Hi,
I am not sure that I completely understand your question (for example,
what does it mean to run a script "dynamically or not"). You could
retrieve the list of processes from OS to try to figure out how was the
script ran, but it is a bit messy. Just maybe: maybe you want to see
whether the s
On 11/22/20 12:33 AM, wagsworl...@yahoo.com wrote:
The only problem I was trying to determine was could i know if I was
running from BBEdit dynamically or not? That was the question. No
problem, just could I know what environment I was running in. The
output was a the Unix output log which up t
The only problem I was trying to determine was could i know if I was running
from BBEdit dynamically or not? That was the question. No problem, just could I
know what environment I was running in. The output was a the Unix output log
which up to the last update automatically came to the front of
On 11/21/20 10:32 PM, wagsworl...@yahoo.com wrote:
Well, up until this last update is BBEdit, when a script was run while
in BBEdit, the Unix log file would automatically come to the fore
front. Now it stays hidden.
that doesn't sound like a perl problem. what log file? there are many on
a
Well, up until this last update is BBEdit, when a script was run while in
BBEdit, the Unix log file would automatically come to the fore front. Now it
stays hidden.
A gentleman on the BBEdit mail list gave an osasctipt that one can execute
from within the script bring executed. But sometimes
On 11/21/20 7:42 PM, wagsworld48 via beginners wrote:
It was a good idea, but that gives me zsh which is what in this case
BBEdit uses to execute the script. So with your code of $ENV, then I
looked at the variables within ENV and picked one that was there for
BBEdit and not there in a normal t
It was a good idea, but that gives me zsh which is what in this case BBEdit
uses to execute the script. So with your code of $ENV, then I looked at the
variables within ENV and picked one that was there for BBEdit and not there in
a normal terminal run. Know other ways, but this at least is one
Perhaps:
perl -le 'print $ENV{SHELL}'
Cheers,
Rob
On Sun, Nov 22, 2020 at 8:00 AM wagsworld48 via beginners <
beginners@perl.org> wrote:
> Mind is blank, but want to know if started with say BBEdit or bash or ?
>
> Probably very simple, but at this point, no idea... ;)
>
> WagsWorld
> World of P
> On Oct 10, 2019, at 6:04 PM, 刘东 wrote:
>
> Dear friends,
> I have written a perl script to get seprated files, but finally I every file
> included multiple files appeared before,
> for example, 1 file 2M, 2 file 5 M( included last one), 3 file 6 M (included
> last two ones), ...
> but I ex
On 2019-10-09 7:21 p.m., 刘东 wrote:
hellow:
I have written a script, but it does not work, can you tell me what wrong with
me?
#! /usr/bin/perl
use strict;
use warnings;
use Getopt::Long;
my ($dir, $files, $file_name, $file_format, $file_dir, $file_main);
GetOptions ('dr=s' =>\$dir);
open
On 2019-10-09 7:21 p.m., 刘东 wrote:
hellow:
I have written a script, but it does not work, can you tell me what wrong with
me?
#! /usr/bin/perl
use strict;
use warnings;
use Getopt::Long;
my ($dir, $files, $file_name, $file_format, $file_dir, $file_main);
GetOptions ('dr=s' =>\$dir);
open
In addition to the comments made by David, it appears the line:
open FASEQ, "<", $files or die "can not read open $!";
is not needed. The file handle FASEQ is never used in an input operation.
You want to use the file name as noted by David.
Ken
On Thu, Oct 10, 2019 at 4:06 AM 刘东 wrote:
> he
The error message "FASEQ can not open" doesn't look like something
which could be output by the code you've provided.
*Either* you should get the "can not read open $!" message (where the
$! will be interpolated to the reason it failed), or the message is
coming from whatever the "usearch" tool
Hi Miguel,
On Wed, 25 Nov 2015 20:28:48 -0500
Miguel Rodas wrote:
> Why am I in this thread?
