Re: [Bioc-devel] custom genome

2015-05-10 Thread Eric P
CCAAA > [9]50 TATGATCACTCTTTCAGGGCATTTAAACTTAAGAGACTAAGATCAAGAAG > [10]50 CTTTATATATAGGCATGCTATTGATGCAAAGATATATCAGGA > > query$seq = getSeq(twobit, query) > > Hope that's helpful; I might have made different decisions with a larger > genome or on Windows, so

[Bioc-devel] custom genome

2015-05-08 Thread Eric P
Hi I have 2-3 genomes that are not listed that I would like to use with bioconductor and I do not really understand how to prepare one properly. I know you have to use BSforge, but after that I need some help. One of the genomes is *Physcomitrella patens*, which is actually being updated at the mo