Paul Rubin wrote:
"Martin P. Hellwig" writes:
Is there an advantage using shifts and masks over my kitchen type solution?
Weren't you complaining about the 8-to-1 expansion from turning each bit
to an ascii char?
One warning to Martin:
If you want your code portable across syste
On Wednesday 05 August 2009 14:50:04 kpal wrote:
> Hello Everybody,
>
> The standard datetime has 1 microsecond granularity. My application
> needs finer time resolution, preferably float seconds. Is there an
> alternative to the out-of-the-box datetime? Timezone support is not
> essential.
I am c
DH wrote:
I'm using popen to capture dcraw stdout and want to pass it to
magickwand. If I instead write the dcraw output to a file then read it
with magickwand I get the same error. But if I comment out the dcraw
protion and read the dcraw output file from the previous attempt,
MagickWand opens
En Wed, 05 Aug 2009 11:46:13 -0300, Martin P. Hellwig
escribió:
On several occasions I have needed (and build) a parser that reads a
binary piece of data with custom structure. For example (bogus one):
BE
+-+-+-+-+--++
| Version | Command
En Wed, 05 Aug 2009 13:07:39 -0300, Lawrence Wong
escribió:
I wrote a program which runs a .bat file using os.system like:
'os.system(pathToBatFile)' and everything was good. Then I decided to
turn my program into a service as opposed to being run with the command
prompt showing. When
> M2Crypto has a couple of bugs open related that, with potential
> workarounds that I haven't yet deemed polished enough to checkin, but
> which might help you out:
>
> https://bugzilla.osafoundation.org/show_bug.cgi?id=7530
> https://bugzilla.osafoundation.org/show_bug.cgi?id=12151
Thanks, that
Massi wrote:
Hi everyone, I'm using the urllib2 library to get the html source code
of web pages. In general it works great, but I'm having to do with a
financial web site which does not provide the souce code I expect. As
a matter of fact if you try:
import urllib2
res = urllib2.urlopen("http:/
En Wed, 05 Aug 2009 20:12:09 -0300, Sparky escribió:
Hello! I am trying to call this method:
long _stdcall AIBurst(long *idnum, [...]
long timeout,
float (*voltages)[4],
long *stateIOout,
long *
MalC0de wrote:
Hello there, I'm writting a debugger,
the problem is there no good interpretation ...
here's the codes:
my_debugger.py :
#!/usr/bin/env python
from ctypes import *
from my_debugger_defines import *
kernel32 = windll.kernel32
class debugger():
def __init__(self):
s
At 08:35 PM 8/5/2009 -0700, r wrote:
"""... Any real
sense of community is undermined -- or
even destroyed -- to be replaced by virtual equivalents that
strive,
unsuccessfully, to synthesize a sense of
community."""
I've brought up the idea of the quasi-community doc
that PHP uses to good effect
"Kosta" wrote in message
news:84d9ae10-3aee-40a8-97ac-05799da0d...@f18g2000prf.googlegroups.com...
>I am a Python newbie, tasked with automating (researching) building
> Windows drivers using the WDK build environment. I've been looking
> into Python for this (instead of writing a bunch of batc
Hi,
I'm using the oNVDL java validator for my DocBook 5.0 documents. Otherwise,
my doc system is python. I wonder if there is any work going on (or perhaps
something I'm missing) to use python to validate DocBook 5 (using the rng
files bundled with the DocBook5 distribution)
I think the catch w
On Aug 4, 12:55 am, David Lyon wrote:
> It isn't totally about the writers...
> Peoples egos are also at stake - it seems.
> If "Fred X wrote Doc Y".. they don't want their name taken off.. So
> they generally speaking don't want the docs changed.
> If you talk too much about docs.. you can be tol
Xavier Ho wrote:
> You should subclass collections.UserDict, and not the default dict class.
> Refer to the collections module.
Xavier, why do you think that is the correct approach? The docs say
"The need for this class has been largely supplanted by the ability to
subclass directly from dict (a
Hi,
I wrote a program which runs a .bat file using os.system like:
'os.system(pathToBatFile)' and everything was good. Then I decided to turn my
program into a service as opposed to being run with the command prompt showing.
When my program became a service, I noticed that the os.system comm
"Martin P. Hellwig" writes:
> Is there an advantage using shifts and masks over my kitchen type solution?