>
> Please remove me from it
>
You are likely subscribed to beginners@perl.org and so receive all E-mails from
all threads. For how to unsubscribe, see
http://learn.perl.org/faq/beginners.html .
Rega
Hi Jin,
some comments on your code:
On Thu, 26 Nov 2015 08:13:54 +0800
Jin Xu wrote:
> Try to use below updated ones:
>
> #!/usr/bin/perl
> use strict;
> use warnings;
> while (my $line = <>) {
You're lacking many empty lines - separating the code into paragraphs. See:
http://perl-begin.org/
Why am I in this thread?
Please remove me from it
Sent from my iPhone
> On Nov 25, 2015, at 7:13 PM, Jin Xu wrote:
>
> Try to use below updated ones:
>
> #!/usr/bin/perl
> use strict;
> use warnings;
> while (my $line = <>) {
> while ($line =~
> s#\d+\s*[*+-/]\s*\d+(\s*[*+-/]\s*\d
Try to use below updated ones:
#!/usr/bin/perl
use strict;
use warnings;
while (my $line = <>) {
while ($line =~
s#\d+\s*[*+-/]\s*\d+(\s*[*+-/]\s*\d+)*##) {
my $result;
eval ("$result = $&;");
$line =~ s//$result/;
}
print ($line);
}
Regards,
Jin Xu
Hi Gary,
I don't know what you are trying to do with that code... :( Still, it's
valid this way:
#!/usr/bin/perl
use strict;
use warnings;
print "Content-type: text/html\n\n"; #Only if you want this format
while (my $line = <>) {
while ($line =~ s#\d+\s*[*+-/]\s*\d+(\s*[*+-/]\s*\d+)*##) {
> gb@MINT ~/Perl5/perl programs $ cat prog164.pl
> #!/usr/bin/perl
> use strict;
> use warnings;
> while ($line = <>) {
> while ($line =~
> s#\d+\s*[*+-/]\s*\d+(\s*[*+-/]\s*\d+)*##) {
> eval ("\$result = $&;");
> $line =~ s//$result/;
>
> }
> print ($line);
> }
Hi Asad,
some comments on your script:
On Wed, 8 May 2013 11:34:14 +0530
Asad wrote:
> Hi All ,
>
> Thanks to you all for the inputs . I have created the following
> script :
>
> use warnings;
> use strict;
> use File::Slurp qw(read_file);
> use constant LIMIT => 3;## Number of
Hi
My first contribution to the list!
Probably the simplest way to do this is (once you have apache2 installed and
working) to create a script that looks a bit like this:
!#/usr/bin/perl
use strict;
use warnings;
sub mylogparser {
Your script
}
mylogparser ();
print "Content-type: text/htm
Hi All ,
Thanks to you all for the inputs . I have created the following
script :
use warnings;
use strict;
use File::Slurp qw(read_file);
use constant LIMIT => 3;## Number of lines wanted
use constant UPPERLIMIT => 9;
open (OUTFILE, '>','d:\perl\OUTPUT.TXT');
#my $file = $ARGV[0]
Hi,
On Sat, Apr 13, 2013 at 4:50 PM, Asad wrote:
> Hi All ,
>
> Greetings !
>
>I have completed O'Reily first book Learning Perl . Started writing
> small perl programs . However I basically do log file analysis , hence was
> thinking is there any perl code around in any of the
On Sat, 13 Apr 2013 21:20:30 +0530
Asad wrote:
>I have completed O'Reily first book Learning Perl . Started
> writing small perl programs . However I basically do log file
> analysis , hence was thinking is there any perl code around in any of
> the book or if anyone already developed for
Thanks.
F: is the local drive on the server. Now I schedule the script to be run on a
daily base instead of calling from my local machine. So far it is OK.
Thanks anyway.
