Greetings All!
As is often the case on this list, the answer may well
be under my nose but I can't see it!
I am looking for a "smart" way to do the following.
Say I have a vector of values, X. I set up bins" for X,
say with breaks at B = c(b1,b2,...,b11) covering the
range of X, i.e. bins numbere
Probably you're looking for function findInterval().
I hope it helps.
Best,
Dimitris
On 8/31/2011 10:00 AM, Ted Harding wrote:
Greetings All!
As is often the case on this list, the answer may well
be under my nose but I can't see it!
I am looking for a "smart" way to do the following.
Say
Thanks, Dimitris. That looks hopeful!
Ted.
On 31-Aug-11 08:06:23, Dimitris Rizopoulos wrote:
> Probably you're looking for function findInterval().
>
> I hope it helps.
>
> Best,
> Dimitris
>
> On 8/31/2011 10:00 AM, Ted Harding wrote:
>> Greetings All!
>> As is often the case on this list, the
On 08/31/2011 06:00 PM, Ted Harding wrote:
Greetings All!
As is often the case on this list, the answer may well
be under my nose but I can't see it!
I am looking for a "smart" way to do the following.
Say I have a vector of values, X. I set up bins" for X,
say with breaks at B = c(b1,b2,...,b1
On 31-Aug-11 08:25:15, Jim Lemon wrote:
> On 08/31/2011 06:00 PM, Ted Harding wrote:
>> Greetings All!
>> As is often the case on this list, the answer may well
>> be under my nose but I can't see it!
>>
>> I am looking for a "smart" way to do the following.
>>
>> Say I have a vector of values, X.
Dear all,
Suppose I have a data frame like this:
[code]
var1 <- c(1,999,2)
var2 <- c(999,1,2)
var3 <- c(1,2,999)
example <- data.frame(var1,var2,var3)
[/code]
I want to replace all 999 to NA in all observations in all columns. I
know how to do it in each individual column.
[code]
example$var1[e
Dear CH,
Try
example[example == 999] <- NA
example
HTH,
Jorge
On Wed, Aug 31, 2011 at 4:48 AM, C.H. <> wrote:
> Dear all,
>
> Suppose I have a data frame like this:
>
> [code]
> var1 <- c(1,999,2)
> var2 <- c(999,1,2)
> var3 <- c(1,2,999)
> example <- data.frame(var1,var2,var3)
> [/code]
>
>
. .
-- .- -.-- -... . ... --- -- .
.-. . .--. .-. --- -.. ..- -.-. .- -... .-.. . -.-. --- -.. .
.-- --- ..- .-.. -.. . .-.. .--. ..- ... .- -. ... .-- . .-.
-.-- --- ..- .-. --.- ..- . ... - .. --- -. ... - --- .--.
.- .--. --- .-.. --- --. .. . ... ..-. --- .-.
Hi,
Take a look at the rle() function. This finds runs of equal values in
vectors. Using apply this can quite easily be run for all the
rows/columns of a matrix.
cheers,
Paul
On 08/30/2011 04:58 PM, Martin Batholdy wrote:
> Hi,
>
> I have the following, rather unorthodox problem:
>
>
> I have a
On 08/31/2011 07:06 PM, Patrick Connolly wrote:
. .
-- .- -.-- -... . ... --- -- .
.-. . .--. .-. --- -.. ..- -.-. .- -... .-.. . -.-. --- -.. .
.-- --- ..- .-.. -.. . .-.. .--. ..- ... .- -. ... .-- . .-.
-.-- --- ..- .-. --.- ..- . ... - .. --- -. ... - --- .--.
.- .--. --
Hi alltogether!
I just tried to install the package BBMM and got the following error
message:
Error in file 'BBMM-package.Rd':
\cr
does not fit tabular format {ll}
Fehler: building help failed für Paket ‘BBMM’
Is there a workaroung to this problem or will i have to wait until it gets
fixed?
Hi there,
I have large excel files which I can save as CSV files.
