Can use Perl and C in a program?

How can I implement these two languages of programming in a program? What part of the program uses Perl and C? Different repositories of Github use many languages of programming in a project but a program only uses a language of programming. -- With kindest regards, William

algorithms

code but an algorithm is my weakness. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

how to can measure my level of knowledge?

I talk nonsense. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

lines of code for code a website

How many lines of code are needed to code a website? *in c, java, php and perl * What language is ideal for this task? -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Knowledge for a basic programmer and advanced programmer

What needs to know a basic and advanced programmer? I am a basic programmer, I don't have enough experience to be an advanced programmer. How many years of experience must an advanced programmer have? -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating s

perlbrew

gt; -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Over-productive or improductive

What is the best option for work in software development? *My weak * 1. I am *over-productive * 2. I have impostor syndrome 3. I have burnout 4. My learning curve is slow -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https

Tool for develop in Perl

Eclipse, Netbeans, Visual Studio or some other code editor like Visual Studio Code, Sublime Text, Atom and Notepad++. The IDE is complete but large files while the code editor is light. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https

Upgrade Perl

How to upgrade Perl from Debian? I have Perl *v5.32.1* -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Code or tools

focus on the code or the tools because exist a lot of tools in the market. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: My progress in Perl

ot; > > That is great advice. Write a program to open your directories > given a key word. I use that program dozens of times every day. > > > Mike > > > On 8/7/23 00:29, Olivier wrote: > > William, > > > >> I started testing some extensions

My progress in Perl

ences and Complex Data Structures in Perl. I have a lot of doubts in my mind: What is my purpose with this language? In my country don't exist use of this language I am boring and tired *I must be a success!* PD: Add your anecdote with this language. -- With kindest regard

Bash vs Perl

. - touch : Create a new file. - rm : Remove a file or directory. - cp : Copy a file or directory. - mv : Move or rename a file or directory. The program must update the package manager -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https

Perl version

What is the first version of Perl? What is the last version of Perl? What is the difference between both versions? What progress has the first last version of Perl made? I have the version of *Perl v5.32.1* -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating

telephone book

What do I need to do to develop a telephone book in Perl? In my country the phone number has 8 digits, i want to generate random numbers but with the same sequence. I want to get at least some number registered in the telephone exchange [unknown number]. -- With kindest regards, William

Communities or support

With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

GNU/Linux

Can develop a program in PERL for GNU/Linux without using BASH? What is the difference between PERL and BASH? -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Scripting language

as released circa 1987. A few changes > have occurred between then and now. The current version of Perl has > exceeded 5.8.0 and is a highly recommended upgrade. > What scripting languages exist nowadays? -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The univer

Re: Roadmap Perl

sunset and when the new one will be implemented. On Sun, Mar 19, 2023 at 12:49 AM Andrew Solomon wrote: > Hi William, > > I don't understand what you mean by the "roadmap". Could you clarify? > > Thanks, > > Andrew > > On Sun, Mar 19, 2023 at 6:26 AM Will

Roadmap Perl

Can someone share the roadmap of Perl? -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: Iterating over Arrays

rds = ("this","that"); > > $words[5] = "bad idea"; > > for my $element (@words){ > if (defined $element) { > print "$element\n"; > } > else { > print "undefined\n"; > } > } > >

What projects can develop in Perl?

I have any ideas 1. phone guide -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Iterating over Arrays

s.pl" 13L, 167B 1,1 All Use of uninitialized value $element in concatenation (.) or string at words.pl line 11. at words.pl line 11. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄⠀

What is difference in this pattern?

1. $foo =~ m/abc/ 2. $foo =~ m 3. $foo =~ m'abc' -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

What is difference in this pattern_

-- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

What define a good program in perl?

In my recents program the program contain your module, conditional, input, ouput. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: What is the mean of the following syntax?

On 8/3/22, armando perez pena wrote: > Hello William, > > Perl is a programming language easy to use an relative easy to learn. But is > very very tricky. > > The best way to learn is get a good book . Like 'Learning Perl' and read the > book and practice. > >

What is the mean of the following syntax?

