Mensanator wrote:
What does this mean?
import turtle
tooter = turtle.Turtle()
*tooter*.tracer
Traceback (most recent call last):
File "", line 1, in
tooter.tracer
AttributeError: 'Turtle' object has no attribute 'tracer'
tooter.hideturtle()
tooter.speed('fast')
turtle.update()
*
In article <19e16923-b200-498b-9ab2-f7d316b56...@d32g2000yqh.googlegroups.com>,
r wrote:
>On Aug 2, 9:52=A0pm, a...@pythoncraft.com (Aahz) wrote:
>
>> Much as I hate to say, use a cross-platform GUI -- Tkinter comes with
>> Python,
>
>Why is Tkinter such a whipping boy of the Python community?
> Rog (R) wrote:
>R> I am porting a simple code from Perl, the website asks for usr/pwd and
>R> the server's side Perl script makes atemp ftp dir for file upload.
>R> The original Perl script connects okay, does its job. The same URL
>R> stuffed into FF3 performs the same way.
>R> My Python
I am using Python 2.5, and most of the cmath functions are not yet available
in this version. Thanks!
Phillip
P.S. In your code, that should be x+= 0J
P.P.S. I wish that the documentation indicated anything that is new.
Christian Heimes-2 wrote:
>
>
>
> phase() has been added to Python 2.
En Tue, 04 Aug 2009 10:15:24 -0300, IronyOfLife
escribió:
On Aug 3, 8:42 pm, "Gabriel Genellina" wrote:
En Mon, 03 Aug 2009 11:04:07 -0300, IronyOfLife
escribió:
> I have installed python 2.6.2 in windows xp professional machine. I
> have set the following environment variables -- PYTHONPA
On 2009-08-05 15:16, Dr. Phillip M. Feldman wrote:
I am using Python 2.5, and most of the cmath functions are not yet available
in this version. Thanks!
Phillip
P.S. In your code, that should be x+= 0J
P.P.S. I wish that the documentation indicated anything that is new.
It does.
http://doc
Hello there, I'm writting a debugger,
the problem is there no good interpretation ...
here's the codes:
my_debugger.py :
#!/usr/bin/env python
from ctypes import *
from my_debugger_defines import *
kernel32 = windll.kernel32
class debugger():
def __init__(self):
self.h_process = No
On Aug 5, 3:40 pm, sturlamolden wrote:
> On 5 Aug, 21:36, sturlamolden wrote:
>
> >http://svn.python.org/view/python/branches/release26-maint/Lib/multip...
>
> >http://svn.python.org/view/python/branches/release31-maint/Lib/multip...
>
> http://svn.python.org/view/python/trunk/Lib/multiprocessing
Hi everyone, I'm using the urllib2 library to get the html source code
of web pages. In general it works great, but I'm having to do with a
financial web site which does not provide the souce code I expect. As
a matter of fact if you try:
import urllib2
res = urllib2.urlopen("http://www.marketwatc
On 5 Aug, 22:07, Piet van Oostrum wrote:
> Calling os.exit in a child process may be dangerous. It can cause
> unflushed buffers to be flushed twice: once in the parent and once in
> the child.
I assume you mean sys.exit. If this is the case, multiprocessing needs
a mechanism to chose between os
On Aug 5, 1:09 pm, kj wrote:
> One of the nice things one can do with Perl's regexp's is illustrated
> in the following example:
>
> my $gly = qr/gg[ucag]/i
> my $ala = qr/gc[ucag]/i;
> my $val = qr/gu[ucag]/i;
> my $leu = qr/uu[ag]|cu[ucag]/i;
> my $ile = qr/au[uca]/i;
>
> my $aliphatic = qr/$gly
In kj writes:
>One of the nice things one can do with Perl's regexp's is illustrated
>in the following example:
>my $gly = qr/gg[ucag]/i
>my $ala = qr/gc[ucag]/i;
>my $val = qr/gu[ucag]/i;
>my $leu = qr/uu[ag]|cu[ucag]/i;
>my $ile = qr/au[uca]/i;
>my $aliphatic = qr/$gly|$ala|$val|$leu|$ile/
On 5 Aug, 20:41, "Martin P. Hellwig"
wrote:
> Paul Rubin wrote:
> > "Martin P. Hellwig" writes:
> >> Is there an advantage using shifts and masks over my kitchen type solution?