Weren't you complaining about the 8-to-1 expansion from turning each bit
to an ascii char?
--
http://mail.python.org/mailman/listinfo/python-list
On Aug 5, 3:44 pm, News123 wrote:
> You didn't really tell us why you need one big file, which contains more
> pixel, than you can probably store in RAM
>
In fact I do not need such a big image.
I just want to know the solution.
> Is it for printing?
> Not knwoing your goal makes it difficult t
Hi all,
I'm quite new to cytpes and am having some troubles I was hoping I
could get a little help with. Before I get into the details this is
what I'm trying to accomplish - I would like to read a dng with python
pass it through either libraw.dll or dcraw.dll (notes on dcraw.dll
version at the en
On Aug 5, 7:49 pm, Gregor Lingl wrote:
> Mensanator schrieb:
>
> > On Aug 5, 5:31 pm, Mensanator wrote:
> >> I fixed this to produce the actual image I'm looking
> >> for instead of that stupid black square. All I did was
> >> use up() & dowm() in place of penup(), pendown() and
> >> replace dot(
Jason Tackaberry urandom.ca> writes:
> On Wed, 2009-08-05 at 16:43 +0200, Michael Ströder wrote:
> > These both expressions are equivalent but which is faster or should be used
> > for any reason?
> > u = unicode(s,'utf-8')
> > u = s.decode('utf-8') # looks nicer
>
> It is sometimes non-obvious w
Mensanator schrieb:
On Aug 5, 5:31 pm, Mensanator wrote:
I fixed this to produce the actual image I'm looking
for instead of that stupid black square. All I did was
use up() & dowm() in place of penup(), pendown() and
replace dot(2) with forward(1).
I'll be posting a followup report later.
En Wed, 05 Aug 2009 09:50:04 -0300, kpal
escribió:
The standard datetime has 1 microsecond granularity.
Note that this is the finest granularity a datetime object can store, NOT
the precision of datetime.now() by example.
My application
needs finer time resolution, preferably float seconds.
This took a while to get a gui working. I am new at this coding.
This work with sqlite3 Python Version: 3.1.0. The older version
doesn't work.
#!/usr/local/bin/python
'''
This is for basic database access to view the information.
Python version: 3.1.0
Features:
-view database.
-run script
-u
En Wed, 05 Aug 2009 15:31:38 -0300, Jeremy Cowles
escribió:
Ok, I feel like this is a really stupid question, but how do you install
setup tools for Python 2.6 under windows?
The only format is .egg which requires setup tools to install, doesn't
it?
I have no idea, and I try to stay as far
> From: Wolfgang Rohdewald
> Subject: Re: using expy to extend python
> To: python-list@python.org
> Date: Thursday, August 6, 2009, 3:48 AM
> On Thursday 06 August 2009, Yingjie
> Lan wrote:
> > For more information about expy, please visit its
> homepage at:
> > http://expy.sf.net/
>
> looks v
PeroMHC wrote:
Hi All, So here is the problem... I have a FASTA file (used for DNA
analyses) that looks like this:
...
gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152
NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC
CGATATAGTGAAACTTCATTTCTACANTACCAAACG
Дамјан Георгиевски wrote:
Is there any easy function in the stdlib to convert any random string in
a valid Python identifier .. possibly by replacing non-valid characters
with _ ?
Python 2.x only, so no need to do Unicode.
Lookup the 'maketrans' function in the 'string' module and the
'trans
Dnia 06-08-2009 o 01:54:46 PeroMHC wrote:
This snippet represents 3 individual DNA sequences. Each sequences is
identified by the line starting with >
The complete file has about 10 million individual sequences.
A simple enough problem, I want to read in this data, and cut out the
last 76 lett
Dnia 06-08-2009 o 01:54:46 PeroMHC wrote:
This snippet represents 3 individual DNA sequences. Each sequences is
identified by the line starting with >
The complete file has about 10 million individual sequences.
A simple enough problem, I want to read in this data, and cut out the
last 76 lett
Is there any easy function in the stdlib to convert any random string in
a valid Python identifier .. possibly by replacing non-valid characters
with _ ?
Python 2.x only, so no need to do Unicode.
--
дамјан ( http://softver.org.mk/damjan/ )
Religion ends and philosophy begins,
just as alche
On Thursday 06 August 2009, Yingjie Lan wrote:
> For more information about expy, please visit its homepage at:
> http://expy.sf.net/
looks very interesting, bookmarked.
