Re: print there!
Godwin Burby wrote: > i think u've misunderstood my question. Your solution will print on a > new line as below: > c:\godwin\bl.csv 1 > c:\godwin\bl.csv 2 > c:\godwin\bl.csv 3 > But i want this number to diplay their value increase on the same line > on the same sport itself without printing the filename multiple times > on multiple lines: I think u've misunderstood the answer. filename = 'c:\\godwin\\bl.csv' for i,row in enumerate(reader): # inserts or updates the database print "\r" + filename, i, # <-- notice the trailing comma print -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
Martijn Iseger wrote: > >> Domain-specific modeling makes software development 5-10 times faster > >> than approaches based on UML or MDA. It accelerates development and > >> reduces complexity by automatically generating full code from > >> higher-abstraction design models. > >> > > Wow, look everyone! A silver bullet! > > > Before slashing down in ignorance - educate yourself on www.dsmforum.org. > After that: feel free to comment. I will make you look a lot more intelligent > Peter Hansen. if you don't understand the "silver bullet" reference, you're not qualified to use phrases like "makes software development 5-10 times faster". -- http://mail.python.org/mailman/listinfo/python-list
Re: webbrowser failing
Thomas Thomas wrote: > import webbrowser > url='http://www.cnn.com' > webbrowser.open(url) > > giving the error > WindowsError: [Errno 2] The system cannot find the file specified: > 'http://www.cnn.com' So you have a Windows install that don't understand HTTP paths, most likely because you (or someone else) has tinkered with the registry. Possible solutions: 1. fire up your browser and use the browser's "make this browser the default browser" feature, if available 2. run the Set Program Access and Default -- http://mail.python.org/mailman/listinfo/python-list
Re: print there!
It's possible you will need to run python -u for this to behave as expected. Otherwise python may buffer the output until it sees a newline so you only see the last result. -- David -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
I just wonder about that 5-10 times faster. that's a really wide range. :) On 9/21/05, Fredrik Lundh <[EMAIL PROTECTED]> wrote: > Martijn Iseger wrote: > > > >> Domain-specific modeling makes software development 5-10 times faster > > >> than approaches based on UML or MDA. It accelerates development and > > >> reduces complexity by automatically generating full code from > > >> higher-abstraction design models. > > >> > > > Wow, look everyone! A silver bullet! > > > > > Before slashing down in ignorance - educate yourself on www.dsmforum.org. > > After that: feel free to comment. I will make you look a lot more > > intelligent > > Peter Hansen. > > if you don't understand the "silver bullet" reference, you're not qualified > to use > phrases like "makes software development 5-10 times faster". > > > > > > -- > http://mail.python.org/mailman/listinfo/python-list > -- http://mail.python.org/mailman/listinfo/python-list
Re: webbrowser failing
(trying again) Thomas Thomas wrote: > import webbrowser > url='http://www.cnn.com' > webbrowser.open(url) > > giving the error > WindowsError: [Errno 2] The system cannot find the file specified: > 'http://www.cnn.com' you have a Windows install that don't understand HTTP paths, most likely because you (or someone else) has tinkered with the registry. Possible solutions: 1. fire up your browser and use the browser's "make this browser the default browser" feature, if available 2. use the "Set Program Access and Default" menu (on the start menu) to select what browser to use or 3. use Jem Berkes' SetBrowser tool: http://www.pc-tools.net/win32/setbrowser/ (make sure you read the warnings on that page before you proceed), -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
> if you don't understand the "silver bullet" reference, you're not > qualified to use phrases like "makes software development 5-10 times > faster". You could reverse that as well: http://www.dsmforum.org -- http://mail.python.org/mailman/listinfo/python-list
Re: Object default value
"ago" <[EMAIL PROTECTED]> wrote: > Is it possible to have a default value associated python objects? I.e. > to flag an attribute in such a way that the assignment operator for the > object returns the default attribute instead of the object itself, but > calls to other object attributes are properly resolved? (I don't think > so, but I am not sure) No. You can overload certain methods to make an object behave like one of its attributes in certain contexts (e.g. comparisions, math operations, conversions), but you cannot do it for all operations. Especially not the "assignment operator", since there is no such thing in Python. (assignment is a statement, and it's an operation on the target namespace, not the source object). (As always, Python works better if you use it to write Python programs) -- http://mail.python.org/mailman/listinfo/python-list
Re: Premature wakeup of time.sleep()
Thank you every body for your comments. Especially Jeff Epler for your hint about NTP. You're right. I see a (constant but somewhat huge)time drift of about 1 ms/min which I can correct for. Thank you Steve Horsley for the clarification of the interrupts that would end the delay. I didn't think of something as trivial as ^C. And thank you Nick Craig-Wood for the shell script to get hands on the HZ value. I had to modify it a little as I do not have /proc/interrupts, but I've got the idea. I measure about 100 and so I have a 10 ms granularity in my VPS as you predicted. Erich -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
Martijn Iseger wrote: >>if you don't understand the "silver bullet" reference, you're not >>qualified to use phrases like "makes software development 5-10 times >>faster". > > > You could reverse that as well: http://www.dsmforum.org > > Having taken the time to educate myself (following the repeated spamming to promote a seminar) I can offer the following observations, but I am omitting the URLs as I believe you've already had far more publicity than the site really merits. 1. Any organisation that can talk about "a leap in productivity of 400% from Assembler to BASIC" as though nothing occurred in between suffers such a total disconnect from computing history that it's hard to take other utterances seriously. 2. "The last OOPSLA ... put forward Domain-Specific Modeling as a solution. Similar statements have been uttered recently by Bill Gates and Grady Booch, among others." The fact that a technique is promoted at a conference doesn't mean the book about it came down from a mountain carried by a prophet. The technologies the dsmforum site rubbishes were similarly promoted. If you *have* to choose a prophet then I'd stick with Booch, as Gates has proved many times that he's a far better (or anyway more ruthless) businessman than he is a software architect. 3. "Domain-Specific Modeling is only possible because it narrows down the design space or domain" presumably means that component-based approaches are more successful when the components are created with the problem domain in mind. What a surprise. And so on. Please note I am not saying that DSM has nothing to offer, simply that it isn't marketing itself any more effectively (or IMHO any more convincingly) than any other comparable technological advance. Since you appear to be an account or channel manager perhaps the best advice I can give you is to leave c.l.py to your technical staff and avoid such blatant self-promotion. DSM might seem like a silver bullet to you, but others have seen similar claims come and go without major changes in software methodology. You might also like to look up "flowchart" in your dictionary ;-) regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
Re: Crypto.Cipher.ARC4, bust or me doing something wrong?
Michael J. Fromberger wrote:
...
> Since ARC4 is a stream cipher, the keystream changes over time -- with
> ARC4, after each character enciphered. To decrypt successfully, you
> need to make sure the decrypting keystream exactly matches the
> encrypting one.
...
from Crypto.Cipher import ARC4 as cipher
enc = cipher.new("abcdefgh")
dec = cipher.new("abcdefgh")
x = enc.encrypt("This is some random text")
x
> "\x05o\xd5XH|\xa4\xfc\xf7z\xecd\xe92\xfb\x05rR'\xbf\xc0F\xfc\xde"
y = dec.decrypt(x)
y
> 'This is some random text'
enc.decrypt(x)
> 'M|[bI\x1ciG6A]\x13Hz\xb0\x19\xca\xf1-\x9a\x1a2\x9e%'
>
> I hope this helps clear up your confusion.
Hi Michael,
Thanks for this, much appreciated.
Michael
--
[EMAIL PROTECTED], http://kamaelia.sourceforge.net/
British Broadcasting Corporation, Research and Development
Kingswood Warren, Surrey KT20 6NP
This message (and any attachments) may contain personal views
which are not the views of the BBC unless specifically stated.
--
http://mail.python.org/mailman/listinfo/python-list
Re: Digest MD5 authentication over using ZSI
Just for the record. After accepting that pythons build-in digest
authentication (HTTPDigestAuthHandler) does *NOT* work, I made my own
digest authentication handler and built it into ZSI, they have recieved
and accepted the patch so it should be part of the next ZSI release
(current 1.7).
I have tested the implementation with Microsoft MapPoint services,
seems OK:
#-
#Usage example (MapPoint SOAP Services):
#-
from CommonService_services import *
loc = FindServiceLocator()
import sys
import ZSI
kw={'tracefile':sys.stdout, 'auth' : (
ZSI.AUTH.httpdigest, 'username', 'passwd') }
portType = loc.getFindServiceSoap(**kw)
AddressLine='Lergravsvej 28'
PostalCode='8660'
CountryRegion='DK'
InputAddress = ns1.Address_Def()
InputAddress._AddressLine = AddressLine
InputAddress._PostalCode = PostalCode
InputAddress._CountryRegion = CountryRegion
specification = ns1.FindAddressSpecification_Def()
specification._InputAddress = InputAddress
specification._DataSourceName = 'MapPoint.EU'
request = FindAddressSoapInWrapper()
request._specification = specification
res = portType.FindAddress(request)
#-
Best regards
Jakob Simon-Gaarde
--
http://mail.python.org/mailman/listinfo/python-list
spe stani collapse all method?
hello, I wonder if anyone used spe stani, I'm looking for how to collapse all code fold, but can't find. pujo -- http://mail.python.org/mailman/listinfo/python-list
Re: Crypto.Cipher.ARC4, bust or me doing something wrong?
Michael Sparks <[EMAIL PROTECTED]> writes: > I'm looking at using this library and to familiarise myself writing > small tests with each of the ciphers. When I hit Crypto.Cipher.ARC4 I've > found that I can't get it to decode what it encodes. This might be a > case of PEBKAC, but I'm trying the following: You have to reinitialize the cipher state for decryption, as someone else explained. You also have to make sure that keys are unique and independent for separate messages. For most applications you probably want to think about adding authentication. In general you shouldn't use arc4 unless you know what you're doing. What's the application? -- http://mail.python.org/mailman/listinfo/python-list
How to copy a file from one machine to another machine
Hi there,
I would like to copy a file from one machine (machine #01) to another
(machine #02).
machine #01: Suse Linux 9.2, Samba 3, Python 2.3.5
machine #02: Windows Machine, Destination Dir: \temp\files\
Both machines are in one network so they can communicate each other. In
order to be able to write a file in the directory on Machine #02 I need
to be the user "myadmin".
In a short Python program I create the source file on Machine #01 like this:
filecontent = 'This is just a test...'
# my own helper method to generate a unique filename
filename = createUniqueFilename()
f = open('/var/files/' + filename, 'w')
f.write(filecontent)
f.close()
Every time a new source file has been created it needs to be copied or
moved from machine #01 to machine #02.
Are there Python modules which help me doing this job? Any examples how
to do that would be very helpful.
Kind regards and many thanks in advance,
Nico
--
http://mail.python.org/mailman/listinfo/python-list
Re: Would you pls tell me a tool to step debug python program?
>Johnny Lee wrote: >> Hi, >>I've met a problem to understand the code at hand. And I wonder >> whether there is any useful tools to provide me a way of step debug? >> Just like the F10 in VC... Not single stepping, but flow tracing, complete with variables, parameters and return values. Python Bug Validator. http://www.softwareverify.com Stephen -- Stephen Kellett Object Media Limitedhttp://www.objmedia.demon.co.uk/software.html Computer Consultancy, Software Development Windows C++, Java, Assembler, Performance Analysis, Troubleshooting -- http://mail.python.org/mailman/listinfo/python-list
send mail through webmail
Hello all, i'd like to send mails from my account. At office it's easy because, i can access directly to the mail server and smpt works fine. but now, i'm working out of office and i can access via web, login, ... is there a way to send mails by microsoft outlook web access? thanks -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
Hello Steve, > 1. Any organisation that can talk about "a leap in productivity of > 400% from Assembler to BASIC" as though nothing occurred in between > suffers such a total disconnect from computing history that it's hard > to take other utterances seriously. I believe the point being made by the organization is that during computing history the most successful shifts in productivity were achieved by similar shifts in raising the abstraction level on which developers specify solutions. According to Capers Jones Software Productivity research Fortran is 4.5 times more productive than Assembler. Looking at chronology I'd say it is not incorrect to refer to the advent of compilers as a leap. > 2. "The last OOPSLA ... put forward Domain-Specific Modeling as a > solution. Similar statements have been uttered recently by Bill Gates > and Grady Booch, among others." The fact that a technique is promoted > at a conference doesn't mean the book about it came down from a > mountain carried by a prophet. Absolutely. Fact is that both (prophets?) as well as a growing number of experts (other prophets?) see this approach as a viable one, hence the increased interest at a growing number of events. > 3. "Domain-Specific Modeling is only possible because it narrows down > the design space or domain" presumably means that component-based > approaches are more successful when the components are created with > the problem domain in mind. What a surprise. Nope, it means that instead of using generic languages (programming or modeling) to specify solutions on top of your platform/component framework, in many cases it makes more sense to use a language that better fits your problem domain. Using components is one way of raising abstraction from the "bottom up" and narrowing your design space. Why stop there? Depending on how the language has been created, a good DSM language is on a higher abstraction level than for example C, Java, Python etc. Still, from model instances you can generate all the lower level code (which in turn interfaces with your component framework). Wouldn't you agree this makes development faster and more mature? > You might also like to look up "flowchart" in your dictionary ;-) Maybe I will! Regards, Martijn -- http://mail.python.org/mailman/listinfo/python-list
Re: Windows paths, Java, and command-line arguments, oh my!