Cheers,
Jason
> Date: Wed, 3 Oct 2012 19:34:45 +0200
> Subject: Re: Perl script on a server using Win32::OLE
On Wed, Sep 26, 2012 at 8:23 AM, Jason Feng wrote:
>
> Hello,
>
> I have a Perl script running on a Windows 2008 server which uses Win32::OLE
> to dump the results on Excel files. It is working fine when I remote login to
> the server and run the script.
>
> Now I want to write a Perl script on
On 2012-09-14, at 1:56 AM, jmrhide-p...@yahoo.com wrote:
> I can see from the responses so far that I was unclear in the way I phrased
> my
> question, so please let me emphasize the following: MY SCRIPT, THOUGH COMPLEX
> (500 LINES), PRODUCES EXACTLY THE OUTPUT I EXPECT EVERY TIME I RUN IT. I
On Thu, 13 Sep 2012 22:56:18 -0700 (PDT)
jmrhide-p...@yahoo.com wrote:
> Where I think we need to focus is, assuming the script runs to its
> end every time, why doesn't it release its hold on the server
> resources? My hosting service runs Apache version 2.2.22. I can't
> tell what version of Perl
I can see from the responses so far that I was unclear in the way I phrased my
question, so please let me emphasize the following: MY SCRIPT, THOUGH COMPLEX
(500 LINES), PRODUCES EXACTLY THE OUTPUT I EXPECT EVERY TIME I RUN IT. In
particular, it never hangs or gives a wrong answer. Also, with al
On 05/26/2012 12:33 PM, Kwaku Addo Ofori wrote:
I need some help. I've just finished my script and a manual test is fine.
Basically, it's a script that gets the PID of some selected process and
lists all the open file descriptors for the processes pipes this to a file.
Problem is, when I run the
On 12-03-27 10:16 AM, Anirban Adhikary wrote:
I have found the solution.
I need to write a line to top of my code and its works.
use Lib "Path to your perl code";
then I can run this perl code directly from crontab I dont need a shell
script to call the perl code.
Try using FindBin. FindBin was
Hi All,
I have found the solution.
I need to write a line to top of my code and its works.
use Lib "Path to your perl code";
then I can run this perl code directly from crontab I dont need a shell
script to call the perl code.
Thanks
Anirban Adhikary.
On Tue, Mar 27, 2012 at 7:41 PM, Paul Johnson
On Tue, Mar 27, 2012 at 04:30:27PM +0530, Anirban Adhikary wrote:
> Hi
> I need to run a perl script from cron tab.
>
> so I write a small shell script and call the perl script within that shell
> script.
> /usr/bin/perl /home/anirban/perl_code.pl
>
> Before calling the perl script I copied all t
Thanks for the Suggestions Ken Slater and Jin Gibson.
Sorry for the missing information's.
Exactly what you people predicted is correct.($k is a file counter
starting at zero, and $Line_Counter is a line counter starting at one)
Script is modified according to the suggestions given by you and no
On 10/11/11 Tue Oct 11, 2011 5:31 AM, "james varghese"
scribbled:
> hi,
> I am new to perl programming.I am trying with the following script and
> need help for it.
>
> I consolidated 10 excel files(in .txt format) which has same headers
> in it and so i made it 1 common header at the top.Whil
> From: james varghese [mailto:james2...@gmail.com]
> Sent: Tuesday, October 11, 2011 8:31 AM
> To: beginners@perl.org
> Subject: perl script help
>
> hi,
> I am new to perl programming.I am trying with the following script and
> need help for it.
