Processed: tagging 919734

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 919734 + buster sid
Bug #919734 [src:node-yauzl] node-yauzl: FTBFS (TypeError: FdSlicer is not a 
constructor)
Added tag(s) sid and buster.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919734: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919734
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: tagging 919737

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 919737 + buster sid
Bug #919737 [src:underscore] underscore: FTBFS (ERROR: `underscore.min.map` is 
not a supported option)
Added tag(s) buster and sid.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919737: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919737
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919554: virtualbox-qt: Cannot launch Virtualbox

[Daniel Baumann]

Hi,

newer Qt does the right thing here: VirtualBox does not need to be 
setuid root but VirtualBoxVM needs to be.


I've tested and commited this in git. Gianfranco, may I upload this to 
experimental?


Regards,
Daniel

Processed: bts

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tag 919554 + patch
Bug #919554 [virtualbox-qt] virtualbox-qt: Cannot launch Virtualbox
Added tag(s) patch.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919554: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919554
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919093: marked as done (Please remove (build-)dependency on mongodb for buster)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 09:24:45 +
with message-id 
and subject line Bug#919093: fixed in nextepc 0.3.10+nods-3
has caused the Debian Bug report #919093,
regarding Please remove (build-)dependency on mongodb for buster
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919093: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919093
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: mongodb
Version: 1:3.4.15-1
Severity: serious
Justification: Cannot be properly supported

MongoDB should not be part of (at least) Buster for the following 
reasons:

 - MongoDB 3.4 will be EOL by June 2019[1], which is way too soon for it 
   to be included in Buster.

 - MongoDB 3.6 and 4.0 will be supported longer, but upstream's switch 
   to SSPLv1 complicates matters. As discussed in #915537, we will not 
   be distributing any SSPL-licensed software, and keeping the last 
   AGPL-licensed version (3.6.8 or 4.0.3) without the ability to 
   cherry-pick upstream fixes is not a viable option. (I am currently 
   not considering distributing mongodb in non-free.)

I will not request removal immediately, to allow other packages time to 
adjust their dependencies, but eventually auto-removal will kick in.  

That said, MongoDB 3.4 will probably remain in sid for as long as it is 
AGPL-licensed and supported upstream.

Apollon

[1] https://www.mongodb.com/support-policy
--- End Message ---
--- Begin Message ---
Source: nextepc
Source-Version: 0.3.10+nods-3

We believe that the bug you reported is fixed in the latest version of
nextepc, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Ruben Undheim  (supplier of updated nextepc package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 09:12:13 +0100
Source: nextepc
Binary: nextepc-core nextepc-mme nextepc-sgw nextepc-pgw nextepc-pcrf 
nextepc-hss nextepc
Architecture: source
Version: 0.3.10+nods-3
Distribution: unstable
Urgency: medium
Maintainer: Debian Mobcom Maintainers 

Changed-By: Ruben Undheim 
Description:
 nextepc- Evolved Packet Core implementation for LTE (metapackage)
 nextepc-core - Evolved Packet Core for LTE (Shared Files)
 nextepc-hss - Evolved Packet Core - Home Subscriber Server (HSS)
 nextepc-mme - Evolved Packet Core - Mobility Management Entity (MME)
 nextepc-pcrf - Evolved Packet Core - Policy and Charging Rules Function (PCRF)
 nextepc-pgw - Evolved Packet Core - Packet Data Network Gateway (PDN-GW)
 nextepc-sgw - Evolved Packet Core - Serving Gateway (SGW)
Closes: 919093
Changes:
 nextepc (0.3.10+nods-3) unstable; urgency=medium
 .
   * debian/control:
 - Move mongodb to Recommends (Closes: #919093)
 - Move nextepc-pcrf and nextepc-hss from Recommends to Depends in the
   metapackage nextepc.
 - New standards version 4.3.0 - no changes
Checksums-Sha1:
 937e4eaca6dedfebce1638dd4d01d72b0ee8eb82 2640 nextepc_0.3.10+nods-3.dsc
 c548c17962854bcb1df8219cafe5d956ca3ea382 19352 
nextepc_0.3.10+nods-3.debian.tar.xz
Checksums-Sha256:
 2e509dcd7a0cfe0845a679b7961a5dcef5dddf6475fc1d4bb3ee4e09b85fa783 2640 
nextepc_0.3.10+nods-3.dsc
 b1b372ad21b5ffb653a49c7ac861dcebcbbcf7dcbecafa8b00973ea83c8f4ac0 19352 
nextepc_0.3.10+nods-3.debian.tar.xz
Files:
 82e52dcab4483e1c7d4d770b79f89079 2640 net optional nextepc_0.3.10+nods-3.dsc
 b6c6a75b9cfa71dea466c236c2dac3b0 19352 net optional 
nextepc_0.3.10+nods-3.debian.tar.xz