Steve M wrote: >Well, apparently I fried my brain trying to sort this out. There is a >typo in my example code in the post but not in my real program. (I know >it is a no-no when asking help on c.l.py but I simplified some details >from the real code in order not to confuse the issues. Probably >backfired by this point.) Below is the post with the error fixed and >one sentence added (to clarify why the error in my original post really >was not the problem). Thanks for any advice. >--- >I'm trying to invoke a Java command-line program from my Python program >on Windows XP. I cannot get the paths in one of the arguments to work >right. > >The instructions for the program describe the following for the >command-line arguments: > >java -jar sforcedataloader.jar -Dsalesforce.config.dir=CONFIG_DIRECTORY > >They also give an example: > >java -Dsalesforce.config.dir=c:\config -jar sforcedataloader.jar > >If I type the example above at the cmd.exe command line the thing works >(assuming I have the config file in c:\config). What doesn't work is >these two lines: > >cmd = r'java -jar sforcedataloader.jar >-Dsalesforce.config.dir=c:\config' >os.system(cmd) > > > > Unless you have fixed your typo in a different place, you have the same problem as before. There are two issues, you need to escape the backslash and you have the java properties line in the wrong place. Instead of: cmd = r'java -jar sforcedataloader.jar -Dsalesforce.config.dir=c:\config' os.system(cmd) use cmd = r'java -Dsalesforce.config.dir=c:\\config -jar sforcedataloader.jar' os.system(cmd) Neil -- Neil Benn Senior Automation Engineer Cenix BioScience BioInnovations Zentrum Tatzberg 47 D-01307 Dresden Germany Tel : +49 (0)351 4173 154 e-mail : [EMAIL PROTECTED] Cenix Website : http://www.cenix-bioscience.com -- http://mail.python.org/mailman/listinfo/python-list
Re: /usr/lib/python2.3/site-packages/_mysql.so: undefined symbol: mysql_rollback
Hi Skip. Thank you very much for your answer. If LDD: [EMAIL PROTECTED] /]# ldd /usr/lib/python2.3/site-packages/_mysql.so libmysqlclient.so.10 => /usr/lib/mysql/libmysqlclient.so.10 (0xf6fb3000) libcrypt.so.1 => /lib/libcrypt.so.1 (0xf6f84000) libnsl.so.1 => /lib/libnsl.so.1 (0xf6f6e000) libm.so.6 => /lib/tls/libm.so.6 (0xf6f4b000) libz.so.1 => /usr/lib/libz.so.1 (0xf6f3b000) libpthread.so.0 => /lib/tls/libpthread.so.0 (0xf6f29000) libc.so.6 => /lib/tls/libc.so.6 (0xf6e02000) /lib/ld-linux.so.2 (0x001d8000) There is no libmysql, but I've got no idea where it is: [EMAIL PROTECTED] /]# find . -name "*libmysql.so*" (no results) In addition, on my PC (where MySQL-python works ok), there is no libmysql: -- [EMAIL PROTECTED] /]# ldd /usr/lib/python2.3/site-packages/_mysql.so linux-gate.so.1 => (0x00883000) libmysqlclient.so.10 => /usr/local/mysql/lib/mysql/libmysqlclient.so.10 (0x00cbf000) libz.so.1 => /usr/lib/libz.so.1 (0x00d52000) libcrypt.so.1 => /lib/libcrypt.so.1 (0x0092c000) libnsl.so.1 => /lib/libnsl.so.1 (0x00ed6000) libm.so.6 => /lib/tls/libm.so.6 (0x00558000) libpthread.so.0 => /lib/tls/libpthread.so.0 (0x00db3000) libc.so.6 => /lib/tls/libc.so.6 (0x0037c000) /lib/ld-linux.so.2 => /lib/ld-linux.so.2 (0x00753000) [EMAIL PROTECTED] /] find . -name "*libmysql.so*" (no results) - Must I install some extra tool? Thank you very much. 2005/9/16, [EMAIL PROTECTED] <[EMAIL PROTECTED]>: > > thomas> ImportError: /usr/lib/python2.3/site-packages/_mysql.so: undefined > thomas> symbol: mysql_rollback > > skip> Is your libmysql.so installed in an odd place? > > Oh, also, try executing > > ldd /usr/lib/python2.3/site-packages/_mysql.so > > If that shows libmysql as undefined. Find out where it is and set > LD_LIBRARY_PATH to refer to it, then try again. If that succeeds, either > retain the LD_LIBRARY_PATH setting or relink _mysql.so with the -R stuff I > referred to in my first message. > > Skip > -- http://mail.python.org/mailman/listinfo/python-list
Re: Would you pls tell me a tool to step debug python program?
Johnny Lee wrote: > Hi, >I've met a problem to understand the code at hand. And I wonder > whether there is any useful tools to provide me a way of step debug? > Just like the F10 in VC... > > Thanks for your help. > > Regards, > Johnny > The pdb module is a basic starting point for Python's debugging features, and can be useful for a single attack on a single truculent bug. Wing IDE has a stepping debugger. It's not the only tool with this feature, but I've found it very convenient, and use it daily. You can download a one-month evaluation, as with many similar products. http://www.wingware.com/ regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
RE: How to copy a file from one machine to another machine
[Nico Grubert] | I would like to copy a file from one machine (machine #01) to another | (machine #02). | | machine #01: Suse Linux 9.2, Samba 3, Python 2.3.5 | machine #02: Windows Machine, Destination Dir: \temp\files\ | | Both machines are in one network so they can communicate each | other. In order to be able to write a file in the directory on Machine | #02 I need to be the user "myadmin". | Every time a new source file has been created it needs to be | copied or moved from machine #01 to machine #02. There are several possibilities, depending on what you're happy to run and where, but perhaps the simplest is to have the share on the Win32 machine mounted on your Linux box under the appropriate username and to copy the files there. From your description I assume you're in control of the files' creation, but even if you're not you could use something like python-fam to detect additions. Is there anything I've missed? TJG This e-mail has been scanned for all viruses by Star. The service is powered by MessageLabs. For more information on a proactive anti-virus service working around the clock, around the globe, visit: http://www.star.net.uk -- http://mail.python.org/mailman/listinfo/python-list
Re: How to copy a file from one machine to another machine
Nico Grubert wrote:
> Hi there,
>
> I would like to copy a file from one machine (machine #01) to another
> (machine #02).
>
> machine #01: Suse Linux 9.2, Samba 3, Python 2.3.5
> machine #02: Windows Machine, Destination Dir: \temp\files\
>
> Both machines are in one network so they can communicate each other. In
> order to be able to write a file in the directory on Machine #02 I need
> to be the user "myadmin".
>
> In a short Python program I create the source file on Machine #01 like this:
>
> filecontent = 'This is just a test...'
> # my own helper method to generate a unique filename
> filename = createUniqueFilename()
> f = open('/var/files/' + filename, 'w')
> f.write(filecontent)
> f.close()
>
>
> Every time a new source file has been created it needs to be copied or
> moved from machine #01 to machine #02.
> Are there Python modules which help me doing this job? Any examples how
> to do that would be very helpful.
>
This isn't really a Python question, as this problem would exist
irrespective of the language you are using.
One possibility would be to run Samba (www.smaba.org) on the Linux
machine so it offered a share to the Windows machine. Then you could
just write to a UNC path (\\server\path\to\file) from Windows and have
the file appear on the Linux machine.
Another way would be to use CIFS client on Linux to access the share
from the Windows machine.
There are many other file sharing solutions, and you can of course also
consider using FTP to send the file to the Linux server.
Some ideas to start with, anyway.
regards
Steve
--
Steve Holden +44 150 684 7255 +1 800 494 3119
Holden Web LLC www.holdenweb.com
PyCon TX 2006 www.pycon.org
--
http://mail.python.org/mailman/listinfo/python-list
scipy for python 2.4 on windows
I am a newbie to python, and have not so much experiences on package installation and related issues. I am looking for Scipy binaries for python 2.4 on windows. Could somebody here kindly give some suggestion to this? Thanks in advance. -- http://mail.python.org/mailman/listinfo/python-list
Re: slicing functionality for strings / Python suitability forbioinformatics
On Wed, 21 Sep 2005, Steven D'Aprano wrote:
> On Mon, 19 Sep 2005 19:40:12 -0700, jbperez808 wrote:
>
>> Having to do an array.array('c',...):
>>
>> >>> x=array.array('c','ATCTGACGTC')
>> >>> x[1:9:2]=array.array('c','')
>> >>> x.tostring()
>> 'AACAGACATC'
>>
>> is a bit klunkier than one would want, but I guess the efficient
>> performance is the silver lining here.
>
> There are a number of ways to streamline that. The simplest is to merely
> create an alias to array.array:
>
> from array import array as str
>
> Then you can say x = str('c', 'ATCTGACGTC').
>
> A little more sophisticated would be to use currying:
>
> def str(value):
>return array.array('c', value)
>
> x = str('ATCTGACGTC')
There's a special hell for people who override builtins.
> although to be frank I'm not sure that something as simple as this
> deserves to be dignified with the name currying.
It's definitely not currying - it doesn't create a new function. Currying
would be:
def arraytype(kind):
def mkarray(value):
return array.array(kind, value)
return mkarray
chars = arraytype('c')
seq = chars("tacatcgtcgacgtcgatcagtaccc")
> Lastly, you could create a wrapper class that implements everything you
> want. For a serious application, this is probably what you want to do
> anyway:
Definitely - there are lots of things to know about DNA molecules or parts
of them that aren't captured by the sequence.
tom
--
If it ain't Alberta, it ain't beef.
