Re: Need help with a program

2010-01-28 Thread evilweasel
I will make my question a little more clearer. I have close to 60,000 lines of the data similar to the one I posted. There are various numbers next to the sequence (this is basically the number of times the sequence has been found in a particular sample). So, I would need to ignore the ones contain

Need help with a program

2010-01-28 Thread evilweasel
Hi folks, I am a newbie to python, and I would be grateful if someone could point out the mistake in my program. Basically, I have a huge text file similar to the format below: AGACTCGAGTGCGCGGA 0 AGATAAGCTAATTAAGCTACTGG 0 AGATAAGCTAATTAAGCTACTGGGTT 1 AGCTCACAA