Each excel file contains two columns. One contains the chromosome number and
the second contains a DNA sequence.
I need to convert this into a fasta file that looks like this
>chromosomenumber
CGTCGAGCGTCGAGCGGAGCG
Can anyon
I'd like to fit the (1-displaced) negative hypergeometric distribution
to data samples such as the following:-
x <- c(370, 311, 299, 266, 265, 232, 197, 198, 170, 154, 133, 123, 120,
103, 80, 72, 69, 67, 67, 50, 36, 35, 26, 23, 15, 11, 9, 6, 5, 3, 3, 2,
2, 2)
i.e., I want to estimate the paramete
Hi all,
I apologize for this probably stupid question, but I really can't figure it
out.
I have a dataframe like this:
group <- c(rep('A', 8), rep('B', 15), rep('C', 6))
time <- c(rep(seq(1:4), 2), rep(seq(1:5), 3), rep(seq(1:3), 2))
value <- runif (29, 1, 10)
dfx <- data.frame (group, time, value
hi everyone,
I want to backtest a simple strategy with RSI, im using "sigThreshold".
i took example from the http://blog.fosstrading.com/ site to understand how
quanstrat works.
but now, i have a problem with my code that i really don't understand, R
says me:
Error in match.names(column, colna
Hi
> Hi all,
> I apologize for this probably stupid question, but I really can't figure
it
> out.
> I have a dataframe like this:
>
> group <- c(rep('A', 8), rep('B', 15), rep('C', 6))
> time <- c(rep(seq(1:4), 2), rep(seq(1:5), 3), rep(seq(1:3), 2))
> value <- runif (29, 1, 10)
> dfx <- data.fr
The plyr solution is:
library(plyr)
ddply(dfx, .(group, time), summarize, mean = mean(value), sd = sd(value))
Best,
Ista
On Wed, Aug 31, 2011 at 7:13 AM, Petr PIKAL wrote:
> Hi
>
>> Hi all,
>> I apologize for this probably stupid question, but I really can't figure
> it
>> out.
>> I have a dat
Hi All,
I now have programming examples for common research tasks done in R, SAS, SPSS
and Stata at http://r4stats.com. The examples fall into the following
categories:
Data Import & Export
Data Management
Enhancing Output
Graphics, ggplot2
Graphics, Traditional
Selecting Variables and Observa
You can use data.table:
> group <- c(rep('A', 8), rep('B', 15), rep('C', 6))
> time <- c(rep(seq(1:4), 2), rep(seq(1:5), 3), rep(seq(1:3), 2))
> value <- runif (29, 1, 10)
> dfx <- data.frame (group, time, value)
> require(data.table)
> dfx <- data.table(dfx)
> dfx[,
+ list(mean = mean(value),
The CRAN check page at
http://cran.r-project.org/web/checks/check_results_BBMM.html
suggests it works under all tested platforms. Therefore I guess you R is
outdated. Please upgrade R and report to the package maintainer that
(s)he should add a dependency statement on a fairly recent version of
dear R community,
i appologize as this is kind of a newbie question, but:
I want to assign group letters (like in anova post-hoc tests) to data
with combined means and SDs. It's easy to apply t-test formulas to get
a materix like
(A - D are treatments
| A B C D
---
Have a look at package multcomp at:
http://cran.r-project.org/package=multcomp
I hope it helps.
Best,
Dimitris
On 8/31/2011 2:30 PM, eldor ado wrote:
dear R community,
i appologize as this is kind of a newbie question, but:
I want to assign group letters (like in anova post-hoc tests) to
Hi
> The plyr solution is:
>
> library(plyr)
> ddply(dfx, .(group, time), summarize, mean = mean(value), sd =
sd(value))
I tried to do the task by ddply but I had difficulties to understand the
correct syntax. Maybe in next issue of plyr summarise could be referenced
in ddply help page.
