Hi
/search.php fills the text box values. But /search.php has two form action
elements
1)
AND
2)
I did GET and POST to both results.php page , which gives *'String could
not be parsed as XML'* exception.
Should data passed be in some XML format or normal query ?
POST on blast_results.php also does not work.
I guess i am not able to identify the variable names to be
passed.For/search.php i found the
variables.But couldnt in the other forms.
Thanks for your help..
Suyash
On Jan 11, 2008 10:27 PM, Mike Meyer <[EMAIL PROTECTED]> wrote:
> On Fri, 11 Jan 2008 14:44:19 +0530 "suyash jape" <[EMAIL PROTECTED]>
> wrote:
>
> > Hi all
> > i want to access a web page through python script, fillup the necessary
> > fields,
> > and press submit button (which does POST call) and retrieve the result
> page
> > and retrieve some values from it.
> >
> > Here is the script i have written till now.
> >
> > >import urllib2
> > > # create array of name/value pairs
> > > self.params = urllib.urlencode({'seqname': 'BioSequence', 'sequence':
> > 'ATACATTATCCAAACATAGCATGGCTT'})
> > >
> > > # send http-post
> > > request = urllib.urlopen("http://www.hydrazome.metazome.net/search.php
> ",
> > params)
> > >
> > > # read back each line of reply
> > > line = request.read()
> > >print line
> >
> > This script fills up the correct values in the search.php page.But i am
> not
> > sure if it is doing the POST (submit call).
> > Beacause in 'line' varialble, i am getting the search.php page.Not the
> > result page which is blast_results.php.
> >
> > How to retrieve the result page?
>
> Sounds like you're not POSTing to the right page.
>
> The form on .../search.php lets you fill in values, but those values
> are not necessarily POSTed to search.php. In particular, the form element
> has an action attribute that has a URL to which the values on the page
> should be posted. If that points to .../blast_results.php, then that's
> the page you need to pass to urlopen with your data.
>
> --
> Mike Meyer < [EMAIL PROTECTED]>
> http://www.mired.org/consulting.html
> Independent Network/Unix/Perforce consultant, email for more information.
>
--
http://mail.python.org/mailman/listinfo/python-list