>
> I consolidated 10 excel files(in .txt format)
On Thu, Aug 11, 2011 at 1:10 AM, Uri Guttman wrote:
> > "KS" == Kevin Spencer writes:
>
> KS> On Wed, Aug 10, 2011 at 4:04 AM, Rob Coops wrote:
> >> #!/usr/bin/perl
> >>
> >> use strict;
> >> use warnings;
> >> use File::Slurp; # A handy module check it out at:
> >> http://search.cpa
> "KS" == Kevin Spencer writes:
KS> On Wed, Aug 10, 2011 at 4:04 AM, Rob Coops wrote:
>> #!/usr/bin/perl
>>
>> use strict;
>> use warnings;
>> use File::Slurp; # A handy module check it out at:
>> http://search.cpan.org/~uri/File-Slurp-.19/lib/File/Slurp.pm
KS> While ha
On Wed, Aug 10, 2011 at 4:04 AM, Rob Coops wrote:
> #!/usr/bin/perl
>
> use strict;
> use warnings;
> use File::Slurp; # A handy module check it out at:
> http://search.cpan.org/~uri/File-Slurp-.19/lib/File/Slurp.pm
While handy, be aware that you are slurping the entire file into
memory, so j
On Wed, Aug 10, 2011 at 12:43 PM, VinoRex.E wrote:
> Hi every one
> i am a Biologist,i am having a DNA file having 2000 to 1000 letters. eg
> file:(ATGCATGCTAGCTAGTCGATCGCATCGATAGCTAGCTACGCG
> CGTACCGTGCAGAAGAGCAGGACATATATATTACGCGGCGATCGATCGTAGC
>
> GATCGATCGATCGCTAGCTGACTATGCATGCTAGCTAGTCGAT
On Tue, Apr 20, 2010 at 8:23 PM, newbie01 perl wrote:
> I want to be able to convert the XML file to a text file ...
XML /is/ text. :\ You can just open an XML file with any text editor
(that supports the text encoding) and edit it by hand. :\
Now, you might want to prettify it (format it, with
Chris Coggins wrote:
I'm using a perl script to write another perl script that will be
executed later. I need to know if all the characters that need to be
escaped, are properly escaped. Can someone help, here's a portion of the
code below. Are all the characters properly escaped? (note this is
> "CC" == Chris Coggins writes:
CC> I'm using a perl script to write another perl script that will be
CC> executed later. I need to know if all the characters that need to be
CC> escaped, are properly escaped. Can someone help, here's a portion of
CC> the code below. Are all the chara
Hi Dave,
There is a tool sysusage which is a open source coded in perl. It
might be worth to have a look.
2010/2/8 Dave Tang :
> Hi everybody,
>
> I want to write a script that checks memory usage of my RHEL box, and ran as
> a cron job say every 10 minutes.
>
> I could write the Perl script to r
Hi Dave
Have you ever tried module Proc-ProcessTable? It is a wonderful tool
to collect process information such as PID, cmdline, CPU usage and Mem
usage.
> Hi everybody,
>
> I want to write a script that checks memory usage of my RHEL box, and ran as
> a cron job say every 10 minutes.
>
> I coul
Dave Tang wrote:
> Very recently a user wrote a script that crashed the server, by using
> all the memory. So also I wanted to capture the process information too.
> Is this information available in the /proc directory?
Yes, google "linux proc".
--
Just my 0.0002 million dollars worth,
Sh
On Mon, 08 Feb 2010 22:52:37 +1000, Shawn H Corey
wrote:
Dave Tang wrote:
Hi everybody,
I want to write a script that checks memory usage of my RHEL box, and
ran as a cron job say every 10 minutes.
I could write the Perl script to run a system command like "ps aux",
parse that information
Dave Tang wrote:
> Hi everybody,
>
> I want to write a script that checks memory usage of my RHEL box, and
> ran as a cron job say every 10 minutes.
>
> I could write the Perl script to run a system command like "ps aux",
> parse that information and kill a job if >90% of the total system memory
Hi Parag!
On Saturday 12 Dec 2009 07:05:02 Parag Kalra wrote:
> Hello All,
>
> I am planning to write a small Perl script to diff 2 excel sheets
> (workbooks) using the module - Spreadsheet::ParseExcel.
>
> I am planning to implement following algorithm.