>
> > Weren't you complaining about the 8-to-1 expansion from turning each bit
> > to an ascii char?
>
> Yes you are (of
On Aug 5, 3:08 pm, Ethan Furman wrote:
> Mensanator wrote:
>
>
>
>
>
>
>
>
>
> > What does this mean?
>
> import turtle
> tooter = turtle.Turtle()
> *tooter*.tracer
>
> > Traceback (most recent call last):
> > File "", line 1, in
> > tooter.tracer
> > AttributeError: 'Turtle' o
On 5 Aug, 22:28, Jesse Noller wrote:
> http://bugs.python.org/issue6653
>
> In the future please use the bug tracker to file and track bugs with,
> so things are not as lossy.
Ok, sorry :)
Also see Piet's comment here. He has a valid case against sys.exit in
some cases. Thus it appears that bot
Postion Title - Sr. Software Development Engineer
Job Responsibilities
The Sr. Software Development Engineer will be responsible for the
design, development and implementation of the award-winning WordStream
suite of products.
Development is presently done primarily using Python on the server and
Jonathan Fine wrote:
> anyone here ever used the Python *embedded* in a database server.
There is also the case of using SQLite where it shares the same process as
your Python code (and nothing else) and is a standard part of the Python
library.
You can add your own functions and collations and i
On Aug 5, 4:41 pm, sturlamolden wrote:
> On 5 Aug, 22:28, Jesse Noller wrote:
>
> >http://bugs.python.org/issue6653
>
> > In the future please use the bug tracker to file and track bugs with,
> > so things are not as lossy.
>
> Ok, sorry :)
>
> Also see Piet's comment here. He has a valid case ag
On Aug 5, 12:56 pm, Gregor Lingl wrote:
> Mensanator schrieb:
>
>
>
>
>
> >> It didn't form 2.5 to 2.6 (at least not intentionally). But with the
> >> indroduction of the TurtleScreen class and the Screen class/object
> >> (singleton) a few of the turtle methods were also implemented as screen
> >
Philip Semanchuk schrieb:
On Aug 5, 2009, at 1:16 PM, Diez B. Roggisch wrote:
Hi,
I'm trying to wrap a C-API which has a call that takes a void* and a
size_t
as arguments.
void foo(void *data, size_t length)
The wrapper is supposed to be called with a python (byte)string instance,
which
On Thu, Aug 6, 2009 at 5:23 AM, Joshua Kugler wrote:
> Are you referring to Python 3.0? Python 2.6 does not have
> collections.UserDict
>
> j
>
Yes, I was sometimes it's hard to keep track what's not in 2.6 and in
3.1 for me, sorry. And thanks.
The ABC MutableMapping is still valid, though.
sturlamolden schrieb:
On 5 Aug, 19:16, "Diez B. Roggisch" wrote:
void foo(void *data, size_t length)
The wrapper is supposed to be called with a python (byte)string instance,
which might contain more than one '\0'-character.
So how do I access the raw data of a string?
cdef extern void foo
On Aug 5, 2009, at 5:19 PM, Diez B. Roggisch wrote:
Philip Semanchuk schrieb:
On Aug 5, 2009, at 1:16 PM, Diez B. Roggisch wrote:
Hi,
I'm trying to wrap a C-API which has a call that takes a void* and
a size_t
as arguments.
void foo(void *data, size_t length)
The wrapper is supposed to
google used to have a sitemap generator written in python, at:
https://www.google.com/webmasters/tools/docs/en/sitemap-generator.html
but the url is gone. It seems the current version is moved here:
http://code.google.com/p/googlesitemapgenerator/
and is written in JavaScript.
is the old python
On 5 Aug, 23:22, "Diez B. Roggisch" wrote:
> And that gives me the *full* bytestring, not only until the first zero?
> I can't try that right now (not at work anymore), but if it's that easy,
> that would be great.