-BEGIN PGP SIGNATURE-

iQJMBAEBCgA2FiEETeTfPeKePuppVOXOGnb1/BKWi3kFAlxC3RUYHHJ1YmVuLnVu
ZGhlaW1AZ21haWwuY29tAAoJEBp29fwSlot5VYIP/AldLFtQ7/y/32GNvFbEJp0N
XGu7adIsoE0TdXN/Kh2nppb38OmlTV6k8tRufH5sig3HOEO8rDTGiqZAE0Fi0J1l
hcB6/DAiGMrgurXPOSZS/c64lPCd/vcyeGOw3hd3GXrToifWmd7eXx8bWYLhOmIF
dPVACMmQT7M0IlOcHpZnznhBJiIrZ3kGiLEhnxpC39bV04WCeERCl1NjMnvA7+i8
fbWkU3vIyHs7iD737IUi1LZUEAnIBoWW+dhX4y75jFYDJJ9eawdD5gpMRZ/Y5q0p
xn1V1eL+e6uiFfsH1mpkcPLOQxZ0v3AFDTsjJuU27t/pRRNxMf7AzAHx0IUTxlqH
2q9c7/th78w+PZR5dIhoMwYLd5dAkkEiU4NHeDFWHmpy+ea6bZOIfUmgqts+7vnw
IqAUqC+/Ra931N2mtCgPxgYFfVwc0NscvzrjSOqleDUtSH1vmXv+EzYmJd90L1gm
MbMKetOg/3VpZrgcKyg2U8L25cwyGLbrPCh79te2

Bug#919649: axiom: /usr/lib/axiom-20170401/bin missing when package is rebuilt

[Juhani Numminen]

Juhani Numminen kirjoitti 18.1.2019 klo 13.15:
> Hi again,
> 
> My test build just finished and I have attached the build log
> from my pbuilder as well as the result of
>   dpkg --contents axiom_20170501-3_amd64.deb
> on the freshly built package.

I noticed that the files I attached actually described a successful
build with all the required files.

I have now tried pbuilder with
 1) amd64, all binary packages
 2) amd64, arch-dependent binary packages
 3) i386, all binary packages
but unfortunately all those builds have produced working packages :)


Juhani

Bug#919388: marked as done (ubertooth: Replace pyside dependencies by pyside2 dependencies)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 09:33:10 +
with message-id 
and subject line Bug#919388: fixed in ubertooth 2018.12.R1-2
has caused the Debian Bug report #919388,
regarding ubertooth: Replace pyside dependencies by pyside2 dependencies
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919388: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919388
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: ubertooth
Version: 2018.12.R1-1
Severity: serious
User: de...@kali.org
Usertags: origin-kali

The last release of ubertooth updated /usr/bin/ubertooth-specan-ui to use
PySide2 instead of PySide but the Recommends field has not been updated
accordingly:
$ apt-cache show ubertooth|grep Recommends
Recommends: ubertooth-firmware, python-pyside.qtcore, python-pyside.qtgui
$ grep PySide2 /usr/bin/ubertooth-specan-ui
from PySide2 import QtCore, QtGui, QtWidgets
from PySide2.QtCore import Qt, QPointF, QLineF

Please recommend "python-pyside2.qtcore, python-pyside2.qtgui,
python-pyside2.qtwidgets".