>
> What we can do is to pick up a works
2009/9/25 Shawn H Corey :
> Irfan Sayed wrote:
>>
>> Hi All,
>>
>> I am planning to wrire the perl script which will accomplish following
>> task
>>
>> 1: login to remote windows machine
>> 2: verify certain batch scripts are running or not
>>
reference this:
http://www.novell.com/coolsolutions/fe
On Fri, Sep 25, 2009 at 1:19 PM, Irfan Sayed wrote:
> Hi All,
>
> I am planning to wrire the perl script which will accomplish following task
>
> 1: login to remote windows machine
> 2: verify certain batch scripts are running or not
>
> Please let me know if this can be possible using perl script
Irfan Sayed wrote:
Hi All,
I am planning to wrire the perl script which will accomplish following task
1: login to remote windows machine
2: verify certain batch scripts are running or not
Please let me know if this can be possible using perl script.
Yes, it's possible.
--
Just my 0.00
Hi
I am able to connect to my remote sql server through SQL express Managment
console.
I have configured my sqlserver to allow remote connections.
Thanks,
siva
On 4/16/09, Jayesh Thakrar wrote:
>
>
> From what I understand, the Express Edition of MS SQL Server does not
> support connections f
On Fri, Apr 17, 2009 at 18:01, Jim Gibson wrote:
> On 4/16/09 Thu Apr 16, 2009 2:25 PM, "Chas. Owens"
> scribbled:
>
>> 2009/4/16 Jim Gibson :
>> snip
>>> This calls the new method in package vpu and assigns the return value, which
>>> should be a blessed scalar of some type, usually a referenc
On 4/16/09 Thu Apr 16, 2009 2:25 PM, "Chas. Owens"
scribbled:
> 2009/4/16 Jim Gibson :
> snip
>> This calls the new method in package vpu and assigns the return value, which
>> should be a blessed scalar of some type, usually a reference to a hash, but
>> it could be any scalar.
> snip
>> $vpu
2009/4/16 Jim Gibson :
snip
> This calls the new method in package vpu and assigns the return value, which
> should be a blessed scalar of some type, usually a reference to a hash, but
> it could be any scalar.
snip
> $vpu must be a blessed scalar in order to call methods on it. Packages
> netEleme
On 4/15/09 Wed Apr 15, 2009 9:18 PM, "Fatema M"
scribbled:
> Hi,
> I am facing an error while executing the Perl script, its compilation fails
> with the following error
>"Can't call method "execute_flow" without a package or object reference
> at "
>
> Code Snippet:
>
> use netElemen
>From what I understand, the Express Edition of MS SQL Server does not support
>connections from remote machines/hosts out-of-the-box.
Look up the Microsoft KB article and turn-on support for remote connections and
then try.
http://support.microsoft.com/kb/914277
-- Jayesh
- Original
On 4/6/2009 16:18, Telemachus wrote:
On Mon Apr 06 2009 @ 2:44, Irfan Sayed wrote:
please adivce / help
Regards
Irfan
Please don't reply to your own mail as a way of nudging people to reply.
It's more likely to annoy than to get you an answer.
also: http://www.perlmonks.net/?node_id=75567
On Mon Apr 06 2009 @ 2:44, Irfan Sayed wrote:
> please adivce / help
>
> Regards
> Irfan
Please don't reply to your own mail as a way of nudging people to reply.
It's more likely to annoy than to get you an answer.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional comman
please adivce / help
Regards
Irfan
From: Irfan Sayed
To: beginners@perl.org
Sent: Monday, April 6, 2009 2:49:40 PM
Subject: perl script to check whether software is installed
Hi All,
i want to check whether a particular software is installed or not through pe
On Tue, Mar 17, 2009 at 11:23, socrtwo wrote:
> I am using the executable cakecmd unzipper in a Perl script. Normally
> when cakcmd is executed outside of Perl and it's done it's work it
> pauses and one has to hit enter to return to the prompt.
>
> How can I program Perl so that it enters the ca
Rick wrote:
> I have a perl script on remote server.
