On 2004-02-26 00:43:21 +, [EMAIL PROTECTED] (Wolf Blaum) said:
As I understand Biology, there is 4 nucleotid acids which gives 4**2
combinaions for dupplets. So you need 8 vars to count the occourence of
all douplets. Worse for triplets. (24)
As I understand genetics, triplets are what matte
Hi all -
Many thanks to those who shared their knowledge. I had a feeling that
there would be an elegant solution to my problem, but I was having no
luck figuring it out.
For reference, where before my code was:
$Pcc++ while $sequence =~ /cc/gi;
..it is now:
$Pcc++ while $sequence =~ /c(?=c)
On 2004-02-25 17:42:46 +, [EMAIL PROTECTED] (Kenton Brede) said:
If you don't get an answer to your question this is probably why -
http://learn.perl.org/beginners-faq#2.2%20%20what%20is%20this%20list%20_not_%20for
Kent
Kent
Kent
Kent -
Thanks for the pointer. I should have read the list
I'm having trouble counting the number of specific substrings within a
string. I'm working on a bioinformatics coursework at the moment, so my
string looks like this:
$sequence = "caggaactttcggaagaccatgta";
I want to count the number of occurrences of each pair of letters, for example:
Num
