anneal to something in the cotton or pine genomes? I doubt it, but I also >> doubt that anyone has checked. >> >> Thank you for the suggestions so far! Very interesting and helpful! >> >> -James Holton >> MAD Scientist >> >> >> On 3/31/2020 11:46 PM, Sahil Batra wrote: >> >> Dear Prof. Holton, >> >> An innovative idea; however all of the 30 kb genome may not be useful for >> specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity. >> >> A similar fluorescent detection approach for SARS Cov2 -- using the >> indiscriminate collateral activity of Cas12 nuclease -- has been reported >> here: >> https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf >> Although not tested on samples from patients. >> >> Regards, >> Sahil Batra >> PhD candidate, IIT Kanpur >> >> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <jxb...@case.edu> wrote: >> >>> One problem I see is the sputum, there’s a reason why swabs are made to >>> get sufficient viral material. >>> >>> Since stool samples test PCR positive that might be an easier approach >>> to get sufficient viral material. As a side note, these are not infectious >>> anymore, or at least one has not been able to infect tissue cultures from >>> stool samples. >>> >>> It’s worth a thought, I’ll need to read those papers you referenced. >>> >>> I believe I read a suitable preprint for viral load, will search for it >>> tomorrow. >>> >>> Jürgen >>> >>> >>> >>> >>> __________________________________________ >>> Jürgen Bosch, Ph.D. >>> Division of Pediatric Pulmonology and Allergy/Immunology >>> Case Western Reserve University >>> 2109 Adelbert Rd, BRB 835 >>> Cleveland, OH 44106 >>> Phone: 216.368.7565 >>> Fax: 216.368.4223 >>> >>> CEO & Co-Founder at InterRayBio, LLC >>> >>> Johns Hopkins University >>> Bloomberg School of Public Health >>> Department of Biochemistry & Molecular Biology >>> >>> On Apr 1, 2020, at 00:50, James Holton <jmhol...@lbl.gov> wrote: >>> >>> In order to do global survelinace of this new virus I figure we're >>> going >>> to need billions of tests. The biggest barriers I believe are >>> logistical. Shipping back and forth to a central labs isn't going to >>> cut it, and neither are test kits that cost $800 each. >>> >>> I think I may have a plausible way forward to a low-cost and easily >>> mass-produced test for the SARS-CoV-2 virus using mostly items people >>> already have, such as smartphones. The most expensive reagent required >>> will be labeled oligos, but those scale very well. >>> >>> The key observation is that smartphones can detect as few as 1e6 >>> particles/mL if they do long exposures (180s). This was using >>> bioluminescence. Reported here: >>> https://www.nature.com/articles/srep40203.pdf >>> >>> The other side of that coin is the expected titer of the virus in >>> sputum. I don't know of any reports for SARS-CoV-2 itself, but for four >>> other respiratory viruses, including one coronavirus, it ranges from 1e6 >>> to 1e8 particles/mL : >>> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ >>> >>> This is encouraging! The challenge will be to detect viral genomes in >>> "the field" without sophisticated lab equipment like a PCR machine, >>> lasers, 3D printers, etc. The concentration will be 1e-15 M, a >>> challenge, but then again we can detect single molecules using >>> fluorescence. The questions are: >>> 1) can we get the background low enough so that the dark current of the >>> camera dominates >>> 2) can we make the signal high enough to overcome the dark current. >>> >>> 1) will depend on the availability of mass-produced filter technology. >>> However, the best filter may simply be time. Provided the fluorophore >>> lifetime is long enough and the camera synchronization tight enough one >>> could simply measure the "afterglow" after the camera flash has turned >>> off. An interesting candidate is europium. Most fluorophores decay in >>> nanoseconds, but lanthanides can be microseconds to milliseconds. In >>> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. >>> Those decay over minutes to hours. What I'm not sure about is using >>> them for FRET. I would appreciate input on experience with this. >>> >>> 2) I believe signal could be enhanced by using very luminous tags (such >>> as quantum dots), and/or by using multiple tags per genome. This virus >>> has the largest RNA genome known to date at 30 kbases. That means there >>> is room for up to 2000 15-mer tags, each with its own label. The set-up >>> cost for doing ~2000 oligo synthesis reactions will be high, but it can >>> be done at scale. You only need ~2 fmol of each oligo, 10 umol >>> synthesis is about $1k, so I estimate about $1 per test using 1000 >>> different oligos. This price point will be important if we want to make >>> billions of tests to be used all over the world. In some countries $1 >>> is a lot. >>> >>> The detection strategy I am focusing on is FRET. That is, oligos would >>> be made in pairs, recognizing abutting sections of the viral genome. >>> Like this: >>> 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3' >>> which would anneal to one of the current CDC test primer sites: >>> 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5' >>> The result in this case would be maximum FRET efficiency only when both >>> oligos are bound. From what I can tell, the ATTO465 dye is one that is >>> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and >>> ATTO550 should give maximum contrast between the green and red channels >>> of the iPhone camera. That way you would discriminate presence/absence >>> by color. Red=virus, Green=clear. That is just an example. Other tags >>> might work better. Maybe quantum dots. >>> >>> Additional aparatus would be required, of course, and at least a few >>> reagents to crack open the capsids (DTT and guanidine). These could be >>> shipped dry in foil packs. The end user would simply tear it open and >>> spit into it. If the intersted party is performing the test on >>> themselves, then there is no biohazard. Heating to 70C (cup of coffee?) >>> should kill the virus, and these reagents will make it even more dead. >>> I'm not sure how much purification would be required. The assay volume >>> in the Nature paper above was 1 mL. I expect signal would be improved >>> by concentrating the RNA as close to the camera as possible. It may >>> even be possible to absorb the nucleic acid directly onto the cover >>> glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and >>> not much else does. Quiagen EZ1 nucleic acid purificaiton columns are >>> nothing but silica glass beads after all. >>> >>> There are still details to work out, but I am intruiged by the fact that >>> this seems physically possible and the potential of being very cheap, >>> rugged, portable and scaled up rapidly. It would be nice to be able to >>> leverage a device that is in already in the hand of half the people on >>> the planet. >>> >>> Comments? Insights? >>> >>> -James Holton >>> MAD Scientist >>> >>> ######################################################################## >>> >>> To unsubscribe from the CCP4BB list, click the following link: >>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >>> >>> >>> ------------------------------ >>> >>> To unsubscribe from the CCP4BB list, click the following link: >>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >>> >> >> ------------------------------ >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> >> >> >> ------------------------------ >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> >> >> >> ------------------------------ >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> > > > -- > patr...@douglas.co.uk Douglas Instruments Ltd. > Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK > Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek > > http://www.douglas.co.uk > Tel: 44 (0) 148-864-9090 US toll-free 1-877-225-2034 > Regd. England 2177994, VAT Reg. GB 480 7371 36 > > > > ------------------------------ > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > > > > ------------------------------ > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > -- Evgenii Osipov Laboratory for Biocrystallography, Department of Pharmaceutical Sciences, KU Leuven O&N2 ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1 This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list hosted by www.jiscmail.ac.uk, terms & conditions are available at https://www.jiscmail.ac.uk/policyandsecurity/
