Re: help with Expect

On Friday 21 May 2004 23:41, Yi Chu wrote: > Does anyone know the mailing list for beginners for Expect? Or some of you > may know the answer to my question, I just ask the question here. > > How to send function key in Expect program? > > Example: > send "Tab()\r" > would send the tab character.

Re: Substitution/Regex problem

On Thursday 29 April 2004 10:31, Owen wrote: > I would like to replace all instances of > > @non_space_characters[non_space_characters] with > $non_space_characters[non_space_characters] > > The program below gets the first one only. How do I get the others? > > TIA > > Owen > ---

RE : SQL Syntax quickie

Another solution : For your query, try "SELECT MAX(id) FROM table" That works with mysql. -Message d'origine- De : dan [mailto:[EMAIL PROTECTED] Envoyé : samedi 25 octobre 2003 11:44 À : [EMAIL PROTECTED] Objet : SQL Syntax quickie Hi, I've looked around to not much avail, what I'm l

Starter of a script

Hello every body, How to know what task have run a perl script ? I mean is possible to get within the code which process Id have start the script. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]

Reg Exp

First of all, sorry for my poor english. I work with DNA sequence and want to extract relevant motives of course using regular expression. A concrete example will be better than a long description of my problem, so : Here is a string corresponding to my DNA strand : cgttgctagctgctatcgatgtgctagtc

RE: Handling Charset

> -Message d'origine- > De : Bob Showalter [mailto:[EMAIL PROTECTED]] > Envoyé : jeudi 2 mai 2002 17:44 > À : gross, cedric; Beginners (E-mail) > Objet : RE: Handling Charset > > > > -Original Message- > > From: gross, cedric [mailto:[EMA

Handling Charset

Hello, How to handle this kind of string : =?iso-8859-1?Q? Is there a perl module to manage that ? Thanks for your answer. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]

RE: Segmentation fault - core dumped

to find out with the core dumped file but it's not human readable...(for me) Cedric > > nice vagueness though. i give it a 9. > > k > > On Tue, Feb 19, 2002 at 09:56:34AM +0100, gross, cedric wrote: > > > >Dear all, > > > > > > > >

Segmentation fault - core dumped

Dear all,   Sometimes with this piece of prog join I obtain a segmentation fault - core dumped... Why ? and How I could solve it ?     Thanks for help meta_extract.pl Description: meta_extract.pl -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTEC

Include file

I have a set of program to do which is using always same var. So I would like to defined a small file where I defined my var (like $database="toto" $host="localhost" etc..) and then include it in my other program, but How to do that ? I try "use" but it's seems that is for complete module. "re

Size of directory

Hello, I don't reach understand how I could obtain the size of a given directory and all the sub-directory.. Is there a function doing that ? or Is somebody have a sub doing that ? Another question : What is the meanning of this 512 bytes for a directory when I do a LL on my unix system ?