Thank you.

This bug report is triggered by Kali's work to get rid of pyside 1.x:
https://bugs.kali.org/view.php?id=4978

-- System Information:
Debian Release: buster/sid
  APT prefers oldoldstable
  APT policy: (500, 'oldoldstable'), (500, 'unstable'), (500, 'testing'), (500, 
'stable'), (500, 'oldstable'), (1, 'experimental')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 4.18.0-3-amd64 (SMP w/4 CPU cores)
Locale: LANG=fr_FR.UTF-8, LC_CTYPE=fr_FR.UTF-8 (charmap=UTF-8), 
LANGUAGE=fr_FR.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)
LSM: AppArmor: enabled
--- End Message ---
--- Begin Message ---
Source: ubertooth
Source-Version: 2018.12.R1-2

We believe that the bug you reported is fixed in the latest version of
ubertooth, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Ruben Undheim  (supplier of updated ubertooth package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 08:56:02 +0100
Source: ubertooth
Binary: libubertooth1 libubertooth-dev ubertooth-firmware 
ubertooth-firmware-source ubertooth
Architecture: source
Version: 2018.12.R1-2
Distribution: unstable
Urgency: medium
Maintainer: Ruben Undheim 
Changed-By: Ruben Undheim 
Description:
 libubertooth-dev - Shared library for Bluetooth experimentation - development 
files
 libubertooth1 - Shared library for Bluetooth experimentation
 ubertooth  - 2.4 GHz wireless development platform for Bluetooth experimentati
 ubertooth-firmware - Firmware for Ubertooth
 ubertooth-firmware-source - Source code for the Ubertooth firmware
Closes: 919388
Changes:
 ubertooth (2018.12.R1-2) unstable; urgency=medium
 .
   * debian/control:
 - Fix dependencies ("Recommends") for ubertooth-specan-ui (Closes: #919388)
   Replaced: python-pyside.qtcore and python-pyside.qtgui with
   python-pyside2.qtgui, python-pyside2.qtwidgets and python-pyside2.qtcore.
   (upstream has migrated the code to work with PySide2)
 - New standards version 4.3.0 - no changes
Checksums-Sha1:
 6c162b2ef67529302455efe6dcd7c261f3226b6e 2646 ubertooth_2018.12.R1-2.dsc
 d7d8e62fa40367854f99ec0272177f0bffe7164f 14780 
ubertooth_2018.12.R1-2.debian.tar.xz
Checksums-Sha256:
 5344768a0c29e4d75bce3d3293c3998ac1ea46a31977d1d23f0054588a2483e1 2646 
ubertooth_2018.12.R1-2.dsc
 0f9c98d21f78ccf5a7092c42a93b57d8b7de5f1495b8cc33a5c84f8bfff63072 14780 
ubertooth_2018.12.R1-2.debian.tar.xz
Files:
 82a7c9ef36229d19beabb48f53713cd0 2646 science optional 
ubertooth_2018.12.R1-2.dsc
 6cb74d4db532a029b3e6370a1e5b5e95 14780 science optional 
ubertooth_2018.12.R1-2.debian.tar.xz

-BEGIN PGP SIGNATURE-

iQJMBAEBCgA2FiEETeTfPeKePuppVOXOGnb1/BKWi3kFAlxC2gwYHHJ1YmVuLnVu
ZGhlaW1AZ21haWwuY29tAAoJEBp29fwSlot5FI4QAIHQz9ZYDvT6cbpGWnBL2s8s
v9XArGI+cR3EpPqe20DsZEolYwlZYi+kPBQ8Wp/P18+e2g9Rlbm0l3ANH6qtkj1o
FZ0t5BRLWC43l6ZFGEMHZa14/T/YTzgSr7IopNS8V7CKXQaT6LHuUzSi+6DaYa5H
P2QFTQ8rvUS0LulP/sPlTQB05jS2NMGU1/2ijdVJkbIf0e5PMWTelfI1OoaooQGZ
N3db4Tp1Eet++1yBMC745p6cKLDj/M4