In your example class mate, def rename looks wrong:
if malloc fails, the previous name should probably not
be replaced by an em
Hi All, So here is the problem... I have a FASTA file (used for DNA
analyses) that looks like this:
...
>gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152
NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC
CGATATAGTGAAACTTCATTTCTACANTACCAAACGTCGCTCGGCAGAGCGTCG
Greetings!
I have seen posts about the assert statement and PbC (or maybe it was
DbC), and I just took a very brief look at pycontract
(http://www.wayforward.net/pycontract/) and now I have at least one
question: Is this basically another way of thinking about unit testing,
or is the idea of
On Aug 5, 5:31 pm, Mensanator wrote:
> I fixed this to produce the actual image I'm looking
> for instead of that stupid black square. All I did was
> use up() & dowm() in place of penup(), pendown() and
> replace dot(2) with forward(1).
>
> I'll be posting a followup report later.
>
http://www.m
Hello! I am trying to call this method:
long _stdcall AIBurst(long *idnum,
long demo,
long stateIOin,
long updateIO,
long ledOn,
long numChannels,
l
In article
<373cf0740908051131gacaf77apba48fa40e929f...@mail.gmail.com>,
Jeremy Cowles wrote:
> Ok, I feel like this is a really stupid question, but how do you install
> setup tools for Python 2.6 under windows?
> The only format is .egg which requires setup tools to install, doesn't it?
http:
Hi,
The expy project provides an express way to extend Python. After some careful
considerations, I came up with some reasons for expy (this is not an exhaustive
list):
(I). WYSIWYG. The expy project enables you to write your module in Python the
way your extension would be (WYSIWYG), and mea
On Wed, 05 Aug 2009 15:27:51 -0500, Robert Kern wrote:
> On 2009-08-05 15:16, Dr. Phillip M. Feldman wrote:
>> I am using Python 2.5, and most of the cmath functions are not yet
>> available in this version. Thanks!
>>
>> Phillip
>>
>> P.S. In your code, that should be x+= 0J
>>
>> P.P.S. I wish
Hi All,
Sorry if you get this twice, it seems to have gotten lost on its way
through python-announce.
I'm pleased to announce the first release of the "extprot" python
module. Extprot implements a compact, efficient, extensible and
language-neutral object serialisation protocol.
License:
I fixed this to produce the actual image I'm looking
for instead of that stupid black square. All I did was
use up() & dowm() in place of penup(), pendown() and
replace dot(2) with forward(1).
I'll be posting a followup report later.
import gmpy
## (even) hi|
##|
##
kj wrote:
In kj writes:
One of the nice things one can do with Perl's regexp's is illustrated
in the following example:
my $gly = qr/gg[ucag]/i
my $ala = qr/gc[ucag]/i;
my $val = qr/gu[ucag]/i;
my $leu = qr/uu[ag]|cu[ucag]/i;
my $ile = qr/au[uca]/i;
my $aliphatic = qr/$gly|$ala|$val|$
Jon Clements wrote:
Now please piddle off...
I am guessing west-midlands? :-)
--
MPH
http://blog.dcuktec.com
'If consumed, best digested with added seasoning to own preference.'
--
http://mail.python.org/mailman/listinfo/python-list
On 5 Aug, 22:44, Xah Lee wrote:
> google used to have a sitemap generator written in python, at:
> https://www.google.com/webmasters/tools/docs/en/sitemap-generator.html
>
> but the url is gone. It seems the current version is moved
> here:http://code.google.com/p/googlesitemapgenerator/
> and i
On 5 Aug, 23:22, "Diez B. Roggisch" wrote:
> And that gives me the *full* bytestring, not only until the first zero?
> I can't try that right now (not at work anymore), but if it's that easy,
> that would be great.