Mean: !~ /\*/ I have the following code: if ($extension !~ /\*/) { $backup = $ARGV . $extension; } -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: How to can develop a program

On Tue, Aug 2, 2022 at 3:16 AM Christian Walde wrote: > On Tue, 02 Aug 2022 10:41:36 +0200, Ruprecht Helms (privat) < > rhe...@rheynmail.de> wrote: > > Am 02.08.22 um 10:07 schrieb Christian Walde: > >> On Mon, 01 Aug 2022 22:50:21 +0200, William Torrez Corea > >

Re: How to can develop a program

On Mon, Aug 1, 2022 at 8:16 AM Christian Walde wrote: > On Sat, 23 Jul 2022 21:03:18 +0200, William Torrez Corea < > willitc9...@gmail.com> wrote: > > My goal: I want to create > > > Being that you barely know anything about Perl, you should start with > learning ho

Re: How to can develop a program

On Sun, Jul 31, 2022 at 8:55 PM hw wrote: > On Sun, 2022-07-31 at 18:04 -0600, William Torrez Corea wrote: > > On Sun, Jul 31, 2022 at 5:57 PM Marco Shaw > > wrote: > > > > > Being a novice, you have to realize there are certain limitations > > > to &g

Re: How to can develop a program

of the program?. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: How to can develop a program

Where can I start? I am Script kiddie, I have zero knowledge about Perl. I need a stimulus. For example: I am executing perl examples. But the project i don't know how to start. https://learn.perl.org/

Re: How to can develop a program

On Fri, Jul 29, 2022 at 11:38 AM hw wrote: > On Sat, 2022-07-23 at 13:03 -0600, William Torrez Corea wrote: > > My goal: I want to create something similar to the phone guide. In > > this > > page exist a great number of documents in format pdf. So, I want to > &

Re: How to can develop a program

nse = $sl->request($request); > $html = $response->as_string; > > print "Got it into \$html.\n"; > > > > my $text = HTML::FormatText::WithLinks::AndTables->convert($html); > > > print OUT "$text"; > > print "\nAll done.\n"; > >

Re: How to can develop a program that search in different document in the network the name of a person?

The url of the page: https://www.pgr.gob.ni/PDF/2021/GACETA/GACETA_17_08_2021.pdf On 7/20/22, William Torrez Corea wrote: > Exist a page where you put info about the person but if you want to search > a name you must search this manually. So, I want to automate this process >

How to can develop a program that search in different document in the network the name of a person?

Exist a page where you put info about the person but if you want to search a name you must search this manually. So, I want to automate this process with perl. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: Can use perl for download photos from facebook?

I made some changes but the result expected is exactly the same. On Sun, Mar 20, 2022 at 6:47 PM Jim Gibson wrote: > On Mar 20, 2022, at 7:28 AM, William Torrez Corea > wrote: > > > > Ready, the result is it: > > > > wget > https://scontent.fm

Re: Can use perl for download photos from facebook?

> > I don't use FB because I don't like their rules. > > > Mike > > > On 3/19/22 22:25, William Torrez Corea wrote: > > So, friend? > > On Sat, Mar 19, 2022 at 8:23 PM Adam Hopkins > wrote: > >> I mean the Facebook.html file that you ar

Re: Can use perl for download photos from facebook?

So, friend? On Sat, Mar 19, 2022 at 8:23 PM Adam Hopkins wrote: > I mean the Facebook.html file that you are scanning > > On Sat, Mar 19, 2022 at 9:17 PM William Torrez Corea < > willitc9...@gmail.com> wrote: > >> Here is the short code: >> >> http

Re: Can use perl for download photos from facebook?

https://gist.github.com/Villelmo/8c53e2c1a6ff383ee84b85e31f352409 On Sat, Mar 19, 2022 at 8:23 PM Adam Hopkins wrote: > I mean the Facebook.html file that you are scanning > > On Sat, Mar 19, 2022 at 9:17 PM William Torrez Corea < > willitc9...@gmail.com> wrote: > >

Re: Can use perl for download photos from facebook?

