On Tue, Oct 02, 2012 at 11:19:51PM +0100, Florian Huber wrote:
> The string is:
>
> >ENSG0112365|ENST0230122|109783797|109787053TGTTTCACAATTCACTACTAAATGTGTACCATTAAATTGAACAGAAAGCTGAGGAATGAACTTCAAGCATTACAAG
>
> So I'm trying to retrieve'ENSG0112365', 'ENST0230122
Flo
Original-Nachricht
> Datum: Tue, 2 Oct 2012 19:17:58 -0400
> Von: William Muriithi
> An: Florian Huber
> CC: beginners@perl.org
> Betreff: Re: Multiple matching of a group of characters
> Florian,
> >
> > The string is:
> >
>
Florian,
>
> The string is:
>
>>ENSG0112365|ENST0230122|109783797|109787053TGTTTCACAATTCACTACTAAATGTGTACCATTAAATTGAACAGAAAGCTGAGGAATGAACTTCAAGCATTACAAG
It may actually have helped if you posted two or three samples. This
could help us identify patterns in your data and
On Oct 2, 2012, at 3:19 PM, Florian Huber wrote:
> Thanks guys, for the answers. :-)
>
> I'm sorry I posted a shortened version of the code as I thought it'd make it
> easier to read while still getting the message across. So here's the actual
> example and the corresponding output:
>
> The s
Thanks guys, for the answers. :-)
I'm sorry I posted a shortened version of the code as I thought it'd
make it easier to read while still getting the message across. So here's
the actual example and the corresponding output:
The string is:
>ENSG0112365|ENST0230122|109783797|109787053
On Mon, Oct 01, 2012 at 11:15:53PM +0100, Florian Huber wrote:
> Dear all,
Hello,
> $string = "/NOTNEEDED/*ACGACGGGTTCAAGGCAG*/NOTNEEDED/"
I would suggest that you show us the real data. I'm assuming that
'NOTNEEDED' is a placeholder for some data that you're not
interested in. Without knowing w
On Mon, Oct 1, 2012 at 5:15 PM, Florian Huber wrote:
>
> My confusion was complete when I tried
>
> $string =~ /[ACGT]{5}/;
>
> now it matches 5 letters, but this time from the beginning, i.e.: ACGAC.
>I'm trying to extract a DNA sequence out of a larger string, i.e. the string
>is of the follow
On Oct 1, 2012, at 3:15 PM, Florian Huber wrote:
> Dear all,
>
> I'm trying to extract a DNA sequence out of a larger string, i.e. the string
> is of the following structure:
>
> $string = "/NOTNEEDED/*ACGACGGGTTCAAGGCAG*/NOTNEEDED/"
>
> But when I do
>
> $string =~ /[ACGT]/;
>
> it matches
