pkg_resources ?

esources.run_script('pbpy==0.1', 'run.py') ##code # What are the advantages of using pkg_resources stuff ? Thanks Regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Python 3.2 vs Java 1.6

Hi All, How does python 3.2 fare compared to Java 1.6 in terms of performance ? any pointers or observations ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Python Developers with 5 years of experience

probably it is good to post jobs in python-list itself rather than posting it on someother site. Many mailing lists do that. It gives a feel of what jobs we come across for the Python developers. KM On Thu, May 5, 2011 at 3:16 AM, Ben Finney wrote: > "Jerome jjcpl.rpo" writes: >

Re: we want python software

I dont know how these students are selected into b tech stream in India. they are so dumb. All they know is a to open a program we need to double click it and it runs.- windoze legacy. most of the time they pay huge amount to a greedy college and get into tech stream. Now that Java boom (jobs) is o

Re: we want python software

hiram R" wrote: > > > On Wed, Dec 6, 2017 at 10:08 AM, km wrote: > >> I dont know how these students are selected into b tech stream in India. >> they are so dumb. All they know is a to open a program we need to double >> click it and it runs. >> >> ​W

Re: learning and experimenting python.

You are wasting our time instead of learning python. On Dec 31, 2016 2:09 PM, wrote: > It is moderatable. You can delete your all messages except topics. > -- > https://mail.python.org/mailman/listinfo/python-list > -- https://mail.python.org/mailman/listinfo/python-list

XMLSchema Parsing

Hi all, i'd like to know if there are any good XMLSchema (.xsd files) parsing modules in python. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

vi and python

Hi all, Is there a way to display inbuilt function syntax as the user starts typing a function name with 'Vi' editor in console mode? tia, KM -- http://mail.python.org/mailman/listinfo/python-list

inbuilt function buffer()

Hi all, I which context is the inbuilt function buffer() used ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: IPython colors in windows

Hi all, Have u tried Colors0.1 module from python.org ? KM On Fri, Feb 04, 2005 at 07:21:29AM -0800, Fuzzyman wrote: > Are you really using the readline module from newcenturycomputers ? > I've got a feeling that&#

multiple inheritance super()

Hi all, In the following code why am i not able to access class A's object attribute - 'a' ? I wishto extent class D with all the attributes of its base classes. how do i do that ? thanks in advance for enlightment ... here's the snippet #!/usr/bin/python class A(object): def __init__

Re: multiple inheritance super()

Hi peter, ya got it working :-) now i understand mro better. thanks, KM - On Tue, Jul 26, 2005 at 04:09:55PM -0400, Peter Hansen wrote: > km wrote: > > Hi all, > > > > In the following code why am i not able to ac

global interpreter lock

Hi all, is true parallelism possible in python ? or atleast in the coming versions ? is global interpreter lock a bane in this context ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

loop in python

0.005 seconds only !!! Is python runtime slow at all aspects when compared to perl ? I really wonder what makes python slower than perl ? Is there any proposal to make python faster in future versions ? curious to know all these ... regards, KM -- http://mail.python.org/mailman/listinfo

Re: loop in python

python snippet, it not better , it takes 0.57 seconds. just test it urself and see. what more do i need to accept python is slow when it comes to loops concept ? PS : my linux box is running fedora core 2 with 256 MB RAM regards, KM

Re: loop in python

hon is not yet ready? even most of the googling abt python vs perl convince me that perl is faster than python in most of the aspects. Also the first thing any newbie to python asks me is abt "raw speed in comparison with similar languages like perl" when i advocate python to perl. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: loop in python

n it comes to webscripting) > regards > Steve "The inventor of Holden" regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: loop in python

re really coded in very low level for python ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Chart Director?

Hi all, Chart Director is a good module to implement graphs using in python. i have been using it since 6 months for scientific data visualisation. great module !!! regards, KM -- On Sat, Feb 19, 2005 at 08:22:19AM +0100, Vincent Wehren wrote

Re: Python - what is the fastest database ?

Hi all, Google has specially designed file system 'Goolgle File System' too. KM - On Mon, Feb 28, 2005 at 01:43:53PM -0500, Terry Reedy wrote: > > <[EMAIL PROTECTED]> wrote in message > news:[EMA

decorators ?