--
http://mail.python.org/mailman/listinfo/python-list
Perl's documentation come of age
Perl's documentation has come of age: http://perldoc.perl.org/ Python morons really need to learn: • ample example codes. • example codes are linked to the appropriate doc location for each code word in the example. • written in a task-oriented style, or manifest-functionality style. That is, it does not have fucking pretensions of a computer science mode or fucking clean aloofness. It either is oriented towards tasks programers need to do, as in module documentations, or document the language as it manifestly functions. (e.g. input, output, side effects; concrete description of object's methods and variables.) The Python docs (docs.python.org), is organized in some incomprehensible computer sciency structure that is impossible to find anything. And the entire doc go to the extra mile to avoid any task-oriented writing or examples as if those are pests that can lower their fucking status. And when the Python docs tries to document its functions, it doesn't talk straight but instead throwing fucking bunch of abstract objects and models jargons. -- The Perl documentations, at least in its presentation (organization, focus) and technology (DHTML...) aspects, has come of age. However, the Perl doc's content and writing per se, remains the worst garbage possible. (and Python's is in the same ball park) The negative aspects people want to avoid are: • do not tech geek. Both perlers and pythoners do tech geeking. That is, mentioning of extraneous jargons, warnings, implementation details, little style guide here and there, unconscious opportunistic OpenSource propaganda pitch-ins, historic information provisions, insider jokes, author masturbation on language design and comparisons... etc. (with Perl, this may be understandable or irrelevant because it is their nature and design to be juvenile. They revel in it. But with Python, of its people's computer sciency aloofness and cleanness pretensions meanwhile don't really exhibit any ability to think and write better, are one fucking assholes.) • Do think clearly before writing. Both Perl and Python docs's writing quality are extremely bad. What they primarily lack is the ability to think clearly before writing. Perl docs write in the fashion of happy-go-lucky juvenile ramble, and Pythoner's in the fashion of computer sciency confoundedness. Both are incomprehensible. One easy way to test this, is for Pythoners to read Perl docs and vice versa. Pythoners will find that, you really don't know what the fuck the Perlers are talking about. Same with Perler with Python docs. However, you will not get the same feeling on well written docs, such as Java or Mathematica. (assume that the people here have been in the programing industry for several years, and are not familiar with the other languages in question.) What the Perlers & Pythoners need to do, is to horn their skills outside of coding. Study philosophy, study economics, history, social sciences, and mathematics. Also, study functional programing or hang out in functional programing communities or hardcore GNU community many also improve vastly your critical thinking and doc writing abilities. More about documentation can be found here: http://www.xahlee.org/UnixResource_dir/writ/gubni_papri.html Xah [EMAIL PROTECTED] ∑ http://xahlee.org/ -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
Martijn Iseger wrote: > Hello Steve, > > >>1. Any organisation that can talk about "a leap in productivity of >>400% from Assembler to BASIC" as though nothing occurred in between >>suffers such a total disconnect from computing history that it's hard >>to take other utterances seriously. > > > I believe the point being made by the organization is that during computing > history the most successful shifts in productivity were achieved by similar > shifts in raising the abstraction level on which developers specify > solutions. > According to Capers Jones Software Productivity research Fortran is 4.5 times > more productive than Assembler. Looking at chronology I'd say it is not > incorrect > to refer to the advent of compilers as a leap. > Neither would I. I was simply pointing out that BASIC wasn't the next thing after assembly language. Even before Fortran there were a whole bunch of what were usually called "autocodes", one of the more popular ones in Britain at least being EMA (extended Mercury autocode. So it wasn't really a leap, more a sequence of steps. I could promote nuclear weapons as being a quantum leap above rock-throwing (millions of percent more kill efficiency), but I'd be falsifying the picture by omitting depressing centuries of weapons development in doing so. Most BASICs weren't compiled languages anyway: BASIC's primary feature was the introduction of interactive execution modes and immediate edit/run cycling. The addition of compilation to machine code is a relatively recent phenomenon for (only some) BASICs, unlike other high-level languages. regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
RE: How to copy a file from one machine to another machine
[Steve Holden] | Nico Grubert wrote: | > Hi there, | > | > I would like to copy a file from one machine (machine #01) | to another (machine #02). | > | > machine #01: Suse Linux 9.2, Samba 3, Python 2.3.5 | > machine #02: Windows Machine, Destination Dir: \temp\files\ | One possibility would be to run Samba (www.smaba.org) on the Linux | machine so it offered a share to the Windows machine. Then you could | just write to a UNC path (\\server\path\to\file) from Windows | and have the file appear on the Linux machine. Quite true. The only things are that: he's already running Samba on the Linux box (see machine #01 above); and he wants to copy *onto* the Windows box (machine #02 above). That said, I entirely agree that it's more of an O/S thing than a language thing and there are no few possible solutions. (Of course, you could implement a Python-only solution using, say, Pyro or some home-grown SocketServer, but there would be an element of wheel-reinvention involved). TJG This e-mail has been scanned for all viruses by Star. The service is powered by MessageLabs. For more information on a proactive anti-virus service working around the clock, around the globe, visit: http://www.star.net.uk -- http://mail.python.org/mailman/listinfo/python-list
epydoc, variables and encoding
I found a "problem" on epydoc. If I specify an encoding, epydoc not find my global variables, and if I remove it, it work well. code.py: #!/usr/bin/env python # -*- coding: utf-8 -*- MY_VAR = None class foo(object): def __init__(self, foo): """ Some text @param foo: Pass me what you want @type foo: A type @return: The object """ return foo This not work (MY_VAR is silently skipped), but if I remove: # -*- coding: utf-8 -*- it see MY_VAR and put it to my html file. Is it normal? Thanks, Michele -- http://mail.python.org/mailman/listinfo/python-list
Re: How to copy a file from one machine to another machine
Hi I think scp is also a solution. I am sure there exist free sshserveres for windows. THat would make the stuff a bit more secure, and the login can be automated via public-key. Regards Markus -- http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
• Do think clearly before writing. You should start thinking before you write something. Do you really think anyone takes you serious the way you talk?I haven't seen anything constructive yet from your side. You always have to comment, why don't you start writing documentation yourself if it bothers you so much. Write it the way you think it should be written and show the rest of the community you are capable of doing anything else but fucking qwasting others peoples time. Rudy -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
Martijn Iseger wrote: > Before slashing down in ignorance - educate yourself on > www.dsmforum.org. After that: feel free to comment. I will make you look > a lot more intelligent Peter Hansen. Talk about throwing stones in glass houses! -- http://mail.python.org/mailman/listinfo/python-list
Writing a parser the right way?
I'm writing a parser for english language. This is a simple function to identify, what kind of sentence we have. Do you think, this class wrapping is right to represent the result of the function? Further parsing then checks isinstance(text, Declarative). --- class Sentence(str): pass class Declarative(Sentence): pass class Question(Sentence): pass class Command(Sentence): pass def identify_sentence(text): text = text.strip() if text[-1] == '.': return Declarative(text) elif text[-1] == '!': return Command(text) elif text[-1] == '?': return Question(text) return text --- At first i just returned the class, then i decided to derive Sentence from str, so i can insert the text as well. -- http://mail.python.org/mailman/listinfo/python-list
Re: scipy for python 2.4 on windows
Z.L. wrote: > I am a newbie to python, and have not so much experiences on package > installation and related issues. I am looking for Scipy binaries for > python 2.4 on windows. Please see the recent thread "use SciPy with Python 2.4.1?" for discussion of this. -- http://mail.python.org/mailman/listinfo/python-list
Re: slicing functionality for strings / Python suitabilityforbioinformatics
Tom Anderson wrote: > There's a special hell for people who override builtins. which is, most likely, chock full of highly experienced python programmers. -- http://mail.python.org/mailman/listinfo/python-list
Re: Windows paths, Java, and command-line arguments, oh my!
Neil Benn wrote: >Steve M wrote: > > > >>Well, apparently I fried my brain trying to sort this out. There is a >>typo in my example code in the post but not in my real program. (I know >>it is a no-no when asking help on c.l.py but I simplified some details >> >> >>from the real code in order not to confuse the issues. Probably > > >>backfired by this point.) Below is the post with the error fixed and >>one sentence added (to clarify why the error in my original post really >>was not the problem). Thanks for any advice. >>--- >>I'm trying to invoke a Java command-line program from my Python program >>on Windows XP. I cannot get the paths in one of the arguments to work >>right. >> >>The instructions for the program describe the following for the >>command-line arguments: >> >>java -jar sforcedataloader.jar -Dsalesforce.config.dir=CONFIG_DIRECTORY >> >>They also give an example: >> >>java -Dsalesforce.config.dir=c:\config -jar sforcedataloader.jar >> >>If I type the example above at the cmd.exe command line the thing works >>(assuming I have the config file in c:\config). What doesn't work is >>these two lines: >> >>cmd = r'java -jar sforcedataloader.jar >>-Dsalesforce.config.dir=c:\config' >>os.system(cmd) >> >> >> >> >> >> >Unless you have fixed your typo in a different place, you have the same >problem as before. There are two issues, you need to escape the >backslash and you have the java properties line in the wrong place. >Instead of: > >cmd = r'java -jar sforcedataloader.jar -Dsalesforce.config.dir=c:\config' >os.system(cmd) > >use > >cmd = r'java -Dsalesforce.config.dir=c:\\config -jar sforcedataloader.jar' >os.system(cmd) > >Neil > > > Whoops you are using a raw string - you only need one backslash - the java thing is still the same though Cheers, Neil -- http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
Rudy Schockaert wrote: > > > > • Do think clearly before writing. > > > > You should start thinking before you write something. Do you really > think anyone takes you serious the way you talk? > I haven't seen anything constructive yet from your side. You always have > to comment, why don't you start writing documentation yourself if it > bothers you so much. Write it the way you think it should be written and > show the rest of the community you are capable of doing anything else > but fucking qwasting others peoples time. 1. Do not feed the trolls. 2. I offered $100 for a rewrite of the "re" documentation if he could persuade 5 regular readers of c.l.py to tell me his version was superior. Emails received: 0. 'Nuff said :-) regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Roel Schroeven wrote: > Fredrik Lundh schreef: >>meanwhile, over in python-dev land: >> >>"Is anyone truly attached to nested tuple function parameters; 'def >>fxn((a,b)): print a,b'? /.../ >> >>Would anyone really throw a huge fit if they went away? I am willing >>to write a PEP for their removal in 2.6 with a deprecation in 2.5 if >>people are up for it." > > I for one would not like to see that disappear. I like being able to > write, for example: > > def drawline((x1, y1), (x2, y2)): > # draw a line from x1, y1 to x2, y2 > foo(x1, y1) > bar(x2, y2) > > instead of > > def drawline(p1, p2): > x1, y1 = p1 > x2, y2 = p2 > # draw a line from x1, y1 to x2, y2 > foo(x1, y1) > bar(x2, y2) > > or > > def drawline(p1, p2): > # draw a line from p1[0], p1[1] to p2[0], p2[1] > foo(p1[0], p1[1]) > bar(p2[0], p2[1]) def drawline(p1, p2): # draw a line from p1 to p2 foo(*p1) bar(*p2) -- Serhiy Storchaka -- http://mail.python.org/mailman/listinfo/python-list
Re: How to copy a file from one machine to another machine
> This isn't really a Python question, as this problem would exist > irrespective of the language you are using. > > One possibility would be to run Samba (www.smaba.org) on the Linux > machine so it offered a share to the Windows machine. Then you could > just write to a UNC path (\\server\path\to\file) from Windows and have > the file appear on the Linux machine. > > Another way would be to use CIFS client on Linux to access the share > from the Windows machine. > > There are many other file sharing solutions, and you can of course also > consider using FTP to send the file to the Linux server. Hello Steve, Samba is already installed and configured on the Linux machine. Can I just use file=open(,'w') in Python to mount the windows share and create the file? By the way, your book "Python Web Programming" is one of the best python books I have read! Really good work! Nico -- http://mail.python.org/mailman/listinfo/python-list
Re: scipy for python 2.4 on windows
Thank you. But that thread cannot provide the information on Scipy binaries for python 2.4 on Windows. And the python interpreter installed on my machine is downloaded from www.python.org, not the cygwin version. In fact, all I need is just weave part of Scipy, not all bundle of whole Scipy. Could you give me some suggestions to get weave installed on python 2.4? [EMAIL PROTECTED] wrote: > Z.L. wrote: > > I am a newbie to python, and have not so much experiences on package > > installation and related issues. I am looking for Scipy binaries for > > python 2.4 on windows. > > Please see the recent thread "use SciPy with Python 2.4.1?" for > discussion of this. -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Serhiy Storchaka a écrit : > Roel Schroeven wrote: > >> Fredrik Lundh schreef: >> >>> meanwhile, over in python-dev land: >>> >>>"Is anyone truly attached to nested tuple function parameters; 'def >>>fxn((a,b)): print a,b'? /.../ >>> >>>Would anyone really throw a huge fit if they went away? I am willing >>>to write a PEP for their removal in 2.6 with a deprecation in 2.5 if >>>people are up for it." >> >> >> I for one would not like to see that disappear. I like being able to >> write, for example: >> >> def drawline((x1, y1), (x2, y2)): >> # draw a line from x1, y1 to x2, y2 >> foo(x1, y1) >> bar(x2, y2) >> >> instead of >> >> def drawline(p1, p2): >> x1, y1 = p1 >> x2, y2 = p2 >> # draw a line from x1, y1 to x2, y2 >> foo(x1, y1) >> bar(x2, y2) >> >> or >> >> def drawline(p1, p2): >> # draw a line from p1[0], p1[1] to p2[0], p2[1] >> foo(p1[0], p1[1]) >> bar(p2[0], p2[1]) > > > def drawline(p1, p2): > # draw a line from p1 to p2 > foo(*p1) > bar(*p2) > That one is stupid. I don't see how you can make it work without some global storing the p1 information in foo which I would consider as very ugly code. -- http://mail.python.org/mailman/listinfo/python-list
Re: Writing a parser the right way?
beza1e1 wrote: > I'm writing a parser for english language. This is a simple function to > identify, what kind of sentence we have. Do you think, this class > wrapping is right to represent the result of the function? Further > parsing then checks isinstance(text, Declarative). > > --- > class Sentence(str): pass > class Declarative(Sentence): pass > class Question(Sentence): pass > class Command(Sentence): pass As far as the parser is concerned, making these separate classes is unnecessary when you could just store the sentence type as a normal data member of Sentence. So the answer to your question is no, in my opinion. However, when you come to actually use the resulting Sentence objects, perhaps the behaviour is different? If you're looking to use a standard interface to Sentences but are going to be doing substantially different processing depending on which sentence type you have, then yes, this class hierarchy may be useful to you. -- Ben Sizer -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Christophe wrote: > > def drawline(p1, p2): > > # draw a line from p1 to p2 > > foo(*p1) > > bar(*p2) > > > > That one is stupid. I don't see how you can make it work without some > global storing the p1 information in foo which I would consider as very > ugly code. if you cannot see how that can work, you clearly haven't done much graphics programming in your days... -- http://mail.python.org/mailman/listinfo/python-list
Re: Crypto.Cipher.ARC4, bust or me doing something wrong?