> I want to launch a expect script(none perl) from local server with
> arguments and launch perl script on remote server.(arguments will be
> feed into perl script)
> I don't know how long perl script will run but I want to scp(using
> expect
Owen wrote:
I have a perl script on remote server.
I want to launch a expect script(none perl) from local server with
arguments and launch perl script on remote server.(arguments will be
feed into perl script)
I don't know how long perl script will run but I want to scp(using
expe
> I have a perl script on remote server.
> I want to launch a expect script(none perl) from local server with
arguments and launch perl script on remote server.(arguments will be
feed into perl script)
> I don't know how long perl script will run but I want to scp(using
expect script from local) th
On Thu, 22 Jan 2009 06:21:32 -0800 (PST)
melbou...@gmail.com wrote:
> I have a Perl script that I run and the out come as showing below:
>
> Reading: server 1\08121100.mls
> Log chain 2:
> Reading: server 2\08120700.mls
> Reading: server 2\08120900.mls
> Reading: server 2\08121100.mls
> L
2008/9/20 <[EMAIL PROTECTED]>:
> Hello,
>
> I would like to mirror Perl scripts I have loaded in a domain #1 directory
> and use them in domain #2 without redirecting the web response to domain #1.
> I really don't want to make copies of all the scripts in domain #1 and
> install them in domain #2
Hi,
Please suggest.
Regards,
Irfan.
From: Irfan J Sayed (isayed)
Sent: Friday, August 29, 2008 1:09 PM
To: '[EMAIL PROTECTED]'; Jeff Pang; beginners@perl.org
Subject: RE: perl script on remote server linux
Thanks. It worked but with one issue.
From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]
Sent: Thursday, August 28, 2008 8:18 PM
To: Irfan J Sayed (isayed)
Cc: beginners@perl.org; Jeff Pang
Subject: RE: perl script on remote server linux
Try this:
system "ssh -x -t SERVER_NAME \"sudo /home
ou run
the script.
Thanks,
Hary
"Irfan J Sayed (isayed)" <[EMAIL PROTECTED]>
08/28/2008 10:29 AM
From
"Irfan J Sayed (isayed)" <[EMAIL PROTECTED]>
To
<[EMAIL PROTECTED]>, "Jeff Pang" <[EMAIL PROTECTED]>,
cc
Subject
RE: perl
ot;Jeff Pang" , beginners@perl.org
> Copie à :
> Objet : RE: perl script on remote server linux
>
> Yes. I want to parse string "error" in the log file.
>
> Please suggest how should I achieve this.
>
Regards,
Jeff.
Créez votre adresse électronique [EMAIL PROTECTED]
1 Go d'espace de stockage, anti-spam et anti-virus intégrés.
.org; Jeff Pang
Subject: RE: perl script on remote server linux
Is there a specific text that you want to parse throught the log file?
Thanks,
Harsha
"Irfan J Sayed (isayed)" <[EMAIL PROTECTED]>
08/28/2008 09:29 AM
From
"Irfan J Sayed (isayed)" <[EM
Is there a specific text that you want to parse throught the log file?
Thanks,
Harsha
"Irfan J Sayed (isayed)" <[EMAIL PROTECTED]>
08/28/2008 09:29 AM
From
"Irfan J Sayed (isayed)" <[EMAIL PROTECTED]>
To
"Jeff Pang" <[EMAIL PROTECTED]>
il/AVMInstall.log" is a Perl open, shell can't
understand for this at all.
> Message du 28/08/08 15:29
> De : "Irfan J Sayed (isayed)"
> A : "Jeff Pang" , beginners@perl.org
> Copie à :
> Objet : RE: perl script on remote server linux
>
>
>
&
TED]
Sent: Wednesday, August 27, 2008 2:32 PM
To: Irfan J Sayed (isayed)
Cc: beginners@perl.org
Subject: RE: perl script on remote server linux
> system "ssh [EMAIL PROTECTED] /home/cgadgil/avm2.1/launchtomcat.sh";
you need a "\" before the "@".
modify it to:
sys
> Message du 27/08/08 11:51
> De : "Irfan J Sayed (isayed)"
> A : "Jeff Pang"
> Copie à : beginners@perl.org
> Objet : RE: perl script on remote server linux
>
>
>
> Thanks Jeff. It really helped.
