Hi Xicheng,
Thanks. I search the list before I post the question
but I can't find similar topics. Could you please tell
me some ealier posts? Also I try to use your code to
read a very small file containing only these two
records. Here is what I got:
This is record 1.
This is sequence:
This is record 2.
This is sequence:
This is record 3.
This is sequence:
I can't print each record out. How do I fix it?
And here is my code:
#!/usr/bin/perl-w
use strict;
my $filename='sequence.fasta';
open(FILENAME,$filename) or die " This $filename
cannot be open!!!\n\n";
{local $/='>';
my $count_record=0;
while (<FILENAME>){
++$count_record;
print "This is record $count_record.\n";
print "This is sequence:$sequence\n"; }
}
exit;
~
--- Xicheng <[EMAIL PROTECTED]> wrote:
> This is a FAQ problem, so I would not post it in the
> group, pls see the
> following code.
> ===================
> #!/usr/bin/perl -w
> use strict;
> open FH, "<data.txt" or die "cant open data.txt:
> $!";
> {
> local $/='>';
> while (<FH>) {
> # do sth on $_; # $_ does not include the
> leading '>' though.
> }
> }
> Dont know if this can go smoothly with your 2.7G
> file though. Good
> luck,
> XC
> =====================
>
> Chen Li wrote:
> > Hi all,
> >
> > I have a big file (2.7G) containing multiple
> records
> > in this format:
> > >gi|618748|dbj|D21618.1| MUS74F01 mouse embryonal
> > carcinoma cell line F9 Mus mus culus cDNA clone
> 74F01,
> > mRNA sequence
> >
>
GCTGCCTCGACGATCTTCGCTTGCNTCCTCGCTCGCTGTCCCGTTGTCCTAGCCCGCCGCCGCCCGCTGAGCTTGTCTTT
> >
>
ACCCTGCTTGCAGACATGGCTGACATCAAGAACAACCCCGAATATTTCTTTCGTNANCCGGTGTNATGGCGCTCGTCCGC
> > AATGTTTTAGCGGCATGGGCCGCTATTGACAGCAAGAG
> > >gi|618749|dbj|D21619.1| MUS74F09 mouse embryonal
> > carcinoma cell line F9 Mus mus culus cDNA clone
> 74F09,
> > mRNA sequence
> >
>
GGCGNNNTGGCCTCGGGCGGCTGGACGTGCCCAGCGCCCGATTAACAAGATACATTTAATTGCTGTGTTTAACCAAATGT
> >
>
TTGAAGGCTGTGGGACTTTTTGAAATCATATGATCTCCTAAAAGCTGTTCACATTGTTCATTAA
> >
> > Each record starts with ">". I want to read each
> > record once at a time.I hear about a special
> variable
> > call $/ might do the job but not sure how to use
> it. I
> > wonder if anyone could help me out.
> >
> > Thanks,
> >
> > Li
> >
> >
> >
> >
> >
> >
> > __________________________________________
> > Yahoo! DSL - Something to write home about.
> > Just $16.99/mo. or less.
> > dsl.yahoo.com
>
>
__________________________________________
Yahoo! DSL Something to write home about.
Just $16.99/mo. or less.
dsl.yahoo.com
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