Paul Rubin wrote: > Michael Sparks <[EMAIL PROTECTED]> writes: >> I'm looking at using this library and to familiarise myself writing >> small tests with each of the ciphers. When I hit Crypto.Cipher.ARC4 >> I've found that I can't get it to decode what it encodes. This might >> be a case of PEBKAC, but I'm trying the following: > > You have to reinitialize the cipher state for decryption, as someone > else explained. You also have to make sure that keys are unique and > independent for separate messages. Hmm... Thanks for this. > For most applications you probably > want to think about adding authentication. Indeed - though I'm working bottom up. How a key gets transfered from a to b safely will be another step. Another one will be how to trust that exchange, for how long, and how much, etc. I'm well aware that this is a well trod area though, hence why I'm working bottom up. > In general you shouldn't > use arc4 unless you know what you're doing. Having looked at how it works from a user perspective, it's fairly inappropriate anyway, due to wanting to work over unreliable channels anyway. > What's the application? Components for secure communications and identity confirmation. Use cases: * Signing content multicast by the BBC to indicate that it came from the BBC. (ohh, so many issues :-) * Signing content captured on a mobile device such that we know that it came from that mobile. Specific high level use case of that is to be able to accept contributions from people from arbitrary devices and know who they came from. Perhaps embedded in the essence. * Related to that would be the ability to tag content with rights [1] information, and to know it's not been tampered with. [1] eg Who created it. When? Has it been published/broadcast or not? When? Have additional rights over and above fair use/dealing been granted (eg creative commons attribution license). * Similarly people want the ability to protect data in transit between trusted end points. Some people using the system would probably be looking to build restrictions management as well, but that's largely beyond the scope of our system. Indeed restrictions management would require breaking our system. For these use cases to work, encryption & digest tools are clearly an option, and hence having components that support encryption and digest are (to say the least) useful. They're obviously not the only techniques though. Rather than re-inventing wheels I thought I'd pick a library sit down and see how pycrypt's meant to be used before actually going anyway. (Amongst other reasons, this is why I suspected me, rather than the library :-) Given the pycrypt library docs page starts off with: "This documentation assumes you have some basic knowledge about the Python language, but not necessarily about cryptography." I do for example know enough about cryptography to know that me devising my own approach is foolhardy. Thus the statement above appealed :) As a result I decided to sit down and learn how to use this to form some basic components for encryption/decryption. Given another part early in the docs was """A central goal of the author's has been to provide a simple, consistent interface for similar classes of algorithms.""" I decided to start off with "sketches" implementing minimal examples for each digest and cipher. I'm now working through the Public Key examples. FWIW, I'm well aware how easy it is to get cipher/digest/etc based security/id systems wrong. I'm really starting with pycrypt because it looked simple enough, low level enough and self contained enough to act as a base for working with existing more complex systems. I supsect we'll end up looking at or wrapping some other library instead/as well, but it struck me as a nice starting point. Anyway, once I've gone through all of the existing digests/ciphers/PK ciphers, I'll post the snippets up on our site as raw examples for pycrypto, which will hopefully be a) correct usage b) be useful to others. Thanks for the comments, Michael. -- [EMAIL PROTECTED], http://kamaelia.sourceforge.net/ British Broadcasting Corporation, Research and Development Kingswood Warren, Surrey KT20 6NP This message (and any attachments) may contain personal views which are not the views of the BBC unless specifically stated. -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Christophe wrote: > Serhiy Storchaka a écrit : > >>Roel Schroeven wrote: [...] >>>or >>> >>>def drawline(p1, p2): >>># draw a line from p1[0], p1[1] to p2[0], p2[1] >>>foo(p1[0], p1[1]) >>>bar(p2[0], p2[1]) >> >> >> def drawline(p1, p2): >> # draw a line from p1 to p2 >> foo(*p1) >> bar(*p2) >> > > > That one is stupid. I don't see how you can make it work without some > global storing the p1 information in foo which I would consider as very > ugly code. In which case perhaps you should actually try the code. Then once you realise it works you can start to figure out why :-). Hint: f(*p1) appears as len(p1) separate arguments to the called function. regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
Re: Using Python with COM to communicate with proprietary Windows software
Joakim Persson wrote:
> On Tue, 13 Sep 2005 10:15:18 +0200, Thomas Heller <[EMAIL PROTECTED]>
> wrote:
>
>
>>>This _shouldn't_ be too difficult -- I know which methods must be
>>>implemented (basically just some kind of event handling to deal with
>>>randomly arriving log points, should be implemented as "onMsg()" on my
>>>COM server side, and some other similar methods), but I don't really
>>>know how. I have tried doing simple COM servers using win32com, but is
>>>it equally possible to implement such a simple thing in comtypes? I
>>>didn't find any server side examples in comtypes, but perhaps there is
>>>a way?
>>
>>There is not yet any server support in comtypes, but it will be added.
>>In the meantime you could use the ctypes.com package that is included in
>>ctypes itself, there are even samples.
>>
>>Thomas
>
>
> Thank you, I will try that. Right now I've been trying to use win32com
> for the server creation, but I haven't been successful yet (have not
> explored it that much yet though).
>
> I have registered a COM server (it should only implement two methods,
> "onMsg()" and "onNotify()", which should print whatever is sent to
> them directly to stdout), but I need to create an interface which is
> not an IDispatch interface and pass it on to the proprietary COM
> server. This connection is needed so that the proprietary COM server
> knows where to send the log and control data.
>
> Registering the COM object in the registry works fine, but how do I
> make it look like a custom interface from the proprietary COM servers
> point of view? Oh well, I will look at it some more tomorrow and
> hopefully come up with a solution...
>
Hi Joakim,
This server I wrote for the Palm Desktop with win32com, it creates a none
IDispatch COMserver.
Maybe it can be of help. I am interested in what you find out on this.
Regards,
Paul Casteels
import pythoncom
import pywintypes
import winerror
import types,time,string
import win32com
import win32ui,win32con
import rfc822
import XmlWriter
from win32com.server.exception import COMException
from win32com.server.util import wrap
from win32com.client import gencache,Dispatch,constants
from win32com import universal
# The following 3 lines may need tweaking for the particular server
# Candidates are pythoncom.Missing and pythoncom.Empty
defaultNamedOptArg=pythoncom.Missing
defaultNamedNotOptArg=pythoncom.Missing
defaultUnnamedArg=pythoncom.Missing
palmApp = 0
outfileName = r'c:\Documents And Settings\paul\My Documents\Python\PDA\cal2.xml'
universal.RegisterInterfaces('{C9B354D8-4A1C-11D5-81D2-00C04FA03755}', 0, 1, 0,
["IDesktopAddin"])
universal.RegisterInterfaces('{C9B354D8-4A1C-11D5-81D2-00C04FA03755}', 0, 1, 0,
["IDesktopCommand"])
def d2s(inDate):
return rfc822.mktime_tz(rfc822.parsedate_tz(inDate))
def s2d(inDate):
return time.asctime(time.localtime(inDate))
class DesktopCommand:
global palmApp
_public_methods_ = ['OnCommand']
_com_interfaces_ = ['IDesktopCommand']
def OnCommand(self):
print "Hello, command"
print palmApp
win32ui.MessageBox("PC-Hello","PC-Title",win32con.MB_OK )
class DesktopAddin:
_public_methods_ = ['GetFrameworkVersion',
'OnInitialize',
'OnUninitialize',
'ShowAboutBox',
'ShowProperties']
_reg_progid_ = "PythonPalm.DesktopAddin"
_reg_clsid_ = "{6F36C1D4-571C-484E-B47B-61297761B3D1}"
_com_interfaces_ = ['IDesktopAddin']
def GetFrameworkVersion(self, plVersion=defaultNamedNotOptArg):
"""method GetFrameworkVersion"""
return 2
def OnInitialize(self, pUnk=defaultNamedNotOptArg,
dwCookie=defaultNamedNotOptArg, \
dwDesktopVersion=defaultNamedNotOptArg,
lParam=defaultNamedNotOptArg, \
pbSuccess=defaultNamedNotOptArg):
"""method OnInitialize"""
global palmApp
self.cookie = dwCookie
palmApp = Dispatch(pUnk)
# add a command
self.cmd = wrap(DesktopCommand())
addinMgr = palmApp.AddinManager
cmdId = 0
cmdId = addinMgr.AddAddinCommand(self.cookie, "AddressCommand", \
self.cmd, cmdId)
cmdDesc = "&Address Command"
#& vbTab & _
# "Displays a list of 10 contacts." & vbTab & _
# "Displays 10 contacts"
addinMgr.AddAddinCommandDetails(cmdId, 0, 0, cmdDesc,
constants.ePimAddressBook)
# no data here yet available
return 1
def OnUninitialize(self):
"""method OnUninitialize"""
global palmApp
of = XmlWriter.XmlFile(outfileName,palmApp.CurrentUser.Name)
dbPim = palmApp.DateBookPim
startDate = '1 Jan 2000 0:0:0'
endDate = '1 Jan 2010 0:0:0'
events = dbPim.Events(d2s(startDate),d2s(endDate))
for j in range(events.Count):
st
Re: Perl's documentation come of age
please feed the trolls. On 9/21/05, Steve Holden <[EMAIL PROTECTED]> wrote: Rudy Schockaert wrote:>> >> • Do think clearly before writing. >> >> You should start thinking before you write something. Do you really> think anyone takes you serious the way you talk?> I haven't seen anything constructive yet from your side. You always have > to comment, why don't you start writing documentation yourself if it> bothers you so much. Write it the way you think it should be written and> show the rest of the community you are capable of doing anything else > but fucking qwasting others peoples time.1. Do not feed the trolls.2. I offered $100 for a rewrite of the "re" documentation if he couldpersuade 5 regular readers of c.l.py to tell me his version wassuperior. Emails received: 0. 'Nuff said :-)regardsSteve--Steve Holden +44 150 684 7255 +1 800 494 3119Holden Web LLC www.holdenweb.comPyCon TX 2006 www.pycon.org--http://mail.python.org/mailman/listinfo/python-list -- edward hotchkiss -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Fredrik Lundh a écrit : > Christophe wrote: > > >>> def drawline(p1, p2): >>> # draw a line from p1 to p2 >>> foo(*p1) >>> bar(*p2) >>> >> >>That one is stupid. I don't see how you can make it work without some >>global storing the p1 information in foo which I would consider as very >>ugly code. > > > if you cannot see how that can work, you clearly haven't done much graphics > programming in your days... You should probably notice that graphics library have changed a lot in the last 20 years. Also, that one was an example but it could have been : def draw_circle(c, p): """Draws a circle centered on c and which goes through p""" pass -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Steve Holden a écrit : > Christophe wrote: > >> Serhiy Storchaka a écrit : >> >>> Roel Schroeven wrote: > > [...] > or def drawline(p1, p2): # draw a line from p1[0], p1[1] to p2[0], p2[1] foo(p1[0], p1[1]) bar(p2[0], p2[1]) >>> >>> >>> >>> def drawline(p1, p2): >>> # draw a line from p1 to p2 >>> foo(*p1) >>> bar(*p2) >>> >> >> >> That one is stupid. I don't see how you can make it work without some >> global storing the p1 information in foo which I would consider as >> very ugly code. > > > In which case perhaps you should actually try the code. Then once you > realise it works you can start to figure out why :-). Hint: f(*p1) > appears as len(p1) separate arguments to the called function. You should also notice that foo knows the starting point of the line but not the ending point and so it can't draw the line. On the other hand, bar knows the end point but not the starting point so it can't do the job either. And what about a function which computes the line length ? -- http://mail.python.org/mailman/listinfo/python-list
Re: testing a website from python
matt wrote: > Here's something I did recently at work. > It contains unittest code and is using > urllib2. > http://blog.spikesource.com/pyhton_testcases.htm If you want to test web sites, you might be interested in zope.testbrowser (currently Zope 3 only, but fixing that is on my to do list). You can see an example testbrowser test (which is also both its README and its unit tests) at http://svn.zope.org/*checkout*/Zope3/branches/testbrowser-integration/src/zope/testbrowser/README.txt?rev=38050 If there is any interest I'll try to package up a stand-alone version in the next few days. -- Benji York -- http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
On Wednesday 21 September 2005 05:41, Xah Lee wrote: > One easy way to test this, is for Pythoners to read Perl docs and > vice versa. > > Pythoners will find that, you really don't know what the fuck the > Perlers are talking about. Same with Perler with Python docs. At the risk of feeding the troll here... point defeated. I learned Python before I learned Perl, but consider myself to now be fluent in both. And I find the docs for both to be immensely useful and fairly well-organized (OK, so sometimes I have to hunt a bit longer than I'd like in the Perl docs, but perldoc.perl.org looks promising). And in my early stages of Python from C++, and Perl from Python, shell, and C, I really didn't have any trouble figuring out what was going on. So, Guido, Fred Drake, and everyone else involved in writing Python docs: done well you have. Keep up the good work. Python IMHO has some of the best docs in the open-source world (on a par with Vim). - Michael -- http://mail.python.org/mailman/listinfo/python-list
Python win32com com_error: (-2147418113
I'm trying to use a proprietary windows software with COM and win32com.