Bug#919560: marked as done (r-cran-callr: autopkgtest regression)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 09:33:02 +
with message-id 
and subject line Bug#919560: fixed in r-cran-callr 3.1.1-2
has caused the Debian Bug report #919560,
regarding r-cran-callr: autopkgtest regression
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919560: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919560
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: r-cran-callr
Version: 3.1.1-1
X-Debbugs-CC: debian...@lists.debian.org
User: debian...@lists.debian.org
Usertags: regression

Dear maintainers,

With a recent upload of r-cran-callr the autopkgtest of r-cran-callr
fails in testing when that autopkgtest is run with the binary packages
of r-cran-callr from unstable. It passes when run with only packages
from testing. In tabular form:
   passfail
r-cran-callr   from testing3.1.1-1
all others from testingfrom testing

I copied some of the output at the bottom of this report.

Currently this regression is blocking the migration to testing [1]. Can
you please investigate the situation and fix it? If needed, please
change the bug's severity.

More information about this bug and the reason for filing it can be found on
https://wiki.debian.org/ContinuousIntegration/RegressionEmailInformation

Paul

[1] https://qa.debian.org/excuses.php?package=r-cran-callr

https://ci.debian.net/data/autopkgtest/testing/amd64/r/r-cran-callr/1717391/log.gz

== Failed
==
-- 1. Error: messages in callr::r do not crash session
(@test-messages.R#5)  ---
there is no package called 'cliapp'
1: r(function() {
   cliapp::cli_text("fooobar")
   1 + 1
   }) at testthat/test-messages.R:5
2: get_result(output = out, options)

-- 2. Failure: (unknown) (@test-messages.R#4)
-
'messages in callr::r do not crash session' did not close network
connections:
c("NA", "NA")
c("NA", "NA")
c("NA", "NA")
c("NA", "NA")
c("NA", "NA")
c("NA", "NA")

-- 3. Error: messages in callr::r_bg do not crash session
(@test-messages.R#16)
there is no package called 'cliapp'
1: expect_equal(rx$get_result(), 2) at testthat/test-messages.R:16
2: quasi_label(enquo(object), label)
3: eval_bare(get_expr(quo), get_env(quo))
4: rx$get_result()
5: rp_get_result(self, private)
6: get_result(out, private$options)

-- 4. Failure: (unknown) (@test-messages.R#10)

'messages in callr::r_bg do not crash session' did not close network
connections:
c("NA", "NA", "NA", "NA")
c("NA", "NA", "NA", "NA")
c("NA", "NA", "NA", "NA")
c("NA", "NA", "NA", "NA")
c("NA", "NA", "NA", "NA")
c("NA", "NA", "NA", "NA")

== DONE

Error: Test failures
Execution halted
autopkgtest [04:43:11]: test run-unit-test: ---]



signature.asc
Description: OpenPGP digital signature
--- End Message ---
--- Begin Message ---
Source: r-cran-callr
Source-Version: 3.1.1-2

We believe that the bug you reported is fixed in the latest version of
r-cran-callr, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Dylan Aïssi  (supplier of updated r-cran-callr package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 09:30:59 +0100
Source: r-cran-callr
Binary: r-cran-callr
Architecture: source
Version: 3.1.1-2
Distribution: unstable
Urgency: medium
Maintainer: Debian R Packages Maintainers 
Changed-By: Dylan Aïssi 
Description:
 r-cran-callr - Call GNU R from GNU R
Closes: 919560
Changes:
 r-cran-callr (3.1.1-2) unstable; urgency=medium
 .
   * Team upload.
   * Add patch to skip failing tests. (Closes: #919560)
Checksums-Sha1:
 0bf9e24d0618670c9119b37672d8f3affe7145a2 2109 r-cran-callr_3.1.1-2.dsc
 aea48dd086dd6234dc3a2f8a9725922abfc3b72b 2632 
r-cran-callr_3.1.1-2.debian.tar.xz
 53febca1af9c446f83e7bbd62f0478ab878f21bb 8419 
r-cran-callr_3.1.1-2_amd64.buildinfo
Checksums-Sha256:
 aee9697b1ba3993718a956fce05c2f73d7b8acc8b7dc2d137e65926eaa4b70bf 

Bug#919755: libimagequant doesn't use the baseline on i386

[Matthias Klose]

Package: src:libimagequant
Version: 2.12.1-2
Severity: serious
Tags: sid buster

the package is built using -DUSE_SSE=1 -msse -mfpmath=sse on i386, which is not
the i386 baseline.

