chen li am Freitag, 6. Januar 2006 11.27:
> Hi Xicheng,
Hi Chen
> Thanks. I search the list before I post the question
> but I can't find similar topics. Could you please tell
> me some ealier posts? Also I try to use your code to
> read a very small file containing only these two
> records. Here is what I got:
>
> This is record 1.
> This is sequence:
> This is record 2.
> This is sequence:
> This is record 3.
> This is sequence:
>
> I can't print each record out. How do I fix it?
>
> And here is my code:
>
> #!/usr/bin/perl-w
A space before -w is missing. Alternatively, just add the following line above
use strict;
use warnings;
> use strict;
>
> my $filename='sequence.fasta';
> open(FILENAME,$filename) or die " This $filename
> cannot be open!!!\n\n";
>
> {local $/='>';
>
> my $count_record=0;
>
> while (<FILENAME>){
> ++$count_record;
>
> print "This is record $count_record.\n";
>
> print "This is sequence:$sequence\n";
$sequence is not defined; when you run the script under 'use warnings;' (or
'#!/usr/bin/perl -w', a warning should be displayed.
To actually print the sequence out:
print "This is sequence: $_\n";
see (on the cmdline)
perldoc perlvar
for documentation of all the funny $... vars
> }
>
> }
> exit;
exit is not needed.
[top posting history:]
> ~
>
> --- Xicheng <[EMAIL PROTECTED]> wrote:
> > This is a FAQ problem, so I would not post it in the
> > group, pls see the
> > following code.
> > ===================
> > #!/usr/bin/perl -w
> > use strict;
> > open FH, "<data.txt" or die "cant open data.txt:
> > $!";
> > {
> > local $/='>';
> > while (<FH>) {
> > # do sth on $_; # $_ does not include the
> > leading '>' though.
> > }
> > }
> > Dont know if this can go smoothly with your 2.7G
> > file though. Good
> > luck,
> > XC
> > =====================
> >
> > Chen Li wrote:
> > > Hi all,
> > >
> > > I have a big file (2.7G) containing multiple
> >
> > records
> >
> > > in this format:
> > > >gi|618748|dbj|D21618.1| MUS74F01 mouse embryonal
> > >
> > > carcinoma cell line F9 Mus mus culus cDNA clone
> >
> > 74F01,
> >
> > > mRNA sequence
>
> GCTGCCTCGACGATCTTCGCTTGCNTCCTCGCTCGCTGTCCCGTTGTCCTAGCCCGCCGCCGCCCGCTGAGCTTG
>TCTTT
>
>
> ACCCTGCTTGCAGACATGGCTGACATCAAGAACAACCCCGAATATTTCTTTCGTNANCCGGTGTNATGGCGCTCG
>TCCGC
>
> > > AATGTTTTAGCGGCATGGGCCGCTATTGACAGCAAGAG
> > >
> > > >gi|618749|dbj|D21619.1| MUS74F09 mouse embryonal
> > >
> > > carcinoma cell line F9 Mus mus culus cDNA clone
> >
> > 74F09,
> >
> > > mRNA sequence
>
> GGCGNNNTGGCCTCGGGCGGCTGGACGTGCCCAGCGCCCGATTAACAAGATACATTTAATTGCTGTGTTTAACCA
>AATGT
>
>
> TTGAAGGCTGTGGGACTTTTTGAAATCATATGATCTCCTAAAAGCTGTTCACATTGTTCATTAA
>
> > > Each record starts with ">". I want to read each
> > > record once at a time.I hear about a special
> >
> > variable
> >
> > > call $/ might do the job but not sure how to use
> >
> > it. I
> >
> > > wonder if anyone could help me out.
> > >
> > > Thanks,
> > >
> > > Li
> > >
> > >
> > >
> > >
> > >
> > >
> > > __________________________________________
> > > Yahoo! DSL - Something to write home about.
> > > Just $16.99/mo. or less.
> > > dsl.yahoo.com
>
> __________________________________________
> Yahoo! DSL Something to write home about.
> Just $16.99/mo. or less.
> dsl.yahoo.com
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