It should, and if it does not it is a bug in Cython. The len()
function should wo
google used to have a sitemap generator written in python, at:
https://www.google.com/webmasters/tools/docs/en/sitemap-generator.html
but the url is gone. It seems the current version is moved here:
http://code.google.com/p/googlesitemapgenerator/
and is written in JavaScript.
is the old python
On Aug 5, 2009, at 5:19 PM, Diez B. Roggisch wrote:
Philip Semanchuk schrieb:
On Aug 5, 2009, at 1:16 PM, Diez B. Roggisch wrote:
Hi,
I'm trying to wrap a C-API which has a call that takes a void* and
a size_t
as arguments.
void foo(void *data, size_t length)
The wrapper is supposed to
sturlamolden schrieb:
On 5 Aug, 19:16, "Diez B. Roggisch" wrote:
void foo(void *data, size_t length)
The wrapper is supposed to be called with a python (byte)string instance,
which might contain more than one '\0'-character.
So how do I access the raw data of a string?
cdef extern void foo
On Thu, Aug 6, 2009 at 5:23 AM, Joshua Kugler wrote:
> Are you referring to Python 3.0? Python 2.6 does not have
> collections.UserDict
>
> j
>
Yes, I was sometimes it's hard to keep track what's not in 2.6 and in
3.1 for me, sorry. And thanks.
The ABC MutableMapping is still valid, though.
Philip Semanchuk schrieb:
On Aug 5, 2009, at 1:16 PM, Diez B. Roggisch wrote:
Hi,
I'm trying to wrap a C-API which has a call that takes a void* and a
size_t
as arguments.
void foo(void *data, size_t length)
The wrapper is supposed to be called with a python (byte)string instance,
which
On Aug 5, 12:56 pm, Gregor Lingl wrote:
> Mensanator schrieb:
>
>
>
>
>
> >> It didn't form 2.5 to 2.6 (at least not intentionally). But with the
> >> indroduction of the TurtleScreen class and the Screen class/object
> >> (singleton) a few of the turtle methods were also implemented as screen
> >
On Aug 5, 4:41 pm, sturlamolden wrote:
> On 5 Aug, 22:28, Jesse Noller wrote:
>
> >http://bugs.python.org/issue6653
>
> > In the future please use the bug tracker to file and track bugs with,
> > so things are not as lossy.
>
> Ok, sorry :)
>
> Also see Piet's comment here. He has a valid case ag
Jonathan Fine wrote:
> anyone here ever used the Python *embedded* in a database server.
There is also the case of using SQLite where it shares the same process as
your Python code (and nothing else) and is a standard part of the Python
library.
You can add your own functions and collations and i
Postion Title - Sr. Software Development Engineer
Job Responsibilities
The Sr. Software Development Engineer will be responsible for the
design, development and implementation of the award-winning WordStream
suite of products.
Development is presently done primarily using Python on the server and
On 5 Aug, 22:28, Jesse Noller wrote:
> http://bugs.python.org/issue6653
>
> In the future please use the bug tracker to file and track bugs with,
> so things are not as lossy.
Ok, sorry :)
Also see Piet's comment here. He has a valid case against sys.exit in
some cases. Thus it appears that bot
On Aug 5, 3:08 pm, Ethan Furman wrote:
> Mensanator wrote:
>
>
>
>
>
>
>
>
>
> > What does this mean?
>
> import turtle
> tooter = turtle.Turtle()
> *tooter*.tracer
>
> > Traceback (most recent call last):
> > File "", line 1, in
> > tooter.tracer
> > AttributeError: 'Turtle' o
On 5 Aug, 20:41, "Martin P. Hellwig"
wrote:
> Paul Rubin wrote:
> > "Martin P. Hellwig" writes:
> >> Is there an advantage using shifts and masks over my kitchen type solution?
>
> > Weren't you complaining about the 8-to-1 expansion from turning each bit
> > to an ascii char?
>
> Yes you are (of
In kj writes:
>One of the nice things one can do with Perl's regexp's is illustrated
>in the following example:
>my $gly = qr/gg[ucag]/i
>my $ala = qr/gc[ucag]/i;
>my $val = qr/gu[ucag]/i;
>my $leu = qr/uu[ag]|cu[ucag]/i;
>my $ile = qr/au[uca]/i;
>my $aliphatic = qr/$gly|$ala|$val|$leu|$ile/
On Aug 5, 1:09 pm, kj wrote:
> One of the nice things one can do with Perl's regexp's is illustrated
> in the following example:
>
> my $gly = qr/gg[ucag]/i
> my $ala = qr/gc[ucag]/i;
> my $val = qr/gu[ucag]/i;
> my $leu = qr/uu[ag]|cu[ucag]/i;
> my $ile = qr/au[uca]/i;
>
> my $aliphatic = qr/$gly
On 5 Aug, 22:07, Piet van Oostrum wrote:
> Calling os.exit in a child process may be dangerous. It can cause
> unflushed buffers to be flushed twice: once in the parent and once in
> the child.
