On Sun, 2010-13-06 at 06:03 +, Xi Yang wrote:
> I'm trying to use use Perl 6 to process some nucleotide sequences.
> However, I found it strangely slow on substr or string concat
> operations, compared with its Perl 5 equivalent.
I don't think that's unexpected at this stage of development. O
# New Ticket Created by Вячеслав Матюхин
# Please include the string: [perl #75690]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75690 >
This code strangely fails:
mmcle...@mmbook:~/rakudo$ cat test.pl
multi sub RangeIt
# New Ticket Created by Alexey
# Please include the string: [perl #75686]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75686 >
---
src/core/IO.pm |4 ++--
1 files changed, 2 insertions(+), 2 deletions(-)
diff --git
# New Ticket Created by Вячеслав Матюхин
# Please include the string: [perl #75688]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75688 >
This code strangely fails:
mmcle...@mmbook:~/rakudo$ cat test.pl
multi sub RangeIt
On Tue Mar 30 03:38:25 2010, moritz wrote:
> 12:35 <@moritz_> rakudo: class A { has $!g; method foo {
self.bar(:$!g) } };
> 12:35 < p6eval> rakudo 534afd: OUTPUT«Symbol '$!g' not predeclared in
> foocurrent instr.: 'perl6;PCT;HLLCompiler;panic' pc 152
> (compilers/p
# New Ticket Created by Moritz Lenz
# Please include the string: [perl #75692]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75692 >
We need tests for callframe($number), methods .line, .file and .my on
the result.
# New Ticket Created by "Carl Mäsak"
# Please include the string: [perl #75700]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75700 >
anyone else get this? I'm just loading a class through a
module, calling a method on it
# New Ticket Created by "Carl Mäsak"
# Please include the string: [perl #75694]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75694 >
rakudo: my %h = { has-b => 42 }
rakudo 0d0672: OUTPUT«===SORRY!===Malformed has at li
# New Ticket Created by "Carl Mäsak"
# Please include the string: [perl #75698]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75698 >
rakudo: say (-5 ... ^5).perl
rakudo ae1300: OUTPUT«(-5, -4, -3, -2, -1, 0, 0, 1, 2, 3,
For your consideration.
>From 77a401211c68d090748e7641e0073484a41f835c Mon Sep 17 00:00:00 2001
From: Luc St-Louis
Date: Sat, 12 Jun 2010 22:01:58 -0400
Subject: [PATCH] Can build both for A4 and letter paper sizes.
---
Makefile | 40 +++-
README|
Dear Xi,
It may be more useful to rewrite your code to take advantage of perl6.
Your revcom can be replaced with a single line using core perl6 functions.
I'll give an example that currently works on rakudo for a simple string,
but you can put it into the loop.
my $sq='ccgacaacgaatatacgggctgtttg
2010/6/13 Richard Hainsworth :
...
> Your revcom can be replaced with a single line using core perl6 functions.
> I'll give an example that currently works on rakudo for a simple string,
> but you can put it into the loop.
>
> my $sq='ccgacaacgaatatacgggctgtttgcttgcgtttgagaggtcgtattcccagatgcgta';
# New Ticket Created by Ira Byerly
# Please include the string: [perl #75706]
# in the subject line of all future correspondence about this issue.
# http://rt.perl.org/rt3/Ticket/Display.html?id=75706 >
Hello,
When passing a negated Bool argument to a Perl6 MAIN subroutine (perl6
foo.p6 --/b
13 matches
Mail list logo