Or
> Date: Wed, 31 Aug 2011 01:36:51 -0700
> From: oliviacree...@gmail.com
> To: r-help@r-project.org
> Subject: [R] Convert CSV file to FASTA
>
> Hi there,
>
> I have large excel files which I can save as CSV files.
>
> Each excel file contain
On 08/31/2011 01:36 AM, anyone wrote:
Hi there,
I have large excel files which I can save as CSV files.
Each excel file contains two columns. One contains the chromosome number and
the second contains a DNA sequence.
I need to convert this into a fasta file that looks like this
chromosomenumb
If you know how many lines to skip, you can set skip=xx in read.table.
The question is what you can do if you have variable lines to skip in
various files but you have characters indicating the begining of the
data, like ~A. What you can do is get the file in using readLines,
use grep to find the
Hi:
Things work if x is the response and y is the covariate. To use the
approach I describe below, you need RStudio and its manipulate package
(which is only available in RStudio - you won't find it on CRAN). You
can download and install RStudio freely from http://rstudio.org/ ; it
is available fo
Dear R-users,
In the R internals manual, it is said that one can extract the
elements of the dot-dot-dot argument using the special symbols ..1 or
..2. It seems to work just fine but I was wondering if there is a way
one can extract or modify the content of the dot-dot-dot argument
using a level n
Hi Reuben,
I am puzzled to note that the gradient check in "optimx" does not work for you.
Can you send me a reproducible example so that I can figure this out?
John - I think the best solution for now is to issue a "warning" rather than an
error message, when the numerical gradient is not suf
Hi,
I thought "..2 <- 1" was a correct way to modify the content of the
2nd level of dot-dot-dot because it did not return any error message.
However, this appears to have no effect whatsoever on the content of
dot-dot-dot. So, I guess I should modify my question to: is it
possible to modify the c
On 31/08/2011 9:41 AM, Sébastien Bihorel wrote:
Hi,
I thought "..2<- 1" was a correct way to modify the content of the
2nd level of dot-dot-dot because it did not return any error message.
However, this appears to have no effect whatsoever on the content of
dot-dot-dot. So, I guess I should modi
Hi,
I have a relatively big dataset and I want to construct
some histograms using the histogram function in lattice. One thing I am
interested in is to look at differences between density and percent. I know I
can
use the hist function but it seems that this function gives sometimes some
wr
Hi all,
I am getting evaluation nested too deeply: infinite recursion /
options(expressions=)? in my code.
Trying to investigate it with traceback() returns a very long list,
index go even more then 495, so I can not read everything because it
is not possible to scroll more.
Is it possible to re
On Aug 31, 2011, at 9:58 AM, . . wrote:
Hi all,
I am getting evaluation nested too deeply: infinite recursion /
options(expressions=)? in my code.
Splitting this into another thread seems unnecessary.
Trying to investigate it with traceback() returns a very long list,
index go even more t
I found that replacing "dcom" by "dexp"( that is what dcom will become
is this case) solve the problem. But I need some mechanics like this
provided by dcom, because I am planning to also use dgamma and many
others...
So, if some one have any idea it will be very appreciable.
Thanks in advance.
On 31/08/2011 9:58 AM, . . wrote:
Hi all,
I am getting evaluation nested too deeply: infinite recursion /
options(expressions=)? in my code.
Trying to investigate it with traceback() returns a very long list,
index go even more then 495, so I can not read everything because it
is not possible t
hi, r users
i have a problem with KNN.
i have 2 datasets, X0 and X1.
>dim(X0)
>1471*13
dim(X1)
>5221*13
and for every instances in the dataset X1, i want to find the nearest
neighbour(1nn) in the dataset X0.
and i dont have the true classifications of dataset X1.
but the function knn() need
Thanks Duncan
On Wed, Aug 31, 2011 at 9:43 AM, Duncan Murdoch
wrote:
> On 31/08/2011 9:41 AM, Sébastien Bihorel wrote:
>>
>> Hi,
>>
>> I thought "..2<- 1" was a correct way to modify the content of the
>> 2nd level of dot-dot-dot because it did not return any error message.