Hi all, was going thru the new features introduced into python2.4 version. i was stuck with 'decorators' - can someone explain me the need of such a thing called decorators ? tia KM -- http://mail.python.org/mailman/listinfo/python-list

debian python2.4

Hi all, is there a debian binary of python2.4 ? tia, KM -- http://mail.python.org/mailman/listinfo/python-list

exec size

Hi all, just curious to know why /usr/bin/python2.3 is 890K and /usr/bin/python2.4 is 3.5M in linux ? tia, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: exec size

Hi Gerhard, ya have tried stripping python2.4 it came to 952K. now does the size diference before and after strip affect the runtime of a python program ? KM - On Thu, Dec 02, 2004 at 02:23:34PM +0100, Gerhard Haering wrote

installer

Hi all, does python have a default module installer inbuilt as for perl in windows ? tia , KM -- http://mail.python.org/mailman/listinfo/python-list

import wx

Hi all, Has anyone tried building wxPython-2.5.3 with python2.4 ? after building and setting paths stuff, i have trouble importing wx - the error says : "ImportError : No module named _core_" can someone shed light on this ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

temp file name

Hi all, Is there a way to create a unique file name; safely i have used os.tmpnam() with python2.4, i warns that the usage is a potential security risk. tia KM -- http://mail.python.org/mailman/listinfo/python-list

wxPython help

Hi all, i am trying out some of the demo programs in wxPython. but i am getting an error: no module 'run' how do i circumvent this module and run the program with main.Loop() ? tia, KM -- http://mail.python.org/mailman/listinfo/python-list

regex multiple patterns in order

I am trying to find sub sequence patterns but constrained by the order in which they occur For example >>> p = re.compile('(CAA)+?(TCT)+?(TA)+?') >>> p.findall('CAACAACAATCTTCTTCTTCTTATATA') [('CAA', 'TCT', 'TA')] But I instead find only one instance of the CAA/TCT/TA in that order. How can I get

Re: regex multiple patterns in order

Aah! I understand now. Thank you Regards, Krishna Mohan On Mon, Jan 20, 2014 at 4:48 PM, Ben Finney wrote: > km writes: > > > I am trying to find sub sequence patterns but constrained by the order > > in which they occur > > There are also specific resources for u

Re: PyPy updated

I tried compiling pandas on pypy 2.3 but it gave error as follows numpy/core/src/multiarray/scalarapi.c:742:16: error: 'PyUnicodeObject' has no member named 'str' uni->str[length] = 0; ^ numpy/core/src/multiarray/scalarapi.c:743:16: error: 'PyUnicodeObject' has no m

Re: HELP!! How to ask a girl out with a simple witty Python code??

show her your python and and impress her. Regards, Krishna On Thu, Mar 5, 2015 at 7:04 AM, Xrrific wrote: > Guys, please Help!!! > > I am trying to impress a girl who is learning python and want ask her out > at the same time. > > Could you please come up with something witty incorporating a sim

psycopg: tz import error

; fails to import.do i need to set any env variable specially for 2.4.3 ? regards,KM -- http://mail.python.org/mailman/listinfo/python-list

references and buffer()

t;>>print x TCGTACC >>> id(y) -1085484104 >>> id(x) -1085476384 now the ids of y and x are not the same - why ? In which situatons are buffers used against the strings ? can i create a write buffer instead of readonly buffer ? what exactly are buffer object types ? and how can i instantiate them ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: references and buffer()

he referred variable/buffer object it should be reflected in the referenced variables/buffers objects . am i wrong ? does it mean that references  in python are not true references ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: references and buffer()

age Collected  immediately? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: references and buffer()

nce of python interpreter ? regards, KM   -- http://mail.python.org/mailman/listinfo/python-list

Re: Python and CMS

Hi, check out Plone atop Zope. http://plone.org regards, KMOn 10/23/06, Sybren Stuvel <[EMAIL PROTECTED]> wrote: Kjell Magne Fauske enlightened us with:> I recommend taking a look at Django [1]. It is not a CMS right out > of the box, but writing one using the Django framework is not that> diffi

cross connecting

are suitable for this sort of a work ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: __init__.py

/__init__.py so that i can access them by foo.mypath1 in first and second submodule class definitions?  if not  anyother way out ? regards, KMOn 11/14/06, Fredrik Lundh <[EMAIL PROTECTED]> wrote: km wrote:> what is the use of __init__.py file in a module dir ?it tells Python that the

Re: __init__.py

Hi, wow ! i tried it and it works like charm! could access  variables  declared at root module dir  in submodules. also i would like to know if i can have an abstract class declared in __init__.py  with common variables ? regards, KMOn 11/14/06, Fredrik Lundh <[EMAIL PROTECTED]> wrot

__init__.py

Hi all, what is the use of __init__.py file in a module dir ? Is it used to initialize variables  that could be shared across sub modules  if set in __init__.py at root dir  of module ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

biopython SProt

Hi all, Biopython's SProt module doesnt seem to work with current Uniprot KB . do anyone have a parser to read Uniprot format files ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

java python GPL

Hi all, what does Java released under GPL mean to python ? could it hamper python development on the long run? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

subprocess woes

The idea is to pipe-input the string to the program as a variable as mentioned above. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: subprocess woes

