New submission from Rex Dwyer:
regex.findall(r'((brown)|(lazy)){1<=e<=3} ((dog)|(fox)){1<=e<=3}',
'The quick borwn fax jumped over the lzy hog',
regex.ENHANCEMATCH)
crashes interpreter.
regex.__version__ => 2.4.85
python version
Rex Dwyer added the comment:
sorry if I wasn't clear.
s = 'ACGTCAGCTGAAAAGCTGACGTACGT
re.split(r'(? ['ACGTCA', 'GCTGAAAA', 'GCTGACGTACGT']
I would also be able to split a text on word boundaries:
re.split(r'\b', "the quick, b
New submission from Rex Dwyer:
I would like to split a DNA sequence with a restriction enzyme.
A description enzyme can be describe as, e.g. r'(?
<http://bugs.python.org/issue22817>
___
___
Python-bugs-l