It should, and if it does not it is a bug in Cython. The len()
function should wo
On 5 Aug, 22:44, Xah Lee wrote:
> google used to have a sitemap generator written in python, at:
> https://www.google.com/webmasters/tools/docs/en/sitemap-generator.html
>
> but the url is gone. It seems the current version is moved
> here:http://code.google.com/p/googlesitemapgenerator/
> and i
Jon Clements wrote:
Now please piddle off...
I am guessing west-midlands? :-)
--
MPH
http://blog.dcuktec.com
'If consumed, best digested with added seasoning to own preference.'
--
http://mail.python.org/mailman/listinfo/python-list
kj wrote:
In kj writes:
One of the nice things one can do with Perl's regexp's is illustrated
in the following example:
my $gly = qr/gg[ucag]/i
my $ala = qr/gc[ucag]/i;
my $val = qr/gu[ucag]/i;
my $leu = qr/uu[ag]|cu[ucag]/i;
my $ile = qr/au[uca]/i;
my $aliphatic = qr/$gly|$ala|$val|$
I fixed this to produce the actual image I'm looking
for instead of that stupid black square. All I did was
use up() & dowm() in place of penup(), pendown() and
replace dot(2) with forward(1).
I'll be posting a followup report later.
import gmpy
## (even) hi|
##|
##
Hi All,
Sorry if you get this twice, it seems to have gotten lost on its way
through python-announce.
I'm pleased to announce the first release of the "extprot" python
module. Extprot implements a compact, efficient, extensible and
language-neutral object serialisation protocol.
License:
On Wed, 05 Aug 2009 15:27:51 -0500, Robert Kern wrote:
> On 2009-08-05 15:16, Dr. Phillip M. Feldman wrote:
>> I am using Python 2.5, and most of the cmath functions are not yet
>> available in this version. Thanks!
>>
>> Phillip
>>
>> P.S. In your code, that should be x+= 0J
>>
>> P.P.S. I wish
Hi,
The expy project provides an express way to extend Python. After some careful
considerations, I came up with some reasons for expy (this is not an exhaustive
list):
(I). WYSIWYG. The expy project enables you to write your module in Python the
way your extension would be (WYSIWYG), and mea
In article
<373cf0740908051131gacaf77apba48fa40e929f...@mail.gmail.com>,
Jeremy Cowles wrote:
> Ok, I feel like this is a really stupid question, but how do you install
> setup tools for Python 2.6 under windows?
> The only format is .egg which requires setup tools to install, doesn't it?
http:
Hello! I am trying to call this method:
long _stdcall AIBurst(long *idnum,
long demo,
long stateIOin,
long updateIO,
long ledOn,
long numChannels,
l
On Aug 5, 5:31 pm, Mensanator wrote:
> I fixed this to produce the actual image I'm looking
> for instead of that stupid black square. All I did was
> use up() & dowm() in place of penup(), pendown() and
> replace dot(2) with forward(1).
>
> I'll be posting a followup report later.
>
http://www.m
Greetings!
I have seen posts about the assert statement and PbC (or maybe it was
DbC), and I just took a very brief look at pycontract
(http://www.wayforward.net/pycontract/) and now I have at least one
question: Is this basically another way of thinking about unit testing,
or is the idea of
Hi All, So here is the problem... I have a FASTA file (used for DNA
analyses) that looks like this:
...
>gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152
NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC
CGATATAGTGAAACTTCATTTCTACANTACCAAACGTCGCTCGGCAGAGCGTCG
On Thursday 06 August 2009, Yingjie Lan wrote:
> For more information about expy, please visit its homepage at:
> http://expy.sf.net/
looks very interesting, bookmarked.
In your example class mate, def rename looks wrong:
if malloc fails, the previous name should probably not
be replaced by an em
Is there any easy function in the stdlib to convert any random string in
a valid Python identifier .. possibly by replacing non-valid characters
with _ ?
Python 2.x only, so no need to do Unicode.
--
дамјан ( http://softver.org.mk/damjan/ )
Religion ends and philosophy begins,
just as alche
Dnia 06-08-2009 o 01:54:46 PeroMHC wrote:
This snippet represents 3 individual DNA sequences. Each sequences is
identified by the line starting with >
The complete file has about 10 million individual sequences.