I assume you mean sys.exit. If this is the case, multiprocessing needs
a mechanism to chose between os
Hi everyone, I'm using the urllib2 library to get the html source code
of web pages. In general it works great, but I'm having to do with a
financial web site which does not provide the souce code I expect. As
a matter of fact if you try:
import urllib2
res = urllib2.urlopen("http://www.marketwatc
On Aug 5, 3:40 pm, sturlamolden wrote:
> On 5 Aug, 21:36, sturlamolden wrote:
>
> >http://svn.python.org/view/python/branches/release26-maint/Lib/multip...
>
> >http://svn.python.org/view/python/branches/release31-maint/Lib/multip...
>
> http://svn.python.org/view/python/trunk/Lib/multiprocessing
Hello there, I'm writting a debugger,
the problem is there no good interpretation ...
here's the codes:
my_debugger.py :
#!/usr/bin/env python
from ctypes import *
from my_debugger_defines import *
kernel32 = windll.kernel32
class debugger():
def __init__(self):
self.h_process = No
On 2009-08-05 15:16, Dr. Phillip M. Feldman wrote:
I am using Python 2.5, and most of the cmath functions are not yet available
in this version. Thanks!
Phillip
P.S. In your code, that should be x+= 0J
P.P.S. I wish that the documentation indicated anything that is new.
It does.
http://doc
En Tue, 04 Aug 2009 10:15:24 -0300, IronyOfLife
escribió:
On Aug 3, 8:42 pm, "Gabriel Genellina" wrote:
En Mon, 03 Aug 2009 11:04:07 -0300, IronyOfLife
escribió:
> I have installed python 2.6.2 in windows xp professional machine. I
> have set the following environment variables -- PYTHONPA
I am using Python 2.5, and most of the cmath functions are not yet available
in this version. Thanks!
Phillip
P.S. In your code, that should be x+= 0J
P.P.S. I wish that the documentation indicated anything that is new.
Christian Heimes-2 wrote:
>
>
>
> phase() has been added to Python 2.
> Rog (R) wrote:
>R> I am porting a simple code from Perl, the website asks for usr/pwd and
>R> the server's side Perl script makes atemp ftp dir for file upload.
>R> The original Perl script connects okay, does its job. The same URL
>R> stuffed into FF3 performs the same way.
>R> My Python
In article <19e16923-b200-498b-9ab2-f7d316b56...@d32g2000yqh.googlegroups.com>,
r wrote:
>On Aug 2, 9:52=A0pm, a...@pythoncraft.com (Aahz) wrote:
>
>> Much as I hate to say, use a cross-platform GUI -- Tkinter comes with
>> Python,
>
>Why is Tkinter such a whipping boy of the Python community?
Mensanator wrote:
What does this mean?
import turtle
tooter = turtle.Turtle()
*tooter*.tracer
Traceback (most recent call last):
File "", line 1, in
tooter.tracer
AttributeError: 'Turtle' object has no attribute 'tracer'
tooter.hideturtle()
tooter.speed('fast')
turtle.update()
*
One of the nice things one can do with Perl's regexp's is illustrated
in the following example:
my $gly = qr/gg[ucag]/i
my $ala = qr/gc[ucag]/i;
my $val = qr/gu[ucag]/i;
my $leu = qr/uu[ag]|cu[ucag]/i;
my $ile = qr/au[uca]/i;
my $aliphatic = qr/$gly|$ala|$val|$leu|$ile/;
In other words, one c
> sturlamolden (s) wrote:
>s> On 5 Aug, 15:40, Jesse Noller wrote:
>>> Sturla;
>>>
>>> That bug was fixed unless I'm missing something.