Bug#919759: gokey FTBFS on armel/mips*: FAIL github.com/cloudflare/gokey

[Adrian Bunk]

Source: gokey
Version: 0.0~git20190103.40eba7e-1
Severity: serious
Tags: ftbfs

https://buildd.debian.org/status/package.php?p=gokey

...
=== RUN   TestGetKey
SIGQUIT: quit
PC=0x6a26c m=0 sigcode=0

goroutine 0 [idle]:
runtime.futex(0x29f17c, 0x80, 0x0, 0x0, 0x0, 0x0, 0x11ccc, 0x0, 0x0, 0x41354, 
...)
/usr/lib/go-1.11/src/runtime/sys_linux_arm.s:330 +0x1c
runtime.futexsleep(0x29f17c, 0x0, 0x, 0x)
/usr/lib/go-1.11/src/runtime/os_linux.go:46 +0x78
runtime.notesleep(0x29f17c)
/usr/lib/go-1.11/src/runtime/lock_futex.go:151 +0xac
runtime.stopm()
/usr/lib/go-1.11/src/runtime/proc.go:2016 +0xac
runtime.findrunnable(0x1021300, 0x0)
/usr/lib/go-1.11/src/runtime/proc.go:2487 +0x374
runtime.schedule()
/usr/lib/go-1.11/src/runtime/proc.go:2613 +0x114
runtime.park_m(0x105c1c0)
/usr/lib/go-1.11/src/runtime/proc.go:2676 +0x8c
runtime.mcall(0x67628)
/usr/lib/go-1.11/src/runtime/asm_arm.s:289 +0x5c

goroutine 1 [chan receive, 9 minutes]:
testing.(*T).Run(0x10c00a0, 0x18b629, 0xa, 0x19585c, 0x1)
/usr/lib/go-1.11/src/testing/testing.go:879 +0x2d0
testing.runTests.func1(0x10c)
/usr/lib/go-1.11/src/testing/testing.go:1119 +0x68
testing.tRunner(0x10c, 0x1038f00)
/usr/lib/go-1.11/src/testing/testing.go:827 +0xac
testing.runTests(0x1080100, 0x29cf58, 0xc, 0xc, 0x40)
/usr/lib/go-1.11/src/testing/testing.go:1117 +0x22c
testing.(*M).Run(0x106a140, 0x0)
/usr/lib/go-1.11/src/testing/testing.go:1034 +0x134
main.main()
_testmain.go:64 +0x12c

goroutine 6 [runnable]:
math/big.nat.montgomery(0x13bafc0, 0x40, 0x86, 0x14bb8c0, 0x40, 0x86, 
0x14bb8c0, 0x40, 0x86, 0x11a0a20, ...)
/usr/lib/go-1.11/src/math/big/nat.go:208 +0x36c
math/big.nat.expNNMontgomery(0x13bafc0, 0x40, 0x86, 0x141e7e0, 0x40, 0x44, 
0x141e5a0, 0x40, 0x44, 0x11a0a20, ...)
/usr/lib/go-1.11/src/math/big/nat.go:1255 +0x760
math/big.nat.expNN(0x13bafc0, 0x40, 0x86, 0x141e7e0, 0x40, 0x44, 0x141e5a0, 
0x40, 0x44, 0x11a0a20, ...)
/usr/lib/go-1.11/src/math/big/nat.go:1067 +0x730
math/big.nat.probablyPrimeMillerRabin(0x11a0a20, 0x40, 0x44, 0x15, 0x41d28901, 
0x44)
/usr/lib/go-1.11/src/math/big/prime.go:106 +0x368
math/big.(*Int).ProbablyPrime(0x1080240, 0x14, 0x103fd38)
/usr/lib/go-1.11/src/math/big/prime.go:78 +0x2b8
crypto/rand.Prime(0x1b2f30, 0x1080ab0, 0x800, 0x1080ac0, 0x0, 0x0)
/usr/lib/go-1.11/src/crypto/rand/util.go:99 +0x24c
github.com/cloudflare/gokey/rsa.generateMultiPrimeKey(0x1b2f30, 0x1080ab0, 0x2, 
0x1000, 0x1078e40, 0x1b2d68, 0x10882d0)