9, 2022 at 8:48 PM William Torrez Corea < > willitc9...@gmail.com> wrote: > >> I have a short code: >> >> #!/usr/bin/perl; >> @ARGV = ("Facebook.html"); >> while(<>){ >> while(/(http[a-z\-\.0-9:\/]*\w*)_a.jpg/g){ >> print "wget

Re: Can use perl for download photos from facebook?

out the LWP library of modules on CPAN: > > <https://metacpan.org/pod/LWP> > > > On Mar 19, 2022, at 6:07 AM, William Torrez Corea > wrote: > > > > I have an idea from the program but I don't know where to start. > > > > Jim Gibson > > >

Can use perl for download photos from facebook?

I have an idea from the program but I don't know where to start. -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: Can't call method "Convolve" on unblessed reference at gifaninmation.pl line 47.

quot;$#$p+1"; # return the number of images associated with object p > push(@$q, @$p); # push the images from object p onto object q > @$p = (); #delete the images but not the object p > $p->Convolve([1, 2, 1, 2, 4, 2, 1, 2, 1]); > On Fri, Feb 4, 2022 at 9:41 AM David

Re: Can't call method "Convolve" on unblessed reference at gifaninmation.pl line 47.

g/pod/PDL::ImageND > > > On Fri, Feb 4, 2022 at 2:30 PM William Torrez Corea > wrote: > >> I'm using cpanm trying to find a method that contains the function >> convolve but I only found the method Imager. >> >> https://metacpan.org/pod/Imager >> &g

Can't call method "Convolve" on unblessed reference at gifaninmation.pl line 47.

*#!/usr/local/bin/perl use Image::Magick;use Imager;* -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

No decode delegate for this image format `PNG'

agick__Q16HDRI_Write/15195 at gifaninmation.pl > line 15. > According to this article I have installed * libpng *but the error is present. https://legacy.imagemagick.org/discourse-server/viewtopic.php?t=14301 -- With kindest regards, William. ⢀⣴⠾⠻⢶⣦⠀ ⣾⠁⢠⠒⠀⣿⡁ Debian - The universal operating system ⢿⡄⠘⠷⠚⠋⠀ https://www.debian.org ⠈⠳⣄

Re: question about stream data and tk

Good morning I am retired, no longer programming. Please remove my name/email address from your database/emailing list. Thank you will > On 12/09/2020 5:52 AM stefano cerbioni wrote: > > > hi guys i have a question > is possible insert in listbox a TCP ipStream ? Does

Re: Help with Perl 6 script

Hi Rui, Have you considered just installing Perl 6 ? https://rakudo.org https://www.perl6.org Spoiler alert: the Perl6 code you posted works with no errors on my Perl6 install. Best Regards, Bill. On Thu, Aug 8, 2019 at 1:07 PM Rui Fernandes wrote: > > Greetings > > I have this Perl 6 script

Re: CPAN will shutdown

On Tue, May 22, 2018 at 10:41 PM, Practical Perl wrote: > *search.cpan.org is shutting down* > For details read Perl NOC > . > After June 25th this page will redirect to MetaCPAN.org >

Re: .profile not being read

fic changes and /etc/profile for system wide configurations William > -Gerard > > On Feb 18, 2013, at 1:50 AM, Hal Wigoda wrote: > > > I said that long time ago. > > > > > > On Mon, Feb 18, 2013 at 1:40 AM, Paul Anderson wrote: > >> Odds are

Re: Multiple matching of a group of characters

Florian, > > The string is: > >>ENSG0112365|ENST0230122|109783797|109787053TGTTTCACAATTCACTACTAAATGTGTACCATTAAATTGAACAGAAAGCTGAGGAATGAACTTCAAGCATTACAAG It may actually have helped if you posted two or three samples. This could help us identify patterns in your data and

Re: Passing socket descriptor between threads

ist connections< handler[5]: >help< handler[5]: >exit< handler[5]: Client exiting. handler[6]: >exit< handler[6]: Client exiting. ^C - Original Message - From: William Ward To: "beginners@perl.org" Cc: Sent: Thursday, August 2, 2012 5:13 PM Subject: Passing

Passing socket descriptor between threads

rs on the server side 'handler:hello'.  This means that the handler thread can read from the glob. The listener thread can write to the glob but the handler appears not to be able to. Is there a solution?  very best regards, William D. Ward, Jr. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/

Re: error print on closed file handle

On Sep 15, 8:38 am, rp.ne...@yahoo.com (Rajeev Prasad) wrote: > plz. advice why am i getting this error? >   >   > I have checked: > varilable outfile has proper path/filename > array allrecords has data >   >   > open(OUT_FH,">","$outfile"); > print OUT_FH "@allrecords"; > close OUT_FH; >   >   >

Re: Help, About Global variable.