The result is everytime the error message
com_error: (-2147418113, 'Catastrophic failure', None, None)
I've read this in some e-mails, but can't find the solution and I have
not enough experience with Windows and COM.
Can anybody help ?
This ist the test script.
#--
import sys
from win32com.client import gencache
import win32com.client
if __name__=='__main__':
flag = None
gencache.EnsureModule('{A5FE85B0-D562-11D3-A8E8-00609727A3F3}', 0, 1, 0)
o =
win32com.client.Dispatch('VISIONP400DATACONTROL.VisionP400DataControlCtrl.1')
"""
Debug output:
o ==>
o.connectToVisionP400 ==>
"""
try:
flag = o.connectToVisionP400()
"""
Error by function call ==>
>>> Unhandled exception while debugging...
Traceback (most recent call last):
File "S:\Python\DCOM\test.py", line , in ?
flag = o.connectToVisionP400()
File
"C:\Programme\Python\Python2.4\lib\site-packages\win32com\gen_py\A5FE85B0-D562-11D3-A8E8-00609727A3F3x0x1x0.py",
line 60, in connectToVisionP400
return self._oleobj_.InvokeTypes(12, LCID, 1, (11, 0), (),)
com_error: (-2147418113, 'Catastrophic failure', None, None)
"""
except:
flag = "*** - The connection not possible !"
print flag
Regards
gerd
--
http://mail.python.org/mailman/listinfo/python-list
Re: sorting tuples...
Thank you very much. I'll look into this immediately. I edited my code earlier and came up with stringing the groups (200501202010, sender, message_string) into one string delimited by '%%%'. I could then sort the messages with the date string at the beginning as the one being sorted with the big string in its "tail" being sorted too. 200501202010%%%sender%%%message_string 200502160821%%%sender%%%message_string ... After sorting this list of long strings, I could then split them up using the '%%%' delimiter and arrange them properly for output. It's crude but at least I achieve what I wanted done. But both posters gave good advices, if not a bit too advanced for me. I'll play with them and keep tweaking my code. Thanks so much! -- /nh -- http://mail.python.org/mailman/listinfo/python-list
Re: What am I doing wrong?
You have been bitten by a well known "feature". You used
a mutable as default value in your argument list for __init__.
See:
http://www.nexedi.org/sections/education/python/tips_and_tricks/python_and_mutable_n/view
It would be better to write:
class structure:
def __init__(self, folders = None):
self.folders=folders or []
-Larry Bates
keithlackey wrote:
> I'm relatively new to python and I've run into this problem.
>
>
> DECLARING CLASS
>
> class structure:
> def __init__(self, folders = []):
> self.folders = folders
>
> def add_folder(self, folder):
> self.folders.append(tuple(folder))
>
>
>
> Now I try to make an instance of this class
>
> structure1 = structure()
> structure1.add_folder([('foo'),])
> print structure1.folders
>
> This returns: [('foo',)]
>
> This works fine. But when I try to make another instance of that class...
>
> structure2 = structure()
> print structure2.folders
>
> This now also returns: [('foo',)]
> Even though I haven't added any folders to this new instance
>
> What am I doing wrong?
>
--
http://mail.python.org/mailman/listinfo/python-list
ANN: Leo 4.3.3 released
Leo 4.3.3 final is now available at: http://sourceforge.net/project/showfiles.php?group_id=3458&package_id=29106 Leo 4.3.3 fixes several bugs reported in Leo 4.3.2 final. To learn about Leo, see: http://webpages.charter.net/edreamleo/intro.html The highlights of 4.3.3 (and 4.3.2) --- - Improved Leo's documentation: - A tutorial introduction to Leo: http://webpages.charter.net/edreamleo/intro.html - A 5-minute guide to programming with Leo: http://webpages.charter.net/edreamleo/intro.html#quick-start-for-programmers - The new rst3 plugin creates .html and .tex files from reStructuredText embedded in Leo files. Any node of the source outline may contain options for the rst3 plugin, which makes this plugin much more useful and flexible than the previous rst plugins. All of Leo's documentation was created using this plugin from sources in LeoDocs.leo. For full documentation for rst3 see: http://webpages.charter.net/edreamleo/rstplugin3.html. - The spellpyx (spell checking) plugin is now much easier to use. - The vim and openWith plugins now use Python's subprocess module if it is present. - Improved the Pretty Printing command. - The usual assortment of bug fixes. Edward Edward K. Ream email: [EMAIL PROTECTED] Leo: http://webpages.charter.net/edreamleo/front.html -- http://mail.python.org/mailman/listinfo/python-list
Re: /usr/lib/python2.3/site-packages/_mysql.so: undefined symbol: mysql_rollback
thomas> There is no libmysql, but I've got no idea where it is: Sorry, libmysqlclient.so is the right beastie. So, look in libmysqlclient.so for a mysql_rollback function (using the nm command). Is it possible you have a _mysql.so file that was built with MySQL 4.x include files but is now linking against MySQL 3.x shared objects? That's just a guess, but MySQL became more transaction-aware in the 3.x->4.x transition. I would guess mysql_rollback is available in 4.x but not 3.x. Actually, a better place to ask would be on the help forum for the mysql-python project at Sourceforge: http://sourceforge.net/projects/mysql-python Andy Dustman, the author, is generally quite quick to respond. Skip -- http://mail.python.org/mailman/listinfo/python-list
Re: Free seminar on domain-specific modeling
Martijn Iseger wrote: ... > I believe the point being made by the organization is that during > computing history the most successful shifts in productivity were > achieved by similar shifts in raising the abstraction level on which > developers specify solutions. The alternate point is that during computing history, many, many, many promises were made for many, many, many, technologies based on the same principle of raising the abstraction level. Many, many, many of those technologies promised much and failed to deliver on their claims when used beyond the people inventing/using those technologies. Furthermore, virtually all of them get marketed as being the next big thing that Will Change The World. As a result anyone marketing an idea in this way meets skepticism. From my perspective your site talks a lot about general ideas but has little on specifics. One thing is relatively clear - your approach appears to include a graphical approach to systems building. Personally I suspect that the fact people are able to engage other parts of their brain when building these systems beyond linguistic is the real reason you see benefits, rather than actually the specific thing that led to the visual approach being possible. Maybe your approach will change the world. Maybe it won't. If it's better and it does, good. If it's not better and it does, that's a lot of effort for no gain. Unfortunately that latter point is a common result. (On a sad note it looks like you're reinvented how hardware is designed and made, but not made the intuitive leap :-/ ) Best Regards, Michael. -- This message (and any attachments) contains personal views which are not the views of the BBC. -- http://mail.python.org/mailman/listinfo/python-list
Syntax error in files with with 'iso-8859-15' coding header
I have a default coding header # -*- coding: iso-8859-15 -*- in my python files. I now have Problems with this settings. I swithched to Python 2.4.1 under Windows. When I import files with the above coding header I get frequent syntax errors with files that work flawlessly under Linux. The Syntax error usually appear near continuation lines of the form func(arg1, arg2, (list, list)) When I change this call to func(arg1, arg2, (list, list)) syntax error goes away as well when I change the coding cookie from: # -*- coding: iso-8859-15 -*- to: # -*- coding: iso-8859-1 -*- I have these problems only on WinNT with 2.4.1 from python org, not with my selfcompiled 2.4.1 under Linux. The .py files come from a CVS repository, so the line endings are converted on checkout. Is this a known problem or am I doing something totally wrong. Kind regards Berthold -- __ Address: G / \ L Germanischer Lloyd phone: +49-40-36149-7374 -++- Vorsetzen 35 P.O.Box 111606 fax : +49-40-36149-7320 \__/ D-20459 HamburgD-20416 Hamburg -- http://mail.python.org/mailman/listinfo/python-list
Re: Finding where to store application data portably
On Tue, 20 Sep 2005 23:03:52 +0100, Tony Houghton wrote: > I'm using pygame to write a game called Bombz which needs to save some > data in a directory associated with it. In Unix/Linux I'd probably use > "~/.bombz", in Windows something like > "C:\Documents And Settings\\Applicacation Data\Bombz". In Windows, you shouldn't hard-code the drive letter. I don't know how you find out what the correct value is, but hard-coding it is just Bad. As a Linux user, I really am sick of every damn application, script and program under the sun filling the top level of my home directory with dot-files. I wish the Linux Standard Base folks would specify that settings files should all go into a subdirectory like ~/settings rather than filling up the home directory with cruft. That was acceptable in the days when people only looked at their files with ls, but in these days of GUI file managers, it is ridiculous that there are more than 100 dot files and directories in my home directory. Can I ask developers to break with the obsolete and annoying habit of creating user-specific config files as ~/.app-name and use ~/settings/app-name instead? -- Steven. -- http://mail.python.org/mailman/listinfo/python-list
wxPython Notebook crash when pressing alt key
Hi I've got some really weird issue with a sizer, a text field and a notebook. Here's an example: import wx class A(wx.Panel): def __init__(self, parent, id): wx.Panel.__init__(self, parent) self.noteBook = wx.Notebook(self, -1) self.panel = wx.Panel(self.noteBook, -1) self.noteBook.AddPage(self.panel, "Page 1", False) self.text = wx.TextCtrl(self, -1) sizerMain = wx.BoxSizer(wx.VERTICAL) sizerMain.Add(self.text, 0) sizerMain.Add(self.noteBook, 0, wx.EXPAND) self.SetSizer(sizerMain) class TRL(wx.Frame): def __init__(self, parent, id, title="App"): wx.Frame.__init__(self, None, -1, title, size=(640,480)) self.content = A(self, -1) app = wx.App() app.frame = TRL(None, -1) app.frame.Show(True) app.MainLoop() Run this, press ALT+F or ALT+(any other key) and try closing the application (Its totally frozen) Anybody have a solution to this? Or have an idea whats hapening and what I am doing wrong? Thanks - Kreedz -- http://mail.python.org/mailman/listinfo/python-list
Re: slicing functionality for strings / Python suitability forbioinformatics
On Wed, 21 Sep 2005 11:37:38 +0100, Tom Anderson wrote: > There's a special hell for people who override builtins. [slaps head] Of course there is, and I will burn in it for ever... -- Steven. -- http://mail.python.org/mailman/listinfo/python-list
Re: Classes derived from dict and eval
Jeremy Sanders wrote:
> Hi -
>
> I'm trying to subclass a dict which is used as the globals environment of
> an eval expression. For instance:
>
> class Foo(dict):
> def __init__(self):
> self.update(globals())
> self['val'] = 42
>
> def __getitem__(self, item):
> # this doesn't get called from the eval statement
> print "*", item
> return dict.__getitem__(self, item)
>
> a = Foo()
>
> print a['val']
> print eval('val*2+6', a)
>
> The first print statements also prints "* val", but __getitem__ is never
> called by the evaluation in the eval statement.