/<>/obj-arm-linux-gnueabi/src/github.com/cloudflare/gokey/rsa/keygen.go:64
 +0x11c
github.com/cloudflare/gokey/rsa.GenerateKey(0x1b2f30, 0x1080ab0, 0x1000, 0x5, 
0x103fe78, 0x18)

/<>/obj-arm-linux-gnueabi/src/github.com/cloudflare/gokey/rsa/keygen.go:17
 +0x34
github.com/cloudflare/gokey.(*KeyGen).generateRsa(0x103fe98, 0x3, 0x1b2f30, 
0x1080ab0, 0x0, 0x0)

/<>/obj-arm-linux-gnueabi/src/github.com/cloudflare/gokey/keygen.go:169
 +0x3c
github.com/cloudflare/gokey.(*KeyGen).GenerateKey(0x103fe98, 0x3, 0x103fe78, 
0x18, 0x10dee00, 0x100)

/<>/obj-arm-linux-gnueabi/src/github.com/cloudflare/gokey/keygen.go:212
 +0xd4
github.com/cloudflare/gokey.GetKey(0x18a854, 0x5, 0x18b9cd, 0xb, 0x10dee00, 
0x100, 0x100, 0x3, 0x144a100, 0x17c118, ...)

/<>/obj-arm-linux-gnueabi/src/github.com/cloudflare/gokey/gokey.go:53
 +0x13c
github.com/cloudflare/gokey.testGetKeyType(0x3, 0x10c00a0)

/<>/obj-arm-linux-gnueabi/src/github.com/cloudflare/gokey/gokey_test.go:132
 +0x454
github.com/cloudflare/gokey.TestGetKey(0x10c00a0)

/<>/obj-arm-linux-gnueabi/src/github.com/cloudflare/gokey/gokey_test.go:169
 +0x60
testing.tRunner(0x10c00a0, 0x19585c)
/usr/lib/go-1.11/src/testing/testing.go:827 +0xac
created by testing.(*T).Run
/usr/lib/go-1.11/src/testing/testing.go:878 +0x2b0

trap0x0
error   0x0
oldmask 0x0
r0  0x29f17c
r1  0x80
r2  0x0
r3  0x0
r4  0x0
r5  0x0
r6  0x2
r7  0xf0
r8  0xe6e8b6e1
r9  0x1
r10 0x29eeb0
fp  0x5
ip  0xb6d3e015
sp  0xbed20108
lr  0x38cbc
pc  0x6a26c
cpsr0x2010
fault   0x0
*** Test killed with quit: ran too long (10m0s).
FAILgithub.com/cloudflare/gokey 600.024s
?   github.com/cloudflare/gokey/cmd/gokey   [no test files]

Bug#919707: matrix-synapse: Missing depends

[sergio]

On Fri, 18 Jan 2019 23:02:28 +0100 Kurt Roeckx  wrote:


You have python3-msgpack (>= 0.3.0), while it should be be >= 0.4.2.



The python3-msgpack dependency is absent.

% apt show matrix-synapse | grep msgpack
%

But it's required!