>> However, this appea
On Aug 31, 2011, at 10:25 AM, . . wrote:
I found that replacing "dcom" by "dexp"( that is what dcom will become
is this case) solve the problem. But I need some mechanics like this
provided by dcom, because I am planning to also use dgamma and many
others...
In R functions are "things" but th
This is what I use...
fit.func<-function(x){
require(MASS)
est<-fitdistr(x$wind_speed, 'weibull')$estimate
data.frame(shape=est[1],scale=est[2])
}
feel free to correct me if this is wrong!
Justin
On Wed, Aug 31, 2011 at 6:21 AM, Dennis Murphy wrote:
> Hi:
>
> Things work if x is the r
Thank your for your entry in the Poorly Capitalized and Inadequately
Searched Posting Contest. You will be advised of your ranking in due
course. In the meantime, you may want to consult the recommended
search site for []functions and []Task Views that have "clustering"
and "classification
>
> In R functions are "things" but they are not "strings" and cannot be
> executed by just asserting a character vector element.
... But note that they can be executed by by asserting a list of
functions component (as well as by do.call below)
> x <- c(rnorm, rt, rweibull) ## this is a list of f
Hello,
I need to calculate elixhauser comorbidity score using ICD9 code. I can
find SAS code for the calculation online, but not R code.
If you wrote the R code or are aware of existence of this kind of R
code, could you please let me know?
Thanks!
Qingxia (Cindy) Chen
__
On Aug 31, 2011, at 11:05 AM, Bert Gunter wrote:
In R functions are "things" but they are not "strings" and cannot be
executed by just asserting a character vector element.
... But note that they can be executed by by asserting a list of
functions component (as well as by do.call below)
x
Hi all,
I have a list x:
> x=list(a=c('1','2'),b=c('2','3'),c=c('1','2'),d=c('2','3'))
I can get the unique elements with unique(), but how can I get the
number of duplicates for each unique elements?
> unique(x)
[[1]]
[1] "1" "2"
[[2]]
[1] "2" "3"
Thanks
--
Best,
Zhenjiang
___
Thanks, Henrique. It works.
On Mon, Aug 29, 2011 at 6:45 PM, Henrique Dallazuanna wrote:
> Try this:
> as.list(colSums(merge(m, n, all = TRUE), na.rm = TRUE))
>
> On Mon, Aug 29, 2011 at 7:39 PM, zhenjiang xu
> wrote:
>>
>> Hi R users,
>>
>> Suppose I have two lists and the names of list 'm' are
table(match(x, x)) gives you the numbers but the labels are
a bit more work.
E.g., I'll define another list
> x <- list(c("1", "2", "4"), c("1", "2", "4"), 2^(0:4), 3^(1:2), 2^(0:4))
> tb <- table(m <- match(x, x))
> m
[1] 1 1 3 4 3
> tb
1 3 4
2 2 1
which says that the first elem
Hi R users,
suppose I have two vectors,
> x=c(1,2,3,4,5)
> y=c('a','b','c','a','c')
How can I get a data.frame like this?
> xy
count
a 5
b 2
c 8
I know a few ways to fulfill the task. However, I have a huge number
of this kind calculations, so I'd like an efficient solution. T
Hi Zhenjiang,
Try
table(unlist(mapply(function(x, y) rep(x, y), y, x)))
HTH,
Jorge
On Wed, Aug 31, 2011 at 12:45 PM, zhenjiang xu <> wrote:
> Hi R users,
>
> suppose I have two vectors,
> > x=c(1,2,3,4,5)
> > y=c('a','b','c','a','c')
> How can I get a data.frame like this?
> > xy
> cou
Try this:
rowsum(x, y)
On Wed, Aug 31, 2011 at 1:45 PM, zhenjiang xu wrote:
>
> Hi R users,
>
> suppose I have two vectors,
> > x=c(1,2,3,4,5)
> > y=c('a','b','c','a','c')
> How can I get a data.frame like this?