>
> Is this a bug? Does anyone have an idea for a workaround? I'm using
> Python 2.3.3.
Try Python 2.4.1:
Python 2.4.1 (#65, Mar 30 2005, 09:13:57) [MSC v.1310 32 bit (Intel)] on win32
Type "help", "copyright", "credits" or "license" for more information.
>>> class Foo(dict):
... def __init__(self):
... self.update(globals())
... self['val'] = 42
... def __getitem__(self, item):
... # this doesn't get called from the eval statement
... print "*", item
... return dict.__getitem__(self, item)
...
>>> a = Foo()
>>>
>>> print a['val']
* val
42
>>> print eval('val*2+6', a)
* val
90
Kent
--
http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Christophe wrote: > Steve Holden a écrit : > >>Christophe wrote: >> >> >>>Serhiy Storchaka a écrit : >>> >>> Roel Schroeven wrote: >> >>[...] >> >> >or > >def drawline(p1, p2): > # draw a line from p1[0], p1[1] to p2[0], p2[1] > foo(p1[0], p1[1]) > bar(p2[0], p2[1]) def drawline(p1, p2): # draw a line from p1 to p2 foo(*p1) bar(*p2) >>> >>> >>>That one is stupid. I don't see how you can make it work without some >>>global storing the p1 information in foo which I would consider as >>>very ugly code. >> >> >>In which case perhaps you should actually try the code. Then once you >>realise it works you can start to figure out why :-). Hint: f(*p1) >>appears as len(p1) separate arguments to the called function. > > > You should also notice that foo knows the starting point of the line but > not the ending point and so it can't draw the line. On the other hand, > bar knows the end point but not the starting point so it can't do the > job either. > This is rubbish. foo(*p1) is *exactly* equivalent to foo(p1[0], p1[1]) and similarly bar(p2) is *exactly* equivalent to bar(p2[0], p2[1]) and consequently the second version of drawline is exactly equivalent to the first. So, if the second one is useless then so is the first. > And what about a function which computes the line length ? I'm not sure what point you are trying to make here. Can you explain? regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
Re: Finding where to store application data portably
Steven D'Aprano wrote: > On Tue, 20 Sep 2005 23:03:52 +0100, Tony Houghton wrote: > > >>I'm using pygame to write a game called Bombz which needs to save some >>data in a directory associated with it. In Unix/Linux I'd probably use >>"~/.bombz", in Windows something like >>"C:\Documents And Settings\\Applicacation Data\Bombz". > > > In Windows, you shouldn't hard-code the drive letter. I don't know how you > find out what the correct value is, but hard-coding it is just Bad. > > As a Linux user, I really am sick of every damn application, script and > program under the sun filling the top level of my home directory with > dot-files. > > I wish the Linux Standard Base folks would specify that settings files > should all go into a subdirectory like ~/settings rather than filling up > the home directory with cruft. That was acceptable in the days when people > only looked at their files with ls, but in these days of GUI file > managers, it is ridiculous that there are more than 100 dot files and > directories in my home directory. > > > > Can I ask developers to break with the obsolete and annoying habit of > creating user-specific config files as ~/.app-name and use > ~/settings/app-name instead? > > > > While we're asking for the improbable, perhaps we could make that ~/.settings/app-name Ssh has used the ~/.ssh directory for a long time to avoid the need for lots of little dot files, and this works quite well. Good luck in your campaign! regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
Re: wxPython Notebook crash when pressing alt key
Kreedz wrote: > Hi > > I've got some really weird issue with a sizer, a text field and a > notebook. Here's an example: > > import wx > > class A(wx.Panel): > def __init__(self, parent, id): > wx.Panel.__init__(self, parent) > self.noteBook = wx.Notebook(self, -1) > self.panel = wx.Panel(self.noteBook, -1) > self.noteBook.AddPage(self.panel, "Page 1", False) > self.text = wx.TextCtrl(self, -1) > sizerMain = wx.BoxSizer(wx.VERTICAL) > sizerMain.Add(self.text, 0) > sizerMain.Add(self.noteBook, 0, wx.EXPAND) > self.SetSizer(sizerMain) > > class TRL(wx.Frame): > def __init__(self, parent, id, title="App"): > wx.Frame.__init__(self, None, -1, title, size=(640,480)) > self.content = A(self, -1) > > app = wx.App() > app.frame = TRL(None, -1) > app.frame.Show(True) > app.MainLoop() > > Run this, press ALT+F or ALT+(any other key) and try closing the > application (Its totally frozen) Anybody have a solution to this? Or > have an idea whats hapening and what I am doing wrong? > > Thanks > > - Kreedz > This code works fine for me (once I add an "import wx" at the top). Python 2.4.1, wxPython 2..5.3.1 regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
distutils and decorators
We're trying to get CherryPy 2.1 RC 1 out the door, but setup.py is
giving us some problems. In our test suite, we want to test a decorator
that we provide. Of course, decorators won't work in Python 2.3, so I
put the actual decorated functions into a separate module, and import it
into the test suite only when running Python 2.4:
if sys.hexversion > 0x020400A2:
from cp_decorator_tests import Exposing, ExposingNewStyle
Now "setup.py install" is complaining when run under Python 2.3, since
it tries to byte-compile every .py file. Output from a second install
run:
C:\Python23\Lib\site-packages\cptrunk>python setup.py install
running install
running build
running build_py
running install_lib
byte-compiling
C:\Python23\Lib\site-packages\cherrypy\test\cp_decorator_tests.py to
cp_decorator_tests.pyc
File
"C:\Python23\Lib\site-packages\cherrypy\test\cp_decorator_tests.py",
line 4
@cherrypy.expose("1")
^
SyntaxError: invalid syntax
running install_data
1. Is there some way to tell setup to skip the byte-compiling on that
single file, or
2. Is there some way to only ship cp_decorator_tests.py if you're
running 2.4, or
3. Is there some better way to optionally test decorators, like using
eval, or
4. other...?
Robert Brewer
System Architect
Amor Ministries
[EMAIL PROTECTED]
--
http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Christophe schreef: > Steve Holden a écrit : > >> Christophe wrote: >> >>> Serhiy Storchaka a écrit : >>> Roel Schroeven wrote: >> >> >> [...] >> > or > > def drawline(p1, p2): ># draw a line from p1[0], p1[1] to p2[0], p2[1] >foo(p1[0], p1[1]) >bar(p2[0], p2[1]) def drawline(p1, p2): # draw a line from p1 to p2 foo(*p1) bar(*p2) >>> >>> >>> That one is stupid. I don't see how you can make it work without some >>> global storing the p1 information in foo which I would consider as >>> very ugly code. >> >> >> >> In which case perhaps you should actually try the code. Then once you >> realise it works you can start to figure out why :-). Hint: f(*p1) >> appears as len(p1) separate arguments to the called function. > > > You should also notice that foo knows the starting point of the line but > not the ending point and so it can't draw the line. On the other hand, > bar knows the end point but not the starting point so it can't do the > job either. It was just an example of tuples as arguments to a function and doing something with the values of the tuples in the function itself. Even so, many graphical environments offer MoveTo(x, y) and LineTo(x, y) or equivalents. MoveTo moves some internal cursor to the specified position without drawing a line; LineTo draws a line from the stored cursor position to the specified position and moves the internal cursor to that new position. > And what about a function which computes the line length ? That would have been a better example indeed, since the *p1 trick doesn't work there. def euclidian_distance((x1, y1), (x2, y2)): return math.sqrt((x2 - x1)**2 + (y2 - y1)**2) That's a lot nicer, I think, than this: def euclidian_distance(p1, p2): return math.sqrt((p2[0] - p1[0])**2 + (p2[1] - p1[1])**2) -- If I have been able to see further, it was only because I stood on the shoulders of giants. -- Isaac Newton Roel Schroeven -- http://mail.python.org/mailman/listinfo/python-list
using variable-value
Hi
In php I can assign a value to a variable and use this varaible to access a
property in some object:
$var = 'property';
$object->{$var}
This will transelate to $object->property...
Is this possible in Python?
# Prints help on methods in Canvas-instance
for method in dir(self.canvas):
print method
print help(self.canvas.method)
gives me " AttributeError: Canvas instance has no attribute 'method' "...
regards tores
--
http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Steve Holden a écrit : > Christophe wrote: > >> Steve Holden a écrit : >> >>> Christophe wrote: >>> >>> Serhiy Storchaka a écrit : > Roel Schroeven wrote: >>> >>> >>> [...] >>> >>> >> or >> >> def drawline(p1, p2): >> # draw a line from p1[0], p1[1] to p2[0], p2[1] >> foo(p1[0], p1[1]) >> bar(p2[0], p2[1]) > > > > > def drawline(p1, p2): ># draw a line from p1 to p2 >foo(*p1) >bar(*p2) > That one is stupid. I don't see how you can make it work without some global storing the p1 information in foo which I would consider as very ugly code. >>> >>> >>> >>> In which case perhaps you should actually try the code. Then once you >>> realise it works you can start to figure out why :-). Hint: f(*p1) >>> appears as len(p1) separate arguments to the called function. >> >> >> >> You should also notice that foo knows the starting point of the line >> but not the ending point and so it can't draw the line. On the other >> hand, bar knows the end point but not the starting point so it can't >> do the job either. >> > This is rubbish. > > foo(*p1) > > is *exactly* equivalent to > > foo(p1[0], p1[1]) > > and similarly > > bar(p2) > > is *exactly* equivalent to > > bar(p2[0], p2[1]) > > and consequently the second version of drawline is exactly equivalent to > the first. So, if the second one is useless then so is the first. Well, sorry about that but you are perfectly right. The point I was trying to defend though was that such construct is very uncommon. It isn't always possible to unpack the tuples like that because you usually need all the info at once. >> And what about a function which computes the line length ? > > > I'm not sure what point you are trying to make here. Can you explain? As I said, the point was that in that specific case, you can do it like that, but most of the time you need the unpack info for all the data in the same function. For example to compute the line length. def length((x1,y1),(x2,y2)): return math.hypot(x1-x2,y1-y2) No unpack trick ( that I know of ) can be used here. You only have 1 way to do it without the unpack in function parameters syntax : def length(p1, p2): x1, y1 = p1 x2, y2 = p2 return math.hypot(x1-x2,y1-y2) -- http://mail.python.org/mailman/listinfo/python-list
Re: using variable-value
Tor Erik Sønvisen wrote:
> Hi
>
> In php I can assign a value to a variable and use this varaible to access a
> property in some object:
>
> $var = 'property';
> $object->{$var}
>
> This will transelate to $object->property...
> Is this possible in Python?
Not directly, but there's a way: getattr(obj, attname, [,default])
> # Prints help on methods in Canvas-instance
> for method in dir(self.canvas):
> print method
> print help(self.canvas.method)
>
> gives me " AttributeError: Canvas instance has no attribute 'method' "...
Try this
for method in dir(self.canvas):
print method
print help(getattr(self.canvas, "method"))
HTH
--
bruno desthuilliers
python -c "print '@'.join(['.'.join([w[::-1] for w in p.split('.')]) for
p in '[EMAIL PROTECTED]'.split('@')])"
--
http://mail.python.org/mailman/listinfo/python-list
Re: distutils and decorators
Robert Brewer wrote:
> We're trying to get CherryPy 2.1 RC 1 out the door, but setup.py is
> giving us some problems.
I don't know anything about distutils, so I can't help you there, but I
never-the-less can't resist speaking up...
> In our test suite, we want to test a decorator
> that we provide. Of course, decorators won't work in Python 2.3
More accurately, the special "@" decorator syntax doesn't work in 2.3.
I would propose that you *do not* want to test the syntax (that's what
the Python test suite is for), but instead test the functionality of the
decorator. Therefore I'd switch to 2.3 compatible syntax instead.