>s> It is still in SVN. Change every call to os._exit to sys.exit
>s> please. :)
Calling os.exit in a child process may be dangerous. It can cause
unflus
On 5 Aug., 21:31, Mensanator wrote:
>
> >>> import turtle
> >>> tooter = turtle.Turtle()
> >>> tooter.tracer
>
> Traceback (most recent call last):
> File "", line 1, in
> tooter.tracer
> AttributeError: 'Turtle' object has no attribute 'tracer'>>>
> tooter.hideturtle()
> >>> tooter.speed(
In <00027aa9$0$2969$c3e8...@news.astraweb.com> Steven D'Aprano
writes:
>No problem. Here you go:
>http://www.cybersource.com.au/users/steve/python/constants.py
Extremely helpful. Thanks!
kynn
--
http://mail.python.org/mailman/listinfo/python-list
On Aug 4, 10:37 pm, erikcw wrote:
> Traceback (most recent call last):
> File "scraper.py", line 144, in
> print pool.map(scrape, range(10))
> File "/usr/lib/python2.6/multiprocessing/pool.py", line 148, in map
> return self.map_async(func, iterable, chunksize).get()
> File "/usr/li
Paul Rubin wrote:
"Martin P. Hellwig" writes:
Is there an advantage using shifts and masks over my kitchen type solution?
Weren't you complaining about the 8-to-1 expansion from turning each bit
to an ascii char?
Yes you are (of course) right, my 'dream' solution would be something
that ac
On 5 Aug, 21:36, sturlamolden wrote:
> http://svn.python.org/view/python/branches/release26-maint/Lib/multip...
>
> http://svn.python.org/view/python/branches/release31-maint/Lib/multip...
http://svn.python.org/view/python/trunk/Lib/multiprocessing/forking.py?revision=65864&view=markup
--
http
On 5 Aug, 15:40, Jesse Noller wrote:
> Sturla;
>
> That bug was fixed unless I'm missing something.
It is still in SVN. Change every call to os._exit to sys.exit
please. :)
http://svn.python.org/view/python/branches/release26-maint/Lib/multiprocessing/forking.py?revision=66717&view=markup
http
On Aug 5, 2:19 am, Steven D'Aprano wrote:
> On Wed, 5 Aug 2009 03:49 pm Mensanator wrote:
>
> > In 3.1, tracing is now a screen attribute, not a turtle atribute.
> > I have no idea why
>
> > tooter = turtle.Turtle()
> > tooter.tracer(False)
>
> > doesn't give me an error (I thought silent erro
Jonathan Fine wrote:
> Hi
>
> I'm writing a talk that compares embed and extend, and wondered if
> anyone here ever used the Python *embedded* in a database server.
> http://twistedmatrix.com/users/glyph/rant/extendit.html
>
> Web frameworks (such as Django) use extend, to import an extensi
On 5 Aug, 21:23, sturlamolden wrote:
> foo(data, length)
Oops, that would be
foo( data, length)
--
http://mail.python.org/mailman/listinfo/python-list
On 5 Aug, 19:16, "Diez B. Roggisch" wrote:
> void foo(void *data, size_t length)
>
> The wrapper is supposed to be called with a python (byte)string instance,
> which might contain more than one '\0'-character.
>
> So how do I access the raw data of a string?
cdef extern void foo(void *data, int
Xavier Ho wrote:
> On Thu, Aug 6, 2009 at 11:51 AM, Sergey Simonenko
> wrote:
>
>> I subclass builtin 'dict' in my application and experience some problems
>> with it.
>>
>
> You should subclass collections.UserDict, and not the default dict class.
> Refer to the collections module.
Are you ref
On Wed, 05 Aug 2009 08:18:55 -0700, Scott David Daniels
wrote:
>I think it explained in the complex math area, but basically EE types
>use j, math types use i for exactly the same thing. Since i is so
>frequently and index in CS, and there is another strong convention,
>why not let the EE types
"Steven D'Aprano" wrote in message
news:pan.2009.08.04.09.28...@remove.this.cybersource.com.au...
> On Tue, 04 Aug 2009 10:03:53 +0200, Bruno Desthuilliers wrote:
>
>>> Disadvantages: your code is filled with line noise. It's an arbitrary
>>> choice between @@ meaning instance attribute and @@ m
Paul Rubin wrote:
"Martin P. Hellwig" writes:
what I usually do is read the packet in binary mode, convert the
output to a concatenated 'binary string'(i.e. '0101011000110') and
Something wrong with reading the data words as an integer and using
old fashioned shifts and masks to get at the bi
Ok, I feel like this is a really stupid question, but how do you install
setup tools for Python 2.6 under windows?
The only format is .egg which requires setup tools to install, doesn't it?