> > xy
> count
> a 5
> b 2
> c 8
>
> I know a few ways to fulfill
On Aug 31, 2011, at 11:45 AM, zhenjiang xu wrote:
> Hi R users,
>
> suppose I have two vectors,
>> x=c(1,2,3,4,5)
>> y=c('a','b','c','a','c')
> How can I get a data.frame like this?
>> xy
> count
> a 5
> b 2
> c 8
>
> I know a few ways to fulfill the task. However, I have a huge
Also
tapply(x, y, sum)
HTH,
Jorge
On Wed, Aug 31, 2011 at 12:50 PM, Jorge I Velez <> wrote:
> Hi Zhenjiang,
>
> Try
>
> table(unlist(mapply(function(x, y) rep(x, y), y, x)))
>
> HTH,
> Jorge
>
>
> On Wed, Aug 31, 2011 at 12:45 PM, zhenjiang xu <> wrote:
>
>> Hi R users,
>>
>> suppose I have tw
Inline below:
On Wed, Aug 31, 2011 at 9:50 AM, Jorge I Velez wrote:
> Hi Zhenjiang,
>
> Try
>
> table(unlist(mapply(function(x, y) rep(x, y), y, x)))
Yikes! How about simply tapply(x,y,sum) ??
?tapply
-- Bert
>
> HTH,
> Jorge
>
>
> On Wed, Aug 31, 2011 at 12:45 PM, zhenjiang xu <> wrote:
>
>> H
For the record, Henrique's use of rowsum() is about 10 times faster
than using tapply (and presumably anything with table() ) on my
computer. It call a C primitive.
-- Bert
On Wed, Aug 31, 2011 at 9:55 AM, Henrique Dallazuanna wrote:
> Try this:
>
> rowsum(x, y)
>
> On Wed, Aug 31, 2011 at 1:45
Dear all,
I am using ggplot with geom_tile to print as an image a matrix I have. My
matrix is a squared one of 512*512 cells.
The code that does that is written below
> print(v + geom_tile(aes(fill=dB))+
> opts(axis.text.x=theme_text(size=20),axis.text.y=theme_text(size=20),
> axis.title.x=
help, help ,help!!!
--
View this message in context:
http://r.789695.n4.nabble.com/function-to-do-the-knn-tp3781137p3781738.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/
I'll put in a plug for vapply().
> # 100,000 numbers in 17576 groups:
> y <- rep(do.call(paste, c(list(sep=""),
expand.grid(LETTERS,letters,letters))), length=1e5)
> x <- seq_along(y)^2
> system.time(val.vapply <- vapply(split(x, y), FUN=sum, FUN.VALUE=0))
user system elapsed
If there's a separate ESS user mail list, please point me to it.
I'm using emacs with ESS and want to enter multiline commands for plots.
Examples in my reference books show each line terminating with a comma so
labels and other attributes can be specified for the plot before it is
submitted
On Wed, 31 Aug 2011, Rich Shepard wrote:
Please explain how I enter these commands.
Got it: put the options within the enclosing parentheses.
Rich
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read t
On Aug 31, 2011, at 12:42 PM, Rich Shepard wrote:
> If there's a separate ESS user mail list, please point me to it.
https://stat.ethz.ch/mailman/listinfo/ess-help
> I'm using emacs with ESS and want to enter multiline commands for plots.
> Examples in my reference books show each line termin
List,
Consider the following data.
gender mygroup id
1 F A 1
2 F B 2
3 F B 2
4 F B 2
5 F C 2
6 F C 2
7 F C 2
8 F D 2
9 F D 2
10 F D 2
11 F D 2
12 F
Is anyone aware of an R package that enables one to estimate the shape
parameters (lambda3 and lambda4) for the generalized lambda
distribution (GLD) based on known mean, variance, skewness, and
kurtosis? I am aware of a package for generating data from a
generalized lambda distribution. However,
Dear all,
I've written a short booklet on how to use R for multivariate analysis,
focussing on principal component analysis and linear discriminant
analysis:
http://little-book-of-r-for-multivariate-analysis.readthedocs.org/
Any comments or corrections will be very welcome.