A simple enough problem, I want to read in this data, and cut out the
last 76 lett
Dnia 06-08-2009 o 01:54:46 PeroMHC wrote:
This snippet represents 3 individual DNA sequences. Each sequences is
identified by the line starting with >
The complete file has about 10 million individual sequences.
A simple enough problem, I want to read in this data, and cut out the
last 76 lett
Дамјан Георгиевски wrote:
Is there any easy function in the stdlib to convert any random string in
a valid Python identifier .. possibly by replacing non-valid characters
with _ ?
Python 2.x only, so no need to do Unicode.
Lookup the 'maketrans' function in the 'string' module and the
'trans
PeroMHC wrote:
Hi All, So here is the problem... I have a FASTA file (used for DNA
analyses) that looks like this:
...
gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152
NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC
CGATATAGTGAAACTTCATTTCTACANTACCAAACG
> From: Wolfgang Rohdewald
> Subject: Re: using expy to extend python
> To: python-list@python.org
> Date: Thursday, August 6, 2009, 3:48 AM
> On Thursday 06 August 2009, Yingjie
> Lan wrote:
> > For more information about expy, please visit its
> homepage at:
> > http://expy.sf.net/
>
> looks v
En Wed, 05 Aug 2009 15:31:38 -0300, Jeremy Cowles
escribió:
Ok, I feel like this is a really stupid question, but how do you install
setup tools for Python 2.6 under windows?
The only format is .egg which requires setup tools to install, doesn't
it?
I have no idea, and I try to stay as far
This took a while to get a gui working. I am new at this coding.
This work with sqlite3 Python Version: 3.1.0. The older version
doesn't work.
#!/usr/local/bin/python
'''
This is for basic database access to view the information.
Python version: 3.1.0
Features:
-view database.
-run script
-u
En Wed, 05 Aug 2009 09:50:04 -0300, kpal
escribió:
The standard datetime has 1 microsecond granularity.
Note that this is the finest granularity a datetime object can store, NOT
the precision of datetime.now() by example.
My application
needs finer time resolution, preferably float seconds.
Mensanator schrieb:
On Aug 5, 5:31 pm, Mensanator wrote:
I fixed this to produce the actual image I'm looking
for instead of that stupid black square. All I did was
use up() & dowm() in place of penup(), pendown() and
replace dot(2) with forward(1).
I'll be posting a followup report later.
Jason Tackaberry urandom.ca> writes:
> On Wed, 2009-08-05 at 16:43 +0200, Michael Ströder wrote:
> > These both expressions are equivalent but which is faster or should be used
> > for any reason?
> > u = unicode(s,'utf-8')
> > u = s.decode('utf-8') # looks nicer
>
> It is sometimes non-obvious w
On Aug 5, 7:49 pm, Gregor Lingl wrote:
> Mensanator schrieb:
>
> > On Aug 5, 5:31 pm, Mensanator wrote:
> >> I fixed this to produce the actual image I'm looking
> >> for instead of that stupid black square. All I did was
> >> use up() & dowm() in place of penup(), pendown() and
> >> replace dot(
Hi all,
I'm quite new to cytpes and am having some troubles I was hoping I
could get a little help with. Before I get into the details this is
what I'm trying to accomplish - I would like to read a dng with python
pass it through either libraw.dll or dcraw.dll (notes on dcraw.dll
version at the en
On Aug 5, 3:44 pm, News123 wrote:
> You didn't really tell us why you need one big file, which contains more
> pixel, than you can probably store in RAM
>
In fact I do not need such a big image.
I just want to know the solution.
> Is it for printing?
> Not knwoing your goal makes it difficult t
"Martin P. Hellwig" writes:
> Is there an advantage using shifts and masks over my kitchen type solution?
Weren't you complaining about the 8-to-1 expansion from turning each bit
to an ascii char?
--
http://mail.python.org/mailman/listinfo/python-list
Hi,
I wrote a program which runs a .bat file using os.system like:
'os.system(pathToBatFile)' and everything was good. Then I decided to turn my
program into a service as opposed to being run with the command prompt showing.