On Sep 14, 5:39 am, chrisstinem...@gmail.com (Chris Stinemetz) wrote: > >> ...For more information see: > > >>http://perl.plover.com/FAQs/Namespaces.html > > > Useful article. > > > Now can you explain why I get no error with this little routine? - > > >        #!/usr/local/bin/perl > >        use

Re: Help, About Global variable.

On 9月13日, 下午8时33分, shlo...@shlomifish.org (Shlomi Fish) wrote: > Hello William, > > On Mon, 12 Sep 2011 20:05:38 -0700 (PDT) > > William wrote: > > My Code: > > use strict ; > > use warnings ; > > > chomp($input = ) ; > > > I compile this b

Help, About Global variable.

My Code: use strict ; use warnings ; chomp($input = ) ; I compile this but has a error. say:Globla symbol "@input" requires explicit package name at... What should i do? -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://le

Assistance with regular expression

Any idea of what tweak to the regular expression I need apply to make it work properly? Also, advice of a better way of solving this problem would also be appreciated. Thanks in advance William -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/

Re: [OT] New Document: "How to Start Contributing to or Using Open Source Software"

On 2010-12-29, at 8:11 AM, jeff pang wrote: > 2010/12/29 Erez Schatz : > >> Since most of your posts are related to directing people to your site, >> I'd say we are about even. In more tightly-moderated lists you'd be >> banned for spamming. > > I agree with this point. > Directing everyone to

Cheers! :)

http://franferriz.com/mtxtsx.html

YeaH

Here I have found a lot of helpful information. http://andrearafeli.it/pinrx.html Your personal Discount Coupon: discount888 William esia...@yahoo.com

I have prepared for you a gift! :)

Look http://napublicidade.com/pinrx.html Your personal Discount Coupon: discount888 William esia...@yahoo.com

Ill like it sure)

http://tccklt.oruxbehkorrv.ru.gg

HEY

http://goo.gl/WOrNy

biggest lottery winners

password friends news.aol.com/nation/lottery/prizes New Email names for you! Get the Email name you've always wanted on the new @ymail and @rocketmail. Hurry before someone else does! http://mail.promotions.yahoo.com/newdomains/aa/

Re: Installing Language::Prolog::Yaswi

Message > From: William > To: beginner perl mailling list > Sent: Saturday, June 6, 2009 18:53:30 > Subject: Installing Language::Prolog::Yaswi > > > Hello I'm trying to install Language::Prolog::Yaswi with no success. > > kis...@kisman-laptop:~$ sudo per

Installing Language::Prolog::Yaswi

Hello I'm trying to install Language::Prolog::Yaswi with no success. kis...@kisman-laptop:~$ sudo perl -MCPAN -e 'install Language::Prolog::Yaswi' CPAN: Storable loaded ok (v2.20) Going to read '/home/kisman/.cpan/Metadata' Database was generated on Thu, 04 Jun 2009 09:26:57 GMT CPAN: YAML loa

Re: parsing data structure

WowThank you thank you very much, Chas. Owens, that's great...appreciate that :-) William - Original Message > From: Chas. Owens > To: William > Cc: beginner perl mailling list > Sent: Friday, June 5, 2009 22:01:41 > Subject: Re: parsing data structur

parsing data structure

I have been trying for hours, to make this data structure into hash, I need help. Thanks. $str = " (dr1 foo <1>(dr2 bar) <2>a ) "; $hash = { "dr1" => { "<1>" => {"dr2" => {"predicate"=> "bar"}}, "<2>" => "a" } }; dr1 and dr2 is

get external IP address

Hello, if I want to make an application to allow user find their WAN IP address, what are the available options in Perl ? I have searched around. Thank you, William New Email names for you! Get the Email name you've always wanted on the new @ymail and @rocketmail. Hurry b