Something like:
def foo():
pass
foo = cherrypy.expose("1")(foo)
--
Benji York
--
http://mail.python.org/mailman/listinfo/python-list
Re: Question About Logic In Python
On Wed, 21 Sep 2005 09:03:00 +1000, Steven D'Aprano <[EMAIL PROTECTED]> wrote: >On Tue, 20 Sep 2005 03:03:15 +, Ron Adam wrote: > >> Steven D'Aprano wrote: >>> Are there actually any usage cases for *needing* a Boolean value? Any >>> object can be used for truth testing, eg: > >[snip] > >> Of course if any of the default False or True conditions are >> inconsistent with the logic you use, you need to do explicit truth testing. > >[snip] > >> So.. >> >> bool(a and b) * value >> >> Would return value or zero, which is usually what I want when I do this >> type of expression. > >That's all very interesting, and valuable advice for somebody who doesn't >understand how Python's logical operators work, but the question is, when >would you actually want that type of expression? > >In practice, how often do you really care that your truth values have the >specific values 0 and 1 rather than anything false and anything true? In >what circumstances? > When you want to use the value as an index fed to something that has a __getitem__ for which only the values 0 and 1 are valid, e.g., a list or tuple of length 2, as I tried to illustrate before ;-) Also, since values 0 and 1 are the values of a bit, you can shift it and create a mask that encodes many logical values at once, which can be handy for truth table stuff or perhaps indexing a 2**nbits table rather than using a tree of nested if/elses to select values. BTW, you asked "Are there actually any usage cases for *needing* a Boolean value?" ^^^ ;-) AFAIK, "one" is enough to make the answer "yes" ;-) Of course you can use other expressions than bool(x) to get the boolean value, but you may have to think more about whether (x and 1) will do it, or whether you should write (x!=0) or, in case x can be None, perhaps settle on (x and 1 or 0) as an idiom to play safe. Well, bool(x) is safe, and less typing ;-) OTOH, it's not a hammer for all nails. Regards, Bengt Richter -- http://mail.python.org/mailman/listinfo/python-list
Re: What am I doing wrong?
keithlackey wrote: > I'm relatively new to python and I've run into this problem. This has two very standard mistakes: First, as noted by Sybren, messages should just use spaces in order to be readable. After correcting that one: >class structure: >def __init__(self, folders = []): >self.folders = folders >... Here is the second one. Default args are not rebuilt, but shared. The correct way to do this is: class structure: def __init__(self, folders=None): if folders is None: self.folders = [] else: self.folders = folders ... --Scott David Daniels [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Calling Access module functions from python
Hi,
I have an Access Data Project (.adp) that I am trying to open and
execute from Python. I am using the win32com.client, and I have
successfully opened the application, but I'm getting an exception when
I try to execute the function (actually a "Sub" that returns void, but
that shouldn't matter). Here's what I have so far:
conn=win32com.client.Dispatch('Access.Application')
conn.OpenAccessProject("C:/path/to/file/filename.adp")
conn.Visible = 1
# works so far
conn.Run("test_interface")
# Exception is thrown here.
# com_error: (-2147352567, 'Exception occurred.', (0, None, None, None,
0, -2147352562), None)
The 'test_interface' function takes no arguments, but I've tried the
same thing with another function that does take arguments and gotten
the same result.
Any help would be appreciated.
Thanks,
kayakerjess
--
http://mail.python.org/mailman/listinfo/python-list
Re: wxPython Notebook crash when pressing alt key
I have written the "import wx" in my message. You press F key while holding down Alt while focusing on the tab? Python 2.4.1, wxPython 2.6.1.0 -- http://mail.python.org/mailman/listinfo/python-list
Calling Access module functions from python
Hi,
I have an Access Data Project (.adp) that I am trying to open and
execute from Python. I am using the win32com.client, and I have
successfully opened the application, but I'm getting an exception when
I try to execute the function (actually a "Sub" that returns void, but
that shouldn't matter). Here's what I have so far:
conn=win32com.client.Dispatch('Access.Application')
conn.OpenAccessProject("C:/path/to/file/filename.adp")
conn.Visible = 1
# works so far
conn.Run("test_interface")
# Exception is thrown here.
# com_error: (-2147352567, 'Exception occurred.', (0, None, None, None,
0, -2147352562), None)
The 'test_interface' function takes no arguments, but I've tried the
same thing with another function that does take arguments and gotten
the same result.
Any help would be appreciated.
Thanks,
kayakerjess
--
http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
I'm new to Python, not programming. I agree with the point regarding the interpreter. what is that? who uses that!? Why are most examples like that, rather than executed as .py files? Another problem that I have (which does get annoying after awhile), is not using foo and bar. Spam and Eggs sucks. It's not funny, although Monty Python does rock. Why not use silly+walks instead. ***/me puts on Monty Python and turns the computer off*** -edward -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Christophe wrote: > > if you cannot see how that can work, you clearly haven't done much graphics > > programming in your days... > > You should probably notice that graphics library have changed a lot in > the last 20 years. yeah, nobody uses things like OpenGL and PDF and SVG and similar APIs these days... -- http://mail.python.org/mailman/listinfo/python-list
Re: Crypto.Cipher.ARC4, bust or me doing something wrong?
Michael Sparks <[EMAIL PROTECTED]> writes: > Rather than re-inventing wheels I thought I'd pick a library sit down > and see how pycrypt's meant to be used before actually going anyway. > (Amongst other reasons, this is why I suspected me, rather than the > library :-) Pycrypt doesn't operate at anything like the level you need. It just gives you low level cipher primitives. You need higher level protocols. > FWIW, I'm well aware how easy it is to get cipher/digest/etc based > security/id systems wrong. I'm really starting with pycrypt because it > looked simple enough, low level enough and self contained enough to > act as a base for working with existing more complex systems. Do yourself a favor and stick to something standard like TLS, rather than cook up your own protocol. There are some Python wrappers for OpenSSL or GNU TLS, for example. > Anyway, once I've gone through all of the existing digests/ciphers/PK > ciphers, I'll post the snippets up on our site as raw examples for > pycrypto, which will hopefully be a) correct usage b) be useful to > others. You really need to know a lot more than it sounds like you know, to have any chance of getting fancy protocol designs correct. http://www.cs.ucdavis.edu/~rogaway/classes/227/spring05/book/main.pdf is a textbook that will show you how to do this, or at least give you an idea of what you're dealing with. Watch out, it is rather theoretical. -- http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
Ed Hotchkiss wrote: > I'm new to Python, not programming. I agree with the point regarding the > interpreter. I couldn't (with a quick skimming) find any references to the interpreter in the thread, so I'll guess the original assertion was something like "showing new-comers the interpreter is stupid and wastes their time". > what is that? who uses that!? As a (more than) full time Python programmer, I can say that I use the interactive interpreter daily, and it contributes significantly to my prototyping of new code and reverse-engineering of existing code. I could imagine that other people might not find it that useful, but the "who uses that!?" response is hard for me to understand. -- Benji York -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Roel Schroeven wrote: > ... > Christophe schreef: >> ... >>And what about a function which computes the line length ? > > That would have been a better example indeed, since the *p1 trick > doesn't work there. > > def euclidian_distance((x1, y1), (x2, y2)): > return math.sqrt((x2 - x1)**2 + (y2 - y1)**2) > > That's a lot nicer, I think, than this: > > def euclidian_distance(p1, p2): > return math.sqrt((p2[0] - p1[0])**2 + (p2[1] - p1[1])**2) But not massively nicer than: def euclidian_distance(p1, p2): (x1, y1), (x2, y2) = p1, p2 return math.sqrt((x2 - x1)**2 + (y2 - y1)**2) --Scott David Daniels [EMAIL PROTECTED] -- http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
Ed Hotchkiss wrote: > I'm new to Python, not programming. I agree with the point regarding the > interpreter. what is that? who uses that!? I spend most of my work day at the interpreter. I don't write programs; I write libraries which I control with the interpreter. It's a fantastically useful and productive way to work. > Why are most examples like > that, rather than executed as .py files? If all of the examples were .py files, then many of them would have to have print statements sprinkled through them and a separate block to show the output. For most of the examples, I'd rather see the input and output interleaved so I know what corrseponds with what. > Another problem that I have (which does get annoying after awhile), is > not using foo and bar. Spam and Eggs sucks. It's not funny, although > Monty Python does rock. Why not use silly+walks instead. Is this really a significant problem for you? -- Robert Kern [EMAIL PROTECTED] "In the fields of hell where the grass grows high Are the graves of dreams allowed to die." -- Richard Harter -- http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
Ed Hotchkiss wrote: > I'm new to Python, not programming. I agree with the point regarding > the interpreter. what is that? who uses that!? Why are most examples > like that, rather than executed as .py files? I think showing examples at the Python interpreter prompt is *very* helpful and IMHO a preferred method in plenty of cases. If I'm showing someone a piece of code that returns some object the type of which you're not really that familiar with, would you rather be running it in a script, or on a command prompt (or, my preference is to either copy and paste the example to a script an run it with ``python -i`` or paste it to an edit in IPython)? With IPython (or vanilla Python interpreter with parse-and-bind tab completion turned on), you can inspect the object quite easily. Again, IMHO, much easier than from a script. > > Another problem that I have (which does get annoying after awhile), is > not using foo and bar. Spam and Eggs sucks. It's not funny, although > Monty Python does rock. Why not use silly+walks instead. Eh. Life's too short for me to get up in a roar about such as this. And Python's too good of a language for me to be overly bothered by example naming conventions. YMMV. > > ***/me puts on Monty Python and turns the computer off*** > > -edward -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Christophe wrote: > Steve Holden a écrit : >>and consequently the second version of drawline is exactly equivalent to >>the first. So, if the second one is useless then so is the first. > > Well, sorry about that but you are perfectly right. The point I was > trying to defend though was that such construct is very uncommon. It > isn't always possible to unpack the tuples like that because you usually > need all the info at once. Many, many drawing APIs use a Postscript-like model such that drawing a line from p1 to p2 decomposes into something like this: moveto(p1) lineto(p2) Almost always those are methods on some object that maintains the state (no globals in sight): gc.moveto(p1) gc.lineto(p2) I think it's much more common than you realize. You are right that there are plenty of functions that you might want to call that would require something like this: low_level_drawline(x1, y1, x2, y2) that isn't amenable to *argument unpacking. -- Robert Kern [EMAIL PROTECTED] "In the fields of hell where the grass grows high Are the graves of dreams allowed to die." -- Richard Harter -- http://mail.python.org/mailman/listinfo/python-list
Re: vendor-packages directory
Terry Reedy wrote: > "Rich Burridge" <[EMAIL PROTECTED]> wrote in message >>Until now we've been using "/usr/lib/python2.4/site-packages" as the >>directory to install the various Python files that these packages use. > > > My impression is that this is exactly the intended place for general-use > support packages. > > +1 Colin W. -- http://mail.python.org/mailman/listinfo/python-list
Re: Organising a python project
Thanks for the info, guys. Noel -- http://mail.python.org/mailman/listinfo/python-list
Re: Organising a python project
Thanks for the info, guys. Noel -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
Dennis Lee Bieber a écrit : > On Wed, 21 Sep 2005 17:08:14 +0200, Christophe <[EMAIL PROTECTED]> > declaimed the following in comp.lang.python: > > > >>No unpack trick ( that I know of ) can be used here. You only have 1 way >>to do it without the unpack in function parameters syntax : >> >>def length(p1, p2): >> x1, y1 = p1 >> x2, y2 = p2 >> return math.hypot(x1-x2,y1-y2) > > import math def length(p1, p2): > > ... return math.hypot(p1[0] - p2[0], p1[1] - p2[1]) > ... > length((1,2),(4,6)) > > 5.0 > > > Still no need for intermediate variables, you can index the tuple at > need. Well, I prefer the explicit tuple unpack anyway. It gives better results than using tuple indexing ( and better performance too most of the time ) -- http://mail.python.org/mailman/listinfo/python-list
Re: Finding where to store application data portably
Steven D'Aprano wrote: > As a Linux user, I really am sick of every damn application, script and > program under the sun filling the top level of my home directory with > dot-files. > > I wish the Linux Standard Base folks would specify that settings files > should all go into a subdirectory like ~/settings rather than filling up > the home directory with cruft. That was acceptable in the days when people > only looked at their files with ls, but in these days of GUI file > managers, it is ridiculous that there are more than 100 dot files and > directories in my home directory. What difference does it make whether one is using a GUI or a command line? Anyway, the vast majority of Unix users I know still use ls a lot more often than GUI-based file managers. I prefer to keep my settings in ~/etc, as a sort of intuitive parallel to the Filesystem Hierarchy Standard. > > > Can I ask developers to break with the obsolete and annoying habit of > creating user-specific config files as ~/.app-name and use > ~/settings/app-name instead? > > Better: a user-specified $ETCDIR. -- http://mail.python.org/mailman/listinfo/python-list
I am not able to setup pydb2 ! Any help !