Hi Dennis, That works great ! thanks for the correction regards, KM-- On 8/29/06, Dennis Lee Bieber <[EMAIL PROTECTED]> wrote: On Tue, 29 Aug 2006 18:17:47 +0530, km <[EMAIL PROTECTED] >declaimed the following in comp.lang.python:

Re: subprocess woes

Hi Dennis,   That works great. thanks for the correction. The 'output' variable has the returned data as string obbject. how can i get it as a list object with elements as line by line? Is it that p1.communicate()[0] by default returns a single string only ? regards, KM  On 8/29/06,

threading support in python

Hi all, Is there any PEP to introduce true threading features into python's next version as in java? i mean without having GIL. when compared to other languages, python is fun to code but i feel its is lacking behind in threading regards, KM -- http://mail.python.org/mailman/listinfo/p

Re: threading support in python

Hi all, Are there any alternate ways of attaining true threading in python ? if GIL doesnt go then does it mean that python is useless for computation intensive scientific applications which are in need of parallelization in threading context ? regards, KM

Re: threading support in python

. ## if __name__ == ''__multiprocessor_execution_environment__': for python_version in range(python2.4.x, python3.x, x): if python_version.GIL: print 'unusable for computation intensive multiprocessor architecture' else:

Re: threading support in python

True, since smartness is a comparison, my friends who have chosen java over python for considerations of a true threading support in a language are smarter, which makes me a dumbo ! :-) KM On 9/5/06, Richard Brodie <[EMAIL PROTECTED]> wrote: > > "km" <[EMAIL PROTECTED]

Re: threading support in python

  Where is Guido ? would be great to hear  his opinion on GIL/ GC issues in future versions of Python.   regards, KM   On 7 Sep 2006 08:02:57 GMT, Antoon Pardon <[EMAIL PROTECTED]> wrote: On 2006-09-06, [EMAIL PRO

Re: Building Python Based Web Application

Hi,   I use Plone/Zope for and interface it with PostgreSQL . its pretty good. saves  lot of time. ofcourse the learning curve is steep. Zope uses CSS heavily and since ur comfortable with it it shouldnt take muchtime building the site with much less coding in python.   regards, KM   On 9/9/06

Re: Ann: CoreBio 0.4

On 11 Sep 2006 00:59:30 -0700, [EMAIL PROTECTED] <[EMAIL PROTECTED]> wrote: > > Announcing CoreBio 0.4 > > CoreBio home page: > http://code.google.com/p/corebio/ > > Download: > http://corebio.googlecode.com/svn/dist/CoreBio-0.4.1.tar.gz > > CoreBio is an open sourc

Re: Ann: CoreBio 0.4

Hi,why are u reinventing the wheel when Biopython[1] is already existing ? is there any specific reason u wanted to develop this CoreBio ? why dont u just extend the existing BioPython package itself ?regards,KM [1]http://biopython.org

Re: best small database?

checkout gadfly database.regards,KMOn 9/11/06, David Isaac <[EMAIL PROTECTED]> wrote: I have no experience with database applications.This database will likely hold only a few hundred items,including both textfiles and binary files.I would like a pure Python solution to the extent reasonable. Sugge

variable update

Hi all Is there any handy untility for checking if  a variable is populated at runtime ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

memory

Hi all,Is there any module to limit the memory usage of the python program ?regards,KM -- http://mail.python.org/mailman/listinfo/python-list

Re: ANN: dmath 0.9 - Math routines for the Decimal type

and how different is MIT licence to GPL ? could u elaborate on that ? regards, KM On 9/26/06, Brian Beck <[EMAIL PROTECTED]> wrote: > Brian Beck wrote: > > What is dmath? > > == > > dmath provides the standard math routines for Python's arbitrary-p

Re: What python modules are available?

