concatenate fasta file

2010-02-12 Thread PeroMHC
Hi All, I have a simple problem that I hope somebody can help with. I have an input file (a fasta file) that I need to edit.. Input file format >name 1 tactcatacatac >name 2 acggtggcat >name 3 gggtaccacgtt I need to concatenate the sequences.. make them look like >concatenated tactcatacatacacg

remove last 76 letters from string

2009-08-05 Thread PeroMHC
Hi All, So here is the problem... I have a FASTA file (used for DNA analyses) that looks like this: ... >gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152 NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC CGATATAGTGAAACTTCATTTCTACANTACCAAACGTCGCTCGGCAGAGCGTCG