On 2007-06-25, [EMAIL PROTECTED] <[EMAIL PROTECTED]> wrote:
> On Jun 25, 1:43 am, "Martin v. Löwis" <[EMAIL PROTECTED]> wrote:
>> [EMAIL PROTECTED] schrieb:
>>
>> > This wiki page suggests using a chroot jail to sandbox Python, but
>> > wouldn't running something like this in your sandboxed Python
On 2007-04-11, [EMAIL PROTECTED] <[EMAIL PROTECTED]> wrote:
> On Apr 11, 9:14 am, Marc 'BlackJack' Rintsch <[EMAIL PROTECTED]> wrote:
>> In <[EMAIL PROTECTED]>, shamzz wrote:
>> > Shouldn't zlib be compiled as a Python module automatically in Python
>> > 2.4.4. I'm guessing Python is doing some ki
On 2007-03-22, Jaroslaw Zabiello <[EMAIL PROTECTED]> wrote:
> I try to connect to web services (written in C#/.NET) with latest ZSI
> 2.0rc3 library. It just does not work.
>
> from ZSI.ServiceProxy import ServiceProxy
> wsdl = 'http://192.168.0.103/NewWebServices/TemplateInsert.asmx?wsdl'
> prin
On 2006-12-02, Robert Kern <[EMAIL PROTECTED]> wrote:
> Beliavsky wrote:
>> When I print an array in any language, I (and I think most programmers)
>> expect by default to have all elements displayed. Matlab, R, and
>> Fortran 95 have somewhat similar arrays to numpy, and that is what they
>> do. I
In article <[EMAIL PROTECTED]>, nuttydevil wrote:
> I have many notepad documents that all contain long chunks of genetic
> code. They look something like this:
>
> atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
> tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
> agcgtgg
In article <[EMAIL PROTECTED]>, Sandro Dentella wrote:
> Il 2006-01-09, John Bauman <[EMAIL PROTECTED]> ha scritto:
>>
>> "Sandro Dentella" <[EMAIL PROTECTED]> wrote in message
>> news:[EMAIL PROTECTED]
>>>I need a (decent) canvas for PyGTK. I used tkinter.canvas with real
>>>pleasure
>>> in the
In article <[EMAIL PROTECTED]>, Greg Stein wrote:
> Guido would acknowledge a query, but never announce it. That's not his
> style.
>
> This should have a positive impact on Python. His job description has a
> *very* significant portion of his time dedicated specifically to
> working on Python. (m
In article <[EMAIL PROTECTED]>, tooper wrote:
> Hello,
>
> Did anybody tried python pickle module over heterogeneous 32/64 bits
> mpi exchanges to overcome the translation problem ? i.e. pickling on
> one side (let's say a 32-bits OS side), sending the buffer as string
> through mpi and unpickling
In article <[EMAIL PROTECTED]>, [EMAIL PROTECTED] wrote:
> Hi,
>
> has anybody thought of / already used graphviz to convert the output of
> trace.py into a graph? I looked at PyUMLGraph, but 1. PyUMLGraph does
> not successfully create a dot file, and 2. I don't really want a UML
> representation
In article <[EMAIL PROTECTED]>, Ben Finney wrote:
> Brian Victor <[EMAIL PROTECTED]> wrote:
>> [EMAIL PROTECTED] wrote:
>> > Torsten Bronger wrote:
>> >> I've been having a closer look at wxPython which is not Pythonic at
>> >> all and bad documented. Probably I'll use it nevertheless.
>> > Aye.
On 2005-08-10, Peter Hansen <[EMAIL PROTECTED]> wrote:
> David E. Konerding DSD staff wrote:
>> Further, calling wx from a thread other than the one running the event
> > loop is deep voodoo and should typically be avoided.
>
> "Typically"? Let's
On 2005-08-10, Bryan Olson <[EMAIL PROTECTED]> wrote:
> > The easiest approach, though, is to use the threadedselectreactor in
> Twisted (you need
> > to check the HEAD branch out with subversion, because that reactor
> isn't included in any releases).
> > With threadedselectreactor, it's easy to
In article <[EMAIL PROTECTED]>, perchef wrote:
> Hi,
>
> I have several files to download and a GUI to update. I know this is a
> frequently asked question but i can't find an appropriate solution.
> My Downloader extends threading.Thread and update a wx.Gauge in GUI
> during the process.
>
> for
In article <[EMAIL PROTECTED]>, Randall Hopper wrote:
> Thomas Heller:
> |> Python -> C++ -> Python Callback
> |>
> |> (example attached) an exception raised in the callback doesn't make it back
> |> across C++ to Python.
> ...
> |> void callback_wrapper( void *user_data )
> |> {
> |> // Acq
On 2005-02-26, Just <[EMAIL PROTECTED]> wrote:
> While googling for a non-linear equation solver, I found
> Math::Polynomial::Solve in CPAN. It seems a great little module, except
> it's not Python... I'm especially looking for its poly_root()
> functionality (which solves arbitrary polynomials)
In article <[EMAIL PROTECTED]>, Chris Lasher wrote:
> Hello,
> I have a rather large (100+ MB) FASTA file from which I need to
> access records in a random order. The FASTA format is a standard format
> for storing molecular biological sequences. Each record contains a
> header line for describing
16 matches
Mail list logo