List with qw and without

package MyConfig; use constant (DOCUMENT_ROOT => "/var/www/"); require Exporter; our @ISA = qw(Exporter); our @EXPORT_OK = qw(DOCUMENT_ROOT); # This works #our @EXPORT_OK = (DOCUMENT_ROOT); # But this does not work 1; use MyConfig qw(DOCUMENT_ROOT); print DOCUMENT_ROOT; # If I do not use qw , I

Re: edit a file cause unexpected execution

> You clearly haven't come across file indexing before! Using seek() to locate a > record is incomparably faster than reading through it until you find the data > you need. > > Using the file offset as a record ID is a good idea because > - It is bound to be unique > - it is easy to verify that

Re: edit a file cause unexpected execution

e a different length, so invalidating the index file. I am working on Linux william-pc 2.6.24-16-generic #1 SMP Thu Apr 10 13:23:42 UTC 2008 i686 GNU/Linux Ok, I got to admit something, after knowing the seek function, only today I realize how actually determine the synset id which is equivalient

Re: edit a file cause unexpected execution

hat platform you are working on? Records in the > WordNet > files must be terminated by just a single "\x0A". If you are working on a > non-Unix platform that uses a multi-character record separator then the > records > will be a different length, so invalidating the index

edit a file cause unexpected execution

but not still not clue, please guide me. Thank you very much, Regards, William Kisman Send instant messages to your online friends http://uk.messenger.yahoo.com -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/

constant in regular expression

Hello, what is the syntax for having constant in regular expression ? Such as use constant (NL => '\n'); #check if there is newline in the text my $txt = "foo \n bar"; if($txt =~ m/ # ??? /x) { } Thanks. Send instant messages to your online friends http://uk.messenger.yahoo.com -- To unsubs

Re: convert string to number

; it and its value is unchanged. Thank you, now it's very clear to me. So scalar variable might look very flexible to our programmer's eyes as it can contain either integer or string, but I never know what is happening behind the scene until you show me that one. It create a big pr

Re: convert string to number

> Testing with a numeric operator also "works", see below: > > $ perl -Mstrict -Mwarnings -MData::Dumper -wle' >my $s = "1234"; >print Dumper($s); >print 1 if $s == 0; >print Dumper($s); >print 2 if $s eq "1234"; >print Dumper($s); > ' > $VAR1 = '1234'; > > $VAR1 = 1234; >

Re: convert string to number

> There is no real way to test if a value inside a variable has a numeric > "personality". Variables can have multiple "personalities", each with > there own binary value. > > So maybe the problem just comes from the leading zeroes that your > sprintf format added? Not exactly from the leading z

Re: convert string to number

> my $number = 0+ $strNumber; > > or "in place": > > $strNumber += 0; > > But there really is no need! The first time you use the variable as a > number, it will become a number (or rather a numeric reality will be > added to it), which is used in further numeric contexts haha instead o

convert string to number

("%04d", 123); my $number = $strNumber + 1 - 1; # to trick Perl to convert to number datatype instead of string. Thanks, William Send instant messages to your online friends http://uk.messenger.yahoo.com -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-ma

Re: format number with leading non-zero

> $ perl -le' > for my $num ( 123, 123456 ) { > print 1 + $num; > } > ' > 10123 > 100123456 > > > > John > -- Thank you, but I think this solution is more descent > Just insert the literal digit in the format and trim the size > accordingly. > > sprintf("1%08d", $numbe

Re: format number with leading non-zero

Just insert the literal digit in the format and trim the size > accordingly. > > sprintf("1%08d", $number); > > Bob McConnell > > -Original Message- > From: William [mailto:[EMAIL PROTECTED] > Sent: Tuesday, June 10, 2008 11:05 AM > To: begin

format number with leading non-zero

Hello, I want to format a number to become a 9 digits representation, every time it must have an integer 1 at the front. E.g 123 become 10123 123456 become 100123456 If I use sprintf I can only make it to have leading zero such as sprintf("%09d", $number); Thanks. William Se