When I run the setup.py script , it throws an error Traceback (most recent call last): File "C:\vijay\db2\utils\PyDB2-1.1.0-2.tar\PyDB2-1.1.0\setup.py", line 57, in -toplevel- libraries=[ db2lib ], File "C:\Python24\lib\distutils\core.py", line 137, in setup raise SystemExit, gen_usage(dist.script_name) + "\nerror: %s" % msg SystemExit: usage: setup.py [global_opts] cmd1 [cmd1_opts] [cmd2 [cmd2_opts] ...] or: setup.py --help [cmd1 cmd2 ...] or: setup.py --help-commands or: setup.py cmd --help error: no commands supplied >>> Please let me know , what should have been the issue. Thanks in advance. Vj -- http://mail.python.org/mailman/listinfo/python-list
Re: I am not able to setup pydb2 ! Any help !
"vj" <[EMAIL PROTECTED]> schrieb im Newsbeitrag news:[EMAIL PROTECTED] | When I run the setup.py script , it throws an error | | Traceback (most recent call last): | File "C:\vijay\db2\utils\PyDB2-1.1.0-2.tar\PyDB2-1.1.0\setup.py", | line 57, in -toplevel- |libraries=[ db2lib ], | File "C:\Python24\lib\distutils\core.py", line 137, in setup |raise SystemExit, gen_usage(dist.script_name) + "\nerror: %s" % msg | SystemExit: usage: setup.py [global_opts] cmd1 [cmd1_opts] [cmd2 | [cmd2_opts] ...] | or: setup.py --help [cmd1 cmd2 ...] | or: setup.py --help-commands | or: setup.py cmd --help | | error: no commands supplied | >>> | | Please let me know , what should have been the issue. You need to say "setup.py install" instead of just setup.py HTH, -- Vincent Wehren | | Thanks in advance. | | Vj | -- http://mail.python.org/mailman/listinfo/python-list
Re: Perl's documentation come of age
Jeremy Jones wrote: > Ed Hotchkiss wrote: > > >>I'm new to Python, not programming. I agree with the point regarding >>the interpreter. what is that? who uses that!? Why are most examples >>like that, rather than executed as .py files? > > > I think showing examples at the Python interpreter prompt is *very* > helpful and IMHO a preferred method in plenty of cases. If I'm showing > someone a piece of code that returns some object the type of which > you're not really that familiar with, would you rather be running it in > a script, or on a command prompt (or, my preference is to either copy > and paste the example to a script an run it with ``python -i`` or paste > it to an edit in IPython)? With IPython (or vanilla Python interpreter > with parse-and-bind tab completion turned on), you can inspect the > object quite easily. Again, IMHO, much easier than from a script. > > >> >>Another problem that I have (which does get annoying after awhile), is >>not using foo and bar. Spam and Eggs sucks. It's not funny, although >>Monty Python does rock. Why not use silly+walks instead. > > > Eh. Life's too short for me to get up in a roar about such as this. > And Python's too good of a language for me to be overly bothered by > example naming conventions. YMMV. > Jim Hugunin's keynote speech at this year's PyCon was accompanied by a projection if his interactive interpreter session, and I know I wasn't alone in finding this a convincing example of Microsoft's (well, Jim's, really) full integration of Python into the .net framework. Modules are good, but the interactive interpreter is a brilliant way to show off what modules can do. As for "Why not foo and bar rather than spam and eggs?", all I can think of to say is "Get over it". regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
Re: I am not able to setup pydb2 ! Any help !
I am new to Python . Please let me where should I issue the command "setup.py install". I have been using the IDLE to run Python scripts. -- http://mail.python.org/mailman/listinfo/python-list
Re: wxPython Notebook crash when pressing alt key
Kreedz wrote: > I have written the "import wx" in my message. > > You press F key while holding down Alt while focusing on the tab? > > Python 2.4.1, wxPython 2.6.1.0 > Nope. Just slightly incompetent at copy-and-paste when multitasking. Looks like you might need to report a bug to the wxPython folks. regards Steve -- Steve Holden +44 150 684 7255 +1 800 494 3119 Holden Web LLC www.holdenweb.com PyCon TX 2006 www.pycon.org -- http://mail.python.org/mailman/listinfo/python-list
Re: C#3.0 and lambdas
On 9/21/05, Scott David Daniels <[EMAIL PROTECTED]> wrote: > Roel Schroeven wrote: > > ... > > Christophe schreef: > >> ... > >>And what about a function which computes the line length ? > > > > That would have been a better example indeed, since the *p1 trick > > doesn't work there. > > > > def euclidian_distance((x1, y1), (x2, y2)): > > return math.sqrt((x2 - x1)**2 + (y2 - y1)**2) > > > > That's a lot nicer, I think, than this: > > > > def euclidian_distance(p1, p2): > > return math.sqrt((p2[0] - p1[0])**2 + (p2[1] - p1[1])**2) > > But not massively nicer than: > > def euclidian_distance(p1, p2): > (x1, y1), (x2, y2) = p1, p2 > return math.sqrt((x2 - x1)**2 + (y2 - y1)**2) > But the question is - why go to the effort to remove the (by your admission) slightly nicer version? Peace Bill Mill bill.mill at gmail.com -- http://mail.python.org/mailman/listinfo/python-list
Re: I am not able to setup pydb2 ! Any help !
vj wrote: > When I run the setup.py script , it throws an error > > Traceback (most recent call last): > File "C:\vijay\db2\utils\PyDB2-1.1.0-2.tar\PyDB2-1.1.0\setup.py", > line 57, in -toplevel- > libraries=[ db2lib ], > File "C:\Python24\lib\distutils\core.py", line 137, in setup > raise SystemExit, gen_usage(dist.script_name) + "\nerror: %s" % msg > SystemExit: usage: setup.py [global_opts] cmd1 [cmd1_opts] [cmd2 > [cmd2_opts] ...] >or: setup.py --help [cmd1 cmd2 ...] >or: setup.py --help-commands >or: setup.py cmd --help > > error: no commands supplied > > > Please let me know , what should have been the issue. You have to give it a command. You probably want python setup.py install -- Robert Kern [EMAIL PROTECTED] "In the fields of hell where the grass grows high Are the graves of dreams allowed to die." -- Richard Harter -- http://mail.python.org/mailman/listinfo/python-list
Re: I am not able to setup pydb2 ! Any help !
"vj" <[EMAIL PROTECTED]> schrieb im Newsbeitrag news:[EMAIL PROTECTED] |I am new to Python . Please let me where should I issue the command | "setup.py install". | | I have been using the IDLE to run Python scripts. You need to open the command prompt (e.g. by entering "cmd" in the "Run" input box). Now enter "cd C:\vijay\db2\utils\PyDB2-1.1.0-2.tar\PyDB2-1.1.0" to get into the right directory. Now enter "setup.py install" and you should be all set.. -- Vincent -- http://mail.python.org/mailman/listinfo/python-list
Re: Finding where to store application data portably
> > > I'm using pygame to write a game called Bombz which needs to save some
> > > data in a directory associated with it. In Unix/Linux I'd probably use
> > > "~/.bombz", in Windows something like
> > > "C:\Documents And Settings\\Applicacation Data\Bombz".
> >
> > In Windows, you shouldn't hard-code the drive letter. I don't know how you
> > find out what the correct value is, but hard-coding it is just Bad.
> >
> XP Pro seems to take
>
> >>> print os.environ["APPDATA"]
> C:\Documents and Settings\Dennis Lee Bieber\Application Data
>
> Though the more consistent might be to hit the registry:
>
> HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Explorer\Shell
> Folders\AppData
>
> and to confuse matters, there is also a "Local AppData" entry
It isn't just the drive letter you shouldn't hardcode. In different
locales the phrases "Documents and Settings" and "Application Data"
are often different. The canonical way to get this dir on Windows is by
using the SHGetFolderPath Windows API call with the CSIDL_APPDATA
constant:
http://msdn.microsoft.com/library/default.asp?url=/library/en-us/shellcc/platform/shell/reference/functions/shgetfolderpath.asp
In Python code that is:
from win32com.shell import shellcon, shell
path = shell.SHGetFolderPath(0, shellcon.CSIDL_APPDATA, 0, 0)
Unfortunately that either means having the PyWin32 extensions installed
(which not all Python installations on Windows have) or building your
own small binary extension to make that call. Failing that, using the
registry location or the environment variable above might suffice
Note that on some older Windows flavours -- not sure exactly which --
the APPDATA env. var. might not be defined.
Also note that Windows app guidelines encourage you to have an
additional vendor/owner directory level before the app name. So:
%APPDATA%\\Bombz
I have a little working script that I use for this kind of stuff which
you are welcome too, if it helps. (attached)
Trent
--
Trent Mick
[EMAIL PROTECTED]
# Copyright (c) 2005 ActiveState Corp.
# License: MIT
# Author: Trent Mick ([EMAIL PROTECTED])
"""Cross-platform application utilities:
Utility Functions:
user_data_dir(...) path to user-specific app data dir
site_data_dir(...) path to all users shared app data dir
"""
#TODO:
# - Add cross-platform versions of other abstracted dir locations, like
# a cache dir, prefs dir, something like bundle/Contents/SharedSupport
# on OS X, etc.
#
http://developer.apple.com/documentation/MacOSX/Conceptual/BPRuntimeConfig/Concepts/UserPreferences.html
#
http://developer.apple.com/documentation/MacOSX/Conceptual/BPFileSystem/index.html
#
http://msdn.microsoft.com/library/default.asp?url=/library/en-us/shellcc/platform/shell/reference/enums/csidl.asp
#
import sys
import os
class Error(Exception):
pass
def user_data_dir(appname, owner=None, version=None):
"""Return full path to the user-specific data dir for this application.
"appname" is the name of application.
"owner" (only required and used on Windows) is the name of the
owner or distributing body for this application. Typically
it is the owning company name.
"version" is an optional version path element to append to the
path. You might want to use this if you want multiple versions
of your app to be able to run independently. If used, this
would typically be ".".
Typical user data directories are:
Windows:C:\Documents and Settings\USER\Application
Data\\
Mac OS X: ~/Library/Application Support/
Unix: ~/.
"""
if sys.platform.startswith("win"):
# Try to make this a unicode path because SHGetFolderPath does
# not return unicode strings when there is unicode data in the
# path.
if owner is None:
raise Error("must specify 'owner' on Windows")
from win32com.shell import shellcon, shell
path = shell.SHGetFolderPath(0, shellcon.CSIDL_APPDATA, 0, 0)
try:
path = unicode(path)
except UnicodeError:
pass
path = os.path.join(path, owner, appname)
elif sys.platform == 'darwin':
from Carbon import Folder, Folders
path = Folder.FSFindFolder(Folders.kUserDomain,
Folders.kApplicationSupportFolderType,
Folders.kDontCreateFolder)
path = os.path.join(path.FSRefMakePath(), appname)
else:
path = os.path.expanduser("~/." + appname.lower())
if version:
path = os.path.join(path, version)
return path
def site_data_dir(appname, owner=None, version=None):
"""Return full path to the user-shared data dir for this application.
"appname" is the name of application.
"owner" (only required and used on Windows) is the name of the
ow
Re: I am not able to setup pydb2 ! Any help !
Unfortunately I get another error Your DB2 root is: C:\Program Files\IBM\SQLLIB\ running install running build running build_py creating build creating build\lib.win32-2.4 copying DB2.py -> build\lib.win32-2.4 running build_ext error: The .NET Framework SDK needs to be installed before building extensions f or Python. -- http://mail.python.org/mailman/listinfo/python-list
Re: Writing a parser the right way?
Well, a declarative sentence is essentially subject-predicate-object, while a question is predicate-subject-object. This is important in further processing. So perhaps i should code this order into the classes? I need to think a little bit more about this. Thanks for your feed for thought! :) -- http://mail.python.org/mailman/listinfo/python-list