Hi all, Thats ridiculous! why is that the numpy implementation documentation is put on sale and not available freely to everyone? regards, KM --- On 11/18/06, Robert Kern <[EMAIL PROTEC

Re: how to print pdf with python on a inkjet printer.

i dont see os.startfile in python2.5 installation on my system :-( KM On 11/19/06, Thomas Heller <[EMAIL PROTECTED]> wrote: Gabriel Genellina schrieb: > At Friday 17/11/2006 17:40, Tim Roberts wrote: > >> > double wow! as it is my customer wants me to print to the

regex problem

line. why doesnt it match the group(4) item of the match ? any idea whats wrong with it ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: regex problem

HI Tim, oof! thats true! thanks a lot. Is there any tool to simplify building the regex ? regards, KM On 11/23/06, Tim Chase <[EMAIL PROTECTED]> wrote: > line is am trying to match is > 1959400|Q2BYK3|Q2BYK3_9GAMM Hypothetical outer membra29.90.00011 1 > > regex

module hierarchy snapshot

Hi, Is there any good tool get a snapshot of module hierarchy for custom python modules ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Supercomputer and encryption and compression @ rate of 96%

ot able to create a file with such a big filename ? any workarounds ? regards, KM On Thu, Apr 14, 2005 at 01:49:22PM +0200, Fredrik Lundh wrote: > Will McGugan wrote: > > > Please implement this as a Python m

OOPS concept

Hi all, Is there any good step by step online tutorial on OOPS concepts in python ? i have checked some on the python.org.__doc__ page but couldnt make much sense. especially i need help on newstyle classes. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: OOPS concept

Hi all, Well this doesnt explain new style classes. let me be more clear. is there any online tutorial/ recommended book which deals explicitly with object oriented programming in python? regards, KM --- > Try this onl

80 bit precision ?

Hi all, does python currently support 80 bit precision Floating Point Unit ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: 20050111: list basics

Hi all, > Perl's pack function will allow you to do direct memory access if you > ask it to via the "p" and "P" templates. can we do direct memory accessing in python also ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

decimal numarray

Hi all, is there any support for decimal type in numarray module ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

without shell

hi all, can any linux command be invoked/ executed without using shell (bash) ? what abt security concerns ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Please help on Binary file manipulation

Hi, I assume ur on a linux/unix box... pls check the manual for 'split' command in linux/unix this does ur job regards, KM --- On 6/5/07, Pieter Potgieter <[EM

distance map

Hi all, Is there any module to make a network diagram given a 2-D matrix of distances ? any hints regards, KM -- http://mail.python.org/mailman/listinfo/python-list

__getattr__ and __getattribute__

Hi all, i find it difficult to understand the difference between the magic methods __getattr__ and __getattribute__ and so donot know when to use former or later. can someone brief me on it ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: __getattr__ and __getattribute__

Oh thats lucid! thanks for the explanation. regards KM - On 5/9/07, Gabriel Genellina <[EMAIL PROTECTED]> wrote: En Tue, 08 May 2007 08:22:03 -0300, km <[EMAIL PROTECTED]> escribió: > i find it difficult to understand

Re: Inheriting from Python list object(type?)

= y p = Point(2,3) print dir(p) print type(p) code regards KM -- On 23 May 2007 09:58:36 -0700, Mangabasi <[EMAIL PROTECTED]> wrote: Howdy, I would like to create a Point class that l

Re: beginner in python

Standard convention is to use four spaces for indent. Another problem is that u have not closed the filehandle in the program! HTH KM -- http://mail.python.org/mailman/listinfo/python-list

Re: beginner in python

consider the whole line in the data file, they are all unique - there is no redundancy. KM --- On 8/2/07, Beema shafreen <[EMAIL PROTECTED]> wrote: > > Hi everybody , > I am a beginner in python, > I have to f

metaclasses: timestamping instances

_created b = Y() print 'b time stamp %e'%b._created print abs(a._created - b._created) I donot understand the difference between 1) setting __metaclass__ to 'Meta' in class Y 2) not setting __metaclass__ to Meta in class Y Why is the difference in behaviour of time stamping

Re: metaclasses: timestamping instances

Hi, But why does it show varied difference in the time between a and b instance creations when __metaclass__ hook is used and when not used in class Y ? I dont understand that point ! KM On 9/1/07, Michele Simionato <[EMAIL PROTECTED]> wrote: > > On Sep 1, 6:07 pm, Steve Ho

setup.py ./configure arguments

Hi, how do i pass '--enable-shared' etc arguments to Python2.5 setup.py ? do i need to edit some file ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: best package for a physical simulation?