> Just one doubt, if we can perform operati
@perl.org
Subject: RE: perl script on remote server linux
> system "ssh [EMAIL PROTECTED] /home/cgadgil/avm2.1/launchtomcat.sh";
you need a "\" before the "@".
modify it to:
system "ssh [EMAIL PROTECTED] /home/cgadgil/avm2.1/launchtomcat.sh";
Créez votre a
Raymond Wan wrote:
Assuming we are using the same ssh, isn't the login name for ssh is
supplied using the "-l" parameter (lowercase L)? Give it a try on the
command line before putting it in the script so that you can figure
out what is wrong easier.
Sorry Irfan and thanks Jeff...I was wron
Hi Irfan,
Assuming we are using the same ssh, isn't the login name for ssh is
supplied using the "-l" parameter (lowercase L)? Give it a try on the
command line before putting it in the script so that you can figure out
what is wrong easier.
Ray
Irfan J Sayed (isayed) wrote:
Hi,
In my
> system "ssh [EMAIL PROTECTED] /home/cgadgil/avm2.1/launchtomcat.sh";
you need a "\" before the "@".
modify it to:
system "ssh [EMAIL PROTECTED] /home/cgadgil/avm2.1/launchtomcat.sh";
Créez votre adresse électronique [EMAIL PROTECTED]
1 Go d'espace de stockage, anti-spam et anti-virus intégr
Hi,
In my case, the user with which I am executing the script is not there in
sudoers file. So I did in the following manner.
#!/usr/bin/perl
open FILE, "server_list" or die $!;
while() {
print "the host is: $_";
chomp;
system "ssh [EMAIL PROTECTED] /home/cgadgil/avm2.1/launchtomcat
On Wed, Aug 20, 2008 at 12:07:02PM -0700, Jyotishmaan Ray wrote:
>
Depending on the Linux system's policies, executing a command like this:
useradd -m -d /mnt/btech -c $encrypted_password -s $shell $user
will:
- create the UID in the password database
- create a group ID in /etc/groups
- ad
From: Andrej Ricnik-Bay <[EMAIL PROTECTED]>
Subject: Re: Perl Script Needed To Create The Home Drectories.
To: "Marc Girod" <[EMAIL PROTECTED]>, "Perl-LDAP Mailing List" <[EMAIL
PROTECTED]>
Date: Wednesday, August 20, 2008, 11:33 PM
On 20/08/2008, Marc Gi
From: "Anirban Adhikary" <[EMAIL PROTECTED]>
> my($a,$b);
Don't! Variables $a and $b are special. They are used in the
sort{block} and have a bit special scope and declaration rules. You'd
better not use them outside sort{}.
> my $uidNumber=2631;
> my $gidNumber=2631;
> open(FH,"/home/anadhikar
Hi Jyotishmaan Ray
U can do the task in the following way but there may be some other good and
compact way.
The source file is the file where uid and user password are written but one
thing in the source file u need to keep uid and user passwd in the same
line. like this
s08-1-5-093 $1$2P6e6U
. $#;
} else {
$url .= "?#=" . $# . "-" . $### . "-" . $#;
}
print $url."\n";
} else {
print "\n";
}
}
}else {
print "\n";
}
my $sth->finish();
;[EMAIL PROTECTED]>
Sent: Monday, July 14, 2008 23:27:21
Subject: Re: Perl script doesnt behave well
luke devon wrote:
>
> I am using perl script to handle some function of squid redirector program .
> Actually its working fine. But after some time , that functions goes off.
> Tha
luke devon wrote:
>
> I am using perl script to handle some function of squid redirector program .