By the way, this has
Hi, there,
I found density function cannot work well on UNIX.R
version 2.13.1 (2011-07-08), Platform: i386-pc-solaris2.10 (32-bit)
Here is an example from R doucments which can work well on other version.
plot(density(c(-20,rep(0,98),20)), xlim = c(-4,4))#
But right now the estimated probab
Dear R users,
I have been trying to understand what the Weights arguments is doing in the
estimation of the parameters when using the Surreg function.
I looked through the function's code but I am not sure if I got it or not.
For example, if I inclue the Surv function in it:
survreg(Surv(vector,
Hello,
I am trying to plot SADIE red-blue plots of cluster indicies using
filled.contour. I want a plot which only has three bins for the data:
<-1.5, -1.5 - 1.5, >1.5, but I am having trouble getting there.
example
X1 X2 X3 X4 X5
1 -5 -4.5 1.0 4.5 6
2 -3 -2.0 1.2 -1.0 3
3 0 0.0 0.0
Hello
I'm translating a Visual Basic routine to R.
Which command in R is similar to "select case" in VB?
See the example:
select case int(AG)
case 0, 5, 8, 10
VAR = 37
case 1, 4
VAR = 70
case 3, 6, 9
VAR = 90
case 2, 7
VAR = 112
end select
A chain of "if else" would not be very ele
thanks everybody!
On Wed, Aug 31, 2011 at 5:03 AM, jim holtman wrote:
> You can use data.table:
>
> > group <- c(rep('A', 8), rep('B', 15), rep('C', 6))
> > time <- c(rep(seq(1:4), 2), rep(seq(1:5), 3), rep(seq(1:3), 2))
> > value <- runif (29, 1, 10)
> > dfx <- data.frame (group, time, value)
>
Hi:
Trying for hours to add a legend to a periodogram. Any help will be appreciated.
For example, how can I add a legent (showing x1, x2, x3, x4) to both plots
(generated by spec.program() and plot()? Here is a worked example.
require(TSA)
require(graphics)
require(stats)
t<-1986:2011
x1<-cos(t*1
I have several datasets that come from different studies (fv02 and fv03),
they represent different levels (patients and lesions), and they have
different patient populations (itt, mitt, mitt3). I wanted to write some
code that would pass my three requirements into a function I wrote, produce
the o
Dear R experts:
I have following problem:
# myfunction
mfun1 <- function(x) {
if ( x == 2){
xv <- sample(c(2,1,0),100, replace = T, prob = c(0.6, 0.2, 0.2))
}
if ( x == 1){
xv <- sample(c(1,0),100, replace = T, prob = c(0.6, 0.4))
}
if ( x == 0) {
xv <- sample(c(0,0),100, replace = T, pro
? switch
Might do the job.
On Wed, Aug 31, 2011 at 1:27 PM, Antonio Silva wrote:
> Hello
>
> I'm translating a Visual Basic routine to R.
>
> Which command in R is similar to "select case" in VB?
>
> See the example:
>
> select case int(AG)
> case 0, 5, 8, 10
> VAR = 37
> case 1, 4
> VAR = 7
Hello all,
I hope something is not already posted regarding this exact problem I am
trying to solve. I've read through the forums and previous postings and am
still confused as to how to approach this. Basically, what I am trying to do
is construct variables that utilizes an average of a variable
On 31/08/2011 10:33 AM, Dan Carpenter wrote:
Hello,
I am trying to plot SADIE red-blue plots of cluster indicies using
filled.contour. I want a plot which only has three bins for the data:
<-1.5, -1.5 - 1.5,>1.5, but I am having trouble getting there.
example
X1 X2 X3 X4 X5
1 -5 -4.5 1
Dear all,
I would like to know how to subset a data.frame by rows.