When my program became a service, I noticed that the os.system comm
Xavier Ho wrote:
> You should subclass collections.UserDict, and not the default dict class.
> Refer to the collections module.
Xavier, why do you think that is the correct approach? The docs say
"The need for this class has been largely supplanted by the ability to
subclass directly from dict (a
On Aug 4, 12:55 am, David Lyon wrote:
> It isn't totally about the writers...
> Peoples egos are also at stake - it seems.
> If "Fred X wrote Doc Y".. they don't want their name taken off.. So
> they generally speaking don't want the docs changed.
> If you talk too much about docs.. you can be tol
Hi,
I'm using the oNVDL java validator for my DocBook 5.0 documents. Otherwise,
my doc system is python. I wonder if there is any work going on (or perhaps
something I'm missing) to use python to validate DocBook 5 (using the rng
files bundled with the DocBook5 distribution)
I think the catch w
"Kosta" wrote in message
news:84d9ae10-3aee-40a8-97ac-05799da0d...@f18g2000prf.googlegroups.com...
>I am a Python newbie, tasked with automating (researching) building
> Windows drivers using the WDK build environment. I've been looking
> into Python for this (instead of writing a bunch of batc
At 08:35 PM 8/5/2009 -0700, r wrote:
"""... Any real
sense of community is undermined -- or
even destroyed -- to be replaced by virtual equivalents that
strive,
unsuccessfully, to synthesize a sense of
community."""
I've brought up the idea of the quasi-community doc
that PHP uses to good effect
MalC0de wrote:
Hello there, I'm writting a debugger,
the problem is there no good interpretation ...
here's the codes:
my_debugger.py :
#!/usr/bin/env python
from ctypes import *
from my_debugger_defines import *
kernel32 = windll.kernel32
class debugger():
def __init__(self):
s
En Wed, 05 Aug 2009 20:12:09 -0300, Sparky escribió:
Hello! I am trying to call this method:
long _stdcall AIBurst(long *idnum, [...]
long timeout,
float (*voltages)[4],
long *stateIOout,
long *
Massi wrote:
Hi everyone, I'm using the urllib2 library to get the html source code
of web pages. In general it works great, but I'm having to do with a
financial web site which does not provide the souce code I expect. As
a matter of fact if you try:
import urllib2
res = urllib2.urlopen("http:/
> M2Crypto has a couple of bugs open related that, with potential
> workarounds that I haven't yet deemed polished enough to checkin, but
> which might help you out:
>
> https://bugzilla.osafoundation.org/show_bug.cgi?id=7530
> https://bugzilla.osafoundation.org/show_bug.cgi?id=12151
Thanks, that
En Wed, 05 Aug 2009 13:07:39 -0300, Lawrence Wong
escribió:
I wrote a program which runs a .bat file using os.system like:
'os.system(pathToBatFile)' and everything was good. Then I decided to
turn my program into a service as opposed to being run with the command
prompt showing. When
En Wed, 05 Aug 2009 11:46:13 -0300, Martin P. Hellwig
escribió:
On several occasions I have needed (and build) a parser that reads a
binary piece of data with custom structure. For example (bogus one):
BE
+-+-+-+-+--++
| Version | Command
DH wrote:
I'm using popen to capture dcraw stdout and want to pass it to
magickwand. If I instead write the dcraw output to a file then read it
with magickwand I get the same error. But if I comment out the dcraw
protion and read the dcraw output file from the previous attempt,
MagickWand opens
On Wednesday 05 August 2009 14:50:04 kpal wrote:
> Hello Everybody,
>
> The standard datetime has 1 microsecond granularity. My application
> needs finer time resolution, preferably float seconds. Is there an
> alternative to the out-of-the-box datetime? Timezone support is not
> essential.
I am c
Paul Rubin wrote:
"Martin P. Hellwig" writes:
Is there an advantage using shifts and masks over my kitchen type solution?
Weren't you complaining about the 8-to-1 expansion from turning each bit
to an ascii char?
One warning to Martin:
If you want your code portable across syste
101 - 168 of 168 matches
Mail list logo
