On 6/12/2010 11:03 PM, Xi Yang wrote:
I'm trying to use use Perl 6 to process some nucleotide sequences. However, I
found it strangely slow on substr or string concat operations, compared with
its Perl 5 equivalent.
Part of this is that perl6 reads files in utf8 by default, and
operation
2010/6/13 Richard Hainsworth :
...
> Your revcom can be replaced with a single line using core perl6 functions.
> I'll give an example that currently works on rakudo for a simple string,
> but you can put it into the loop.
>
> my $sq='ccgacaacgaatatacgggctgtttgcttgcgtttgagaggtcgtattcccagatgcgta';
Dear Xi,
It may be more useful to rewrite your code to take advantage of perl6.
Your revcom can be replaced with a single line using core perl6 functions.
I'll give an example that currently works on rakudo for a simple string,
but you can put it into the loop.
my $sq='ccgacaacgaatatacgggctgtttg
On Sun, 2010-13-06 at 06:03 +, Xi Yang wrote:
> I'm trying to use use Perl 6 to process some nucleotide sequences.
> However, I found it strangely slow on substr or string concat
> operations, compared with its Perl 5 equivalent.
I don't think that's unexpected at this stage of development. O
I'm trying to use use Perl 6 to process some nucleotide sequences. However, I
found it strangely slow on substr or string concat operations, compared with
its Perl 5 equivalent.
Here are the codes, Perl 6 on top, Perl 5 on middle, a test input file on
bottom (should be stored to "makeseq.fasta"