Example:
Probesets348843488834892
1 19676_at A AA
2 10001_atP P P
3 10002_at
Thanks for the answers.
Indeed, I wrote wrong in my examples the variables x and y
I meant to say
> y <- c(1,7,14,25,29,30)
> x <- c(1,2,3,4,10,20)
Thanks
--
View this message in context:
http://r.789695.n4.nabble.com/Fitting-my-data-to-a-Weibull-model-tp3780169p3781746.html
Sent from the R h
Suppose your data is called df.
df[rowSums(df == "P")>0,]
In short, this tests each element for equality for "P", sums the number of
"P"s found and subsets when that number is >0.
Michael
On Wed, Aug 31, 2011 at 1:28 PM, Joao Fadista wrote:
> Dear all,
>
> I would like to know how to subset a
If your data frame is called 'df', then
something like the following should work:
df[ apply(as.matrix(df[,-1]), 1, function(x) any(x == "P")), ]
This creates a logical vector as long as the
number of rows. As Bill Dunlap recently noted,
'apply' really wants a matrix and not a data frame.
On 31
Hi Antonio,
Take a look at
require(car)
?recode
for an alternative.
HTH,
Jorge
On Wed, Aug 31, 2011 at 1:27 PM, Antonio Silva <> wrote:
> Hello
>
> I'm translating a Visual Basic routine to R.
>
> Which command in R is similar to "select case" in VB?
>
> See the example:
>
> select case int(
you can use 'ave' to add a new column with the state average:
> id<-as.character(c(01001:01010, 02001:02010))
> st<-substr(id,1,1)
> cnty<-substr(id,2,5)
> tfr10<-rnorm(1:20)
>
> mydata<-data.frame(id,st,cnty,tfr10)
> mydata$stAvg <- ave(mydata$tfr10, mydata$st)
> print(mydata)
id st cnty
On Aug 31, 2011, at 12:06 PM, Peter Maclean wrote:
Hi:
Trying for hours to add a legend to a periodogram. Any help will be
appreciated.
For example, how can I add a legent (showing x1, x2, x3, x4) to both
plots (generated by spec.program() and plot()? Here is a worked
example.
require(T
Thanks Jorge and Michael
"recode" was exactly what I was looking for.
AG<-2.7
VAR<-recode(as.integer(AG),"c(0,5,8,10)=37;c(1,4)=70;c(3,6,9)=90;c(2,7)=112")
VAR
[1] 112
Great!
All the best,
Antônio
2011/8/31 Jorge I Velez
> Hi Antonio,
>
> Take a look at
>
> require(car)
> ?recode
>
> for an
Hi djmuseR,
I tried installing and running the script that you suggested.
But with every value I tried for a, b, c and d I get one of those 2 error
messages
Error in nls(y ~ a - b * exp(-c * x^d), start = list(a = 10, b = 30, c =
0.4, :
singular gradient
Error in numericDeriv(form[[3L]], name
For this example you can work out every possibility, you can use this in place
(or in addition to) the simulations. Here is a quick example with a couple
other ways to look at what is happening:
all.rolls <- expand.grid(1:6,1:6)
max.roll <- apply(all.rolls, 1, max)
round(prop.table(table(max.ro
Hi Joao,
Here is one way (d is your data set):
d[apply(d == 'P', 1, any),]
HTH,
Jorge
On Wed, Aug 31, 2011 at 1:28 PM, Joao Fadista <> wrote:
> Dear all,
>
> I would like to know how to subset a data.frame by rows.
>
> Example:
>
> Probesets34884348883489
Hi all,
I was using integrate to do some integration. Also tried a little bit
of the AdaptIntegrate from the cubature package.
Is there other functions in R for numerical integration? May be a
compound of function for this purpose...
__
R-help@r-projec
Hello!
I created a distances matrix for 13 objects using daisy (see the attached file).
I am trying to clusteranalyse it using agnes but it's not working.