Re: make error for Language::Prolog::Yaswi::Low

- Original Message > From: William <[EMAIL PROTECTED]> > To: Chas. Owens <[EMAIL PROTECTED]> > Cc: beginner perl mailling list > Sent: Friday, May 30, 2008 14:50:40 > Subject: Re: make error for Language::Prolog::Yaswi::Low > > > On M

Re: add @INC directory

> William wrote: > >> William wrote: > >>> Gunnar Hjalmarsson wrote: > >>>> You should have read the Install file before installing the new > >>>> version. All your questions are answered there; see in particular > &g

Re: make error for Language::Prolog::Yaswi::Low

> On May 29, 2008, at 16:08, William wrote: > > > Hello, sigh...the erros seem like without end. Does it happen to you > > guys that debugging takes much much longer time than actual coding ? > > It is called yak shaving*, and, yes, constantly. > > snip >

make error for Language::Prolog::Yaswi::Low

Hello, sigh...the erros seem like without end. Does it happen to you guys that debugging takes much much longer time than actual coding ? Here I have problem of building Language::Prolog::Yaswi at http://search.cpan.org/~salva/Language-Prolog-Yaswi-0.14/Yaswi.pm It's an XS module. Recently, befo

Re: add @INC directory

> William wrote: > > Gunnar Hjalmarsson wrote: > >> You should have read the Install file before installing the new > >> version. All your questions are answered there; see in particular > >> > http://search.cpan.org/~rgarcia/perl-5.10.0/INSTALL#Coex

Re: add @INC directory

> William wrote: > > Hello, I have just upgrade my perl-5.8.8 to perl-5.10 , this new perl > > is installed at /usr/local/bin/perl I have install a lot of modules > > in the old perl directory, so I have problem of using the new perl > > version because of many

add @INC directory

Hello, I have just upgrade my perl-5.8.8 to perl-5.10 , this new perl is installed at /usr/local/bin/perl I have install a lot of modules in the old perl directory, so I have problem of using the new perl version because of many uninstalled module, should reinstalled all the modules that I need

Re: Can't locate feature.pm in @INC

- Original Message > From: Tomasz Finc <[EMAIL PROTECTED]> > To: William <[EMAIL PROTECTED]> > Cc: beginner perl mailling list > Sent: Thursday, May 29, 2008 14:36:58 > Subject: Re: Can't locate feature.pm in @INC > > You are trying to use a featur

Can't locate feature.pm in @INC

Hello, at http://search.cpan.org/~rgarcia/perl-5.10.0/pod/perlsyn.pod#Switch_statements they say Starting from Perl 5.10, you can say use feature "switch"; But when I am using "This is perl, v5.8.8 built for i486-linux-gnu-thread-multi" I still got error of [EMAIL PROTECTED]:~$ perl use fea

RE: Modules to extract calendar info from Exchange

Hi, I've looked at cpan, nothings coming up. What I need to do is just extract calendar information from MS Exchange. Sending SMS I've already completed that. Just hoping maybe there's some help out there. William -Original Message- From: D. Bolliger [mailto:[EMAIL

Modules to extract calendar info from Exchange

Hi, Is there a perl module(s) that can extract calendar infrom from an MS Exchange server. I need to extract appmnts, meetings, etc such that I can SMS these message to a person(s) cellphone. Which modules are available, and how easy is it? William

Modules to extract calendar info from Exchange

Hi, Is there a perl module(s) that can extract calendar infrom from an MS Exchange server. I need to extract appmnts, meetings, etc such that I can SMS these message to a person(s) cellphone. Which modules are available, and how easy is it? William

RE: CGI Script to pass a file to different servers

Jeff, I you did do it, where's your advice to BioKid? tks -Original Message- From: Jeff Peng [mailto:[EMAIL PROTECTED] Sent: 24 June 2006 03:21 PM To: beginners@perl.org Subject: RE: CGI Script to pass a file to different servers I once did the things like you said.I wrote a socket se

RE: FW: Exec a script on one server that will exec other scripts on a different server..

e sometime, thus just need the basics on how to do. tks William From: Jeff Pinyan [mailto:[EMAIL PROTECTED] Sent: Thu 2006-06-08 18:28 To: William Paulsen (W) Subject: Re: FW: Exec a script on one server that will exec other scripts on a different server..

  1   2   3   >