> Actually its working fine. But after some time , that functions goes off.
> That's meant VALUE-A doesnt comes in to the request.
>
> I checked the DB , it also fine.
> CPU also nothing
>
> Can s
luke devon wrote:
Hi,
Hello,
I am using perl script to handle some function of squid redirector
program . Actually its working fine. But after some time , that
functions goes off. That's meant
VALUE-A doesnt comes in to the request.
I checked the DB , it also fine.
CPU also nothing
Can s
hose steps in to the code
> ?
>
>
>
> - Original Message
> From: Thomas Bätzler <[EMAIL PROTECTED]>
> To: Perl
> Cc: luke devon <[EMAIL PROTECTED]>
> Sent: Monday, July 14, 2008 16:05:21
> Subject: RE: Perl script doesnt behave well
>
> luke devon <[EMAIL PR
could you please direct me how could I implement those steps in to the code ?
- Original Message
From: Thomas Bätzler <[EMAIL PROTECTED]>
To: Perl
Cc: luke devon <[EMAIL PROTECTED]>
Sent: Monday, July 14, 2008 16:05:21
Subject: RE: Perl script doesnt behave well
luke d
Try pasting some input record for which the output is not coming.
If the record contains confidential data, you can mask the data.
Regards,
Amit Saxena
On Mon, Jul 14, 2008 at 3:43 PM, luke devon <[EMAIL PROTECTED]> wrote:
> Hi,
>
> I am using perl script to handle some function of squid redire
luke devon <[EMAIL PROTECTED]> asked:
> I am using perl script to handle some function of squid
> redirector program . Actually its working fine. But after
> some time , that functions goes off. That's meant VALUE-A
> doesnt comes in to the request.
Is it possible that your script has lost the
On Jun 30, 8:25 pm, [EMAIL PROTECTED] (John W. Krahn) wrote:
> Cheez wrote:
> > Howdy,
>
> Hello,
Hi John, thank you for your reply. I will incorporate as much of
these suggestions as possible. Certainly when I get a new, more
efficient script running, I will post it.
Thanks again! -Dan
--
To
On Jun 30, 8:47 pm, [EMAIL PROTECTED] (Icarus) wrote:
> Is this homework by the way dude?
>
> anyway..my two cents..run them..if it works right away cool. If not,
> that'll get you started. There's more than way to do it.
Hehe, sorry Icarus, this is not homework...just some old man trying to
sel
On Jun 30, 8:36 pm, [EMAIL PROTECTED] (Rob Dixon) wrote lots of great
advice:
Hi Rob, I appreciate your reply and all of the suggestion. I will see
if I can get your script to work then report back. Cheers! -Dan
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMA
On Jun 30, 8:01 am, [EMAIL PROTECTED] (Cheez) wrote:
> Howdy, scripting with perl is a hobby and not a vocation so i
> apologize in advance for rough looking code.
>
> I have a very large list of 16-letter words called
> "hashsequence16.txt". This file is 203MB in size.
>
> I have a large list of
Cheez wrote:
> Howdy, scripting with perl is a hobby and not a vocation so i
> apologize in advance for rough looking code.
>
> I have a very large list of 16-letter words called
> "hashsequence16.txt". This file is 203MB in size.
>
> I have a large list of data called "newrawdata.txt". This fi
Cheez wrote:
Howdy,
Hello,
scripting with perl is a hobby and not a vocation so i
apologize in advance for rough looking code.
I have a very large list of 16-letter words called
"hashsequence16.txt". This file is 203MB in size.
I have a large list of data called "newrawdata.txt". This fil
dakin999 wrote:
I am looking for any generic perl code that is doing some thing like
following. Any code help will be really helpful.
1. Reads from a database(oracle) following columns:
Customer_No, Fname, Lname, Password.
2. Encrypts the password in SHA1_Base64 format.
3. Use the perl-ldap ad
1 - 100 of 284 matches
Mail list logo