What might be the problem:
mydistances<-read.csv("Results of daisy.csv")
mycluster<-agnes(mydistances, method="ward")
I am getting:
Error in
And with this one the OP won the contest David talked about with a
highscore.
Uwe Ligges
On 31.08.2011 19:35, jiliguala wrote:
help, help ,help!!!
--
View this message in context:
http://r.789695.n4.nabble.com/function-to-do-the-knn-tp3781137p3781738.html
Sent from the R help mailing list
On Aug 31, 2011, at 1:04 PM, alex46...@yahoo.com wrote:
Hi, there,
I found density function cannot work well on UNIX.R
version 2.13.1 (2011-07-08), Platform: i386-pc-solaris2.10 (32-bit)
Here is an example from R doucments which can work well on other
version.
plot(density(c(-20,rep(0,98
I'll assume that all of an individual's data rows
are contiguous and that an individual always passes through
the groups in order (or, least, the individual
never leaves a group and then reenters it), so we
can find everything we need to know by comparing each
row with the previous row.
You can us
Hi:
I'd suggest using ggsave(); in particular, see its height = and width
= arguments. If you have some time, you could look at some examples of
ggplot2 themes:
https://github.com/hadley/ggplot2/wiki/themes
and some examples of how to use various opts():
https://github.com/hadley/ggplot2/wiki/%2Bo
Hello r-project team,
to my data I have an estimate for the shape parameter gamma of a fitted
weibull distribution. Now I want to test it against the exponential
distribution hypothesis, i.e. gamma = 1. Does anybody know how to do it?
I think I can run a t-test, but I am not sure how to get there.
R version: 2.13.1 64 bit for macOSX
R console version: R for Mac OS X GUI 1.40-devel Leopard build 64-bit (5874)
Problem: When I go to use the auto completion feature it keeps tagging
on all the listed options instead of just allowing me to pick one. Is there a
fix for this?
_
Dear R gurus,
I trying to convert a list of data frames to one data frame, but one of the
values within the list is NULL, so I get the error "arguments imply differing
number of rows." Do you know of a quick way to tell R to combine all that are
not null? Here is a simple example:
> tmp<-list(
On Aug 31, 2011, at 2:40 PM, Nathan Hutcheson wrote:
> R version: 2.13.1 64 bit for macOSX
> R console version: R for Mac OS X GUI 1.40-devel Leopard build 64-bit (5874)
>
>
> Problem: When I go to use the auto completion feature it keeps tagging
> on all the listed options instead of just al
Hi Mark,
Try
do.call(rbind, tmp[!sapply(tmp, is.null)])
HTH,
Jorge
On Wed, Aug 31, 2011 at 4:02 PM, Mark Ebbert <> wrote:
> Dear R gurus,
>
> I trying to convert a list of data frames to one data frame, but one of the
> values within the list is NULL, so I get the error "arguments imply
> dif
Hi!
Can anyone tell me how to convert the anova/ancova summary output into a data
frame?
Thanks!
Shane Phillips
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do
Dear all,
Are you aware of any implementation of the split normal
distribution (also called two-piece normal) in R?
For a description, please consult:
http://en.wikipedia.org/wiki/Split_normal_distribution
By implementation, I mean functions like dnorm, rnorm,
qnorm, etc.
Thanks for your help
On 31.08.2011 22:33, Shane Phillips wrote:
Hi!
Can anyone tell me how to convert the anova/ancova summary output into a data
frame?
For the first component of such an object:
as.data.frame(summary.aov_object[[1]])
Uwe Ligges
Thanks!
Shane Phillips
[[alternative HTML version
Yeah, I never would have come up with that one. Thanks!
On Aug 31, 2011, at 2:18 PM, Jorge I Velez wrote:
Hi Mark,
Try
do.call(rbind, tmp[!sapply(tmp, is.null)])
HTH,
Jorge
On Wed, Aug 31, 2011 at 4:02 PM, Mark Ebbert <> wrote:
Dear R gurus,
I trying to convert a list of data frames to one
1 - 100 of 133 matches
Mail list logo