Thanks,
Jeremy
--
http://mail.python.org/mailman/listinfo/python-list
On Aug 5, 2009, at 1:16 PM, Diez B. Roggisch wrote:
Hi,
I'm trying to wrap a C-API which has a call that takes a void* and a
size_t
as arguments.
void foo(void *data, size_t length)
The wrapper is supposed to be called with a python (byte)string
instance,
which might contain more than
> reportlab has a spider chart in reportlab/graphics/charts/spider.py
> How about
> http://matplotlib.sourceforge.net/examples/api/radar_chart.html?highl...
Both exactly what I was after. Thanks very much.
> The 'wxPython in Action' book has some simple example code which
> produces this sort o
> Fafounet (F) wrote:
>F> Thank you, now I can get the correct character.
>F> Now when I have the string abécd I can get ab then é thanks to
>F> your function and then cd. But how is it possible to know that cd is
>F> still the same word ?
That depends on your definition of `word'. And that
unicode() has LOAD_GLOBAL which s.decode() does not. Is it generally
the case that LOAD_ATTR is slower than LOAD_GLOBAL that lead to your
intuition that the former would probably be slower? Or some other
intuition?
Of course, the results from timeit are a different thing - I ask about
the intuiti
"Martin P. Hellwig" writes:
> what I usually do is read the packet in binary mode, convert the
> output to a concatenated 'binary string'(i.e. '0101011000110') and
Something wrong with reading the data words as an integer and using
old fashioned shifts and masks to get at the bit fields?
--
http
Mensanator schrieb:
It didn't form 2.5 to 2.6 (at least not intentionally). But with the
indroduction of the TurtleScreen class and the Screen class/object
(singleton) a few of the turtle methods were also implemented as screen
methods and as turtle methods declared deprecated (see docs of Python
> It didn't form 2.5 to 2.6 (at least not intentionally). But with the
> indroduction of the TurtleScreen class and the Screen class/object
> (singleton) a few of the turtle methods were also implemented as screen
> methods and as turtle methods declared deprecated (see docs of Python
> 2.6). These
On 5 Aug 2009, at 19:17 , Bearophile wrote:
Have you tried Hachoir? (I think its name may be changed to Fusil, I
don't know).
Name hasn't been changed (I think fusil is a subproject, something
like that) on the other hand the hachoir.org site is dead.
But apparently Hachoir was moved to bitbu
On 5 Aug 2009, at 16:46 , Martin P. Hellwig wrote:
Hi List,
On several occasions I have needed (and build) a parser that reads a
binary piece of data with custom structure. For example (bogus one):
BE
+-+-+-+-+--++
| Version | Command | Ins
Martin P. Hellwig:
> On several occasions I have needed (and build) a parser that reads a
> binary piece of data with custom structure. For example (bogus one):
>
> BE
> +-+-+-+-+--++
> | Version | Command | Instruction | Data Length | Data | Fill
Hi,
I'm trying to wrap a C-API which has a call that takes a void* and a size_t
as arguments.
void foo(void *data, size_t length)
The wrapper is supposed to be called with a python (byte)string instance,
which might contain more than one '\0'-character.
So how do I access the raw data of a str
Jon Clements wrote:
IIRC (and I have my doubts) the BitVector module may be of use, but
it's been about 3 years since I had to look at it. I think it used the
C equiv. of short ints to do its work. Otherwise, maybe the array
module, the struct module or even possibly ctypes.
Not much use, but m
dp_pearce wrote:
I want to be able to use Python to produce Spider plots (perhaps you
know them as radar plots or star plots). Does anyone know how to
achieve this? Are there existing libraries?
Direction to any examples, especially those with tutorials, would be
greatly appreciated.
Cheers,
Da
Reply to self: code attached.
As Marco wrote: "To run the single C file USB bulk read program
properly, you must provide a source of data to the CY7C68013 FIFO bus,
like the Simple dual channel A/D system,
otherwise the reading call will time out in one second, you will get a
bunch of zeros, and
Jon Clements wrote:
On 5 Aug, 13:17, Jonathan Fine wrote:
Hi
I'm writing a talk that compares embed and extend, and wondered if
anyone here ever used the Python *embedded* in a database server.
http://twistedmatrix.com/users/glyph/rant/extendit.html
Web frameworks (such as Django) use ex
1 - 100 of 168 matches
Mail list logo
