Re: Severe performance loss, comparing with perl 5

2010-06-14 Thread Bruce Keeler
On 6/12/2010 11:03 PM, Xi Yang wrote: I'm trying to use use Perl 6 to process some nucleotide sequences. However, I found it strangely slow on substr or string concat operations, compared with its Perl 5 equivalent. Part of this is that perl6 reads files in utf8 by default, and operation

Re: Severe performance loss, comparing with perl 5

2010-06-13 Thread yary
2010/6/13 Richard Hainsworth : ... > Your revcom can be replaced with a single line using core perl6 functions. > I'll give an example that currently works on rakudo for a simple string, > but you can put it into the loop. > > my $sq='ccgacaacgaatatacgggctgtttgcttgcgtttgagaggtcgtattcccagatgcgta';

Re: Severe performance loss, comparing with perl 5

2010-06-13 Thread Richard Hainsworth
Dear Xi, It may be more useful to rewrite your code to take advantage of perl6. Your revcom can be replaced with a single line using core perl6 functions. I'll give an example that currently works on rakudo for a simple string, but you can put it into the loop. my $sq='ccgacaacgaatatacgggctgtttg

Re: Severe performance loss, comparing with perl 5

2010-06-13 Thread Guy Hulbert
On Sun, 2010-13-06 at 06:03 +, Xi Yang wrote: > I'm trying to use use Perl 6 to process some nucleotide sequences. > However, I found it strangely slow on substr or string concat > operations, compared with its Perl 5 equivalent. I don't think that's unexpected at this stage of development. O

Severe performance loss, comparing with perl 5

2010-06-12 Thread Xi Yang
I'm trying to use use Perl 6 to process some nucleotide sequences. However, I found it strangely slow on substr or string concat operations, compared with its Perl 5 equivalent. Here are the codes, Perl 6 on top, Perl 5 on middle, a test input file on bottom (should be stored to "makeseq.fasta"