Hi, checkout MMTK package http://dirac.cnrs-orleans.fr/MMTK/ regards, KM On 1/24/07, Robert Kern <[EMAIL PROTECTED]> wrote: [EMAIL PROTECTED] wrote: > Hello everyone, > i would like to use python to perform some simulation involving collisions > of colloidal particles. >

Re: Best Free and Open Source Python IDE

check out SPE (StanisPpython Editor) KM On 9 Feb 2007 10:43:00 -0800, Bastos <[EMAIL PROTECTED]> wrote: On Feb 8, 10:03 am, "Srikanth" <[EMAIL PROTECTED]> wrote: > Yes, > > All I need is a good IDE, I can't find something like Eclipse (JDT). > Eclipse has

module organization/inheritance problem

ork ? am i missing something ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

module level subclassing

that possible ? kindly enlighten regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: comparing dictionaries to find the identical keys

ent or not in the other list and then print corresponding values. Alternately this can also be done with sets module by converting the list into a set object and do a simple intersection of the two sets, by which u get the commonly occuring items. HTH KM > -- > http://mail.python.org/mailman/listinfo/python-list > -- http://mail.python.org/mailman/listinfo/python-list

Re: joining rows

s > > Looking at the answer u require , u can clearly make a dictionary if list datastructure! where dictionary keys are A,B, C ,D and corresponding values are list if items (ie., 1,2,3 ...) Once u have such a dict loaded, its kust a matter of accessing that list via a key and display

Re: Python Trajectory Module?

Hi have a look at these demos (includes trajectory etc) with VPython http://showmedo.com/videos/series?name=pythonThompsonVPythonSeries best wishes, KM -- On Jan 2, 2008 5

Re: A GUI framework for running simulations

Hi, check SimPy module and then http://www.showmedo.com/videos/series?name=pythonThompsonVPythonSeries KM On Jan 23, 2008 8:10 PM, Guilherme Polo <[EMAIL PROTECTED]> wrote: > 2008/1/23, [EMAIL PROTECTED] <[EMAIL PROTECTED]>: > > Hello! I am currently working on writing a

Re: Embarrasing questio

Hi, you could do it this way also : if i in [3,5]: do something... KM ~ On Fri, Feb 13, 2009 at 1:19 AM, Michele Simionato < michele.simion...@gmail.com> wrote: > On Feb 12, 5:07 pm, TechieInsights wrote: > > On Feb 12, 9:03 am, Catherine Heathcote

multiprocessing python2.6.1

? thanks in advance. KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Geometry package

Hi, I hope this is what u need : http://cgal-python.gforge.inria.fr/ HTH KM On Sun, Mar 29, 2009 at 1:55 AM, Justin Pearson wrote: > Hi all, > > I'm looking for a geometry package in Python; something that will let > me define line segments, and can tell me if two line segment

update python version

Hi all, Is there a way to update python 2.6.1 to 2.6.2 using easy_install ? thanks, regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: ANN: Resolver One 1.2 released

Hi, sounds great - but disappointing to find it only available on window$. Is there any Linux release in near future ??? KM ~~ On Tue, Aug 19, 2008 at 6:10 PM, [EMAIL PROTECTED] < [EMAIL PROTECTED]> wrote: > We are proud to announce the r

Re: improving a huge double-for cycle

how abt this ? N = len(IN) for k in range(N): for j in range(N): if j >= k: # or k <= j doSomething() KM ~~~ On Thu, Sep 18, 2008 at 6:27 PM, Tim Chase <[EMAIL PROTECTED]>wrote: > Code: Select all >>for i in rang

python 3.x third party modules

Hi all, I would like to look at third party modules which are python 3.0 ready. could some one point me to such a resource ? If its not available, it would be useful to host a page regarding this on python.org ? any comments ? KM -- http://mail.python.org/mailman/listinfo/python-list

Re: python for *nix system admins

import os HTH KM ~~ On Sat, Sep 27, 2008 at 1:35 PM, Lars Stavholm <[EMAIL PROTECTED]> wrote: > Hi All, > > I'm new to this list and hoping that this is not off-topic. > If it is, please point me in the right direction. > > I seem to recollect a pyth

Re: Delaunay triangulation

check CGAL (cgal.org) it has python bindings Krishna On Wed, Dec 2, 2009 at 11:28 PM, David Robinow wrote: > On Tue, Dec 1, 2009 at 8:31 PM, Vincent Davis > wrote: > > Anyone know of a python implementation of Delaunay triangulation? > > Matplotlib has one. > There's also Delny @pypi > > It's

Re: Manyfile Processing

use glob module Krishna On Fri, Dec 4, 2009 at 6:37 PM, Diez B. Roggisch wrote: > u...@domain.invalid schrieb: > >> Hey, >> >> sorry if i bother you with a beginners question but i have an issue >> with processing a bunch of files. They are some arithmetic lists the >> processing of one file is

Implementation of Book Organization tool (Python2.[x])

Hi together, I'm a python-proficient newbie and want to tackle a program with Python 2.x, which basically organizes all my digital books (*.pdf, *.chm, etc..) and to give them specific "labels", such as: "Author" -> string "Read" -> boolean "Last Opened:" -> string and so on.. Now my question is

  1   2   >