# /etc/init.d/matrix-synapse start
ERROR:root:Needed msgpack>=0.4.2 but it was not installed



python3-pymacaroons dependency is OK:

% aptitude why python3-pymacaroons
i   matrix-synapse Depends python3-pymacaroons



% apt show matrix-synapse | grep jinja2

Suggests: python3-bleach (>= 1.4.2), python3-jinja2 (>= 2.8)

but 2.9 is required:

# /etc/init.d/matrix-synapse start

ERROR:root:Needed Jinja2>=2.9 but it was not installed
ERROR:root:Needed Jinja2>=2.9 but it was not installed
Missing Requirements: python3-Jinja2>=2.9, python3-Jinja2>=2.9
To install run:
sudo apt install python3-Jinja2>=2.9 python3-Jinja2>=2.9


--
sergio.

Bug#919029: grub-pc: meaningless message "RUB boot loader was previously installed..."

[Vincent Lefevre]

On 2019-01-12 13:33:35 +, Colin Watson wrote:
> On Sat, Jan 12, 2019 at 02:11:25PM +0100, Vincent Lefevre wrote:
> > On 2019-01-12 10:36:02 +, Colin Watson wrote:
> > > The ID changing is presumably the systemd bug you mentioned, and that
> > > seems to be the grave part of this.
> > 
> > Actually, I think that the fact that grub-pc changes the configuration
> > and loses the previous one is a grave bug too (even though it is
> > caused by the udev bug). There should have been a way for the user to
> > keep the previous configuration so that nothing gets broken due to
> > temporary issues.
> 
> I'm not at all sure that I agree.  The configuration in question exists
> in order to tell the postinst which devices it should run grub-install
> on.  If the device does not exist, it obviously isn't possible to run
> grub-install on it.
> 
> I can see the argument that it might be convenient to have configuration
> that effectively says "install to this device if it exists, otherwise
> continue anyway"; but such a configuration may mean that the GRUB image
> on disk that you might in fact attempt to boot from will end up being
> incompatible with the rest of /boot/grub/ and thus cause a failure to
> boot even though the postinst pretended everything is fine!
> Disregarding this kind of configuration error can have grave
> consequences of its own.  In any case, even if it might be convenient to
> have such a configuration, I won't accept that part of the issue as a
> grave bug.

I meant that the issue was that the user may not have remember
or even known where GRUB was installed (this was my case, and
I could find the information just because I keep track of the
changes of config.dat). This makes the problem unfixable without
risking to erase some data.

> Note that temporary issues of this kind are extremely rare; this is the
> first of its kind that I can recall hearing about.  By contrast, it's
> quite common for people to accidentally end up with a boot sector that
> they thought was being updated when it in fact wasn't.  It makes a lot
> more sense for the GRUB maintainer scripts to prioritise dealing with
> the latter situation than the former.  So I'm happy to try to improve
> the way the maintainer scripts responded here, but not in a way that
> results in silently ignoring missing devices.
> 
> If the dialog box hadn't been cut off in a way that made it non-obvious
> that GRUB needed you to select devices to install to, I don't think you
> would have ended up in this situation.

I don't think so. I think that I would have chosen to let the new
version of GRUB uninstalled for the moment (just like what I actually
did), because I did not know where to install it. Same loss of
information. The only difference would have been that the message
would have been clearer.

-- 
Vincent Lefèvre  - Web: 
100% accessible validated (X)HTML - Blog: 
Work: CR INRIA - computer arithmetic / AriC project (LIP, ENS-Lyon)

Processed: tagging 916013

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 916013 + confirmed pending
Bug #916013 [src:atop] atop FTBFS with glibc 2.28
Added tag(s) pending.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
916013: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=916013
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: Re: Bug#915970: asyncpg: FTBFS on hppa - test timeouts

[Debian Bug Tracking System]

Processing control commands:

> retitle -1 asyncpg frequently FTBFS due to test timeouts
Bug #915970 [src:asyncpg] asyncpg: FTBFS on hppa - test timeouts
Changed Bug title to 'asyncpg frequently FTBFS due to test timeouts' from 
'asyncpg: FTBFS on hppa - test timeouts'.
> severity -1 serious
Bug #915970 [src:asyncpg] asyncpg frequently FTBFS due to test timeouts
Severity set to 'serious' from 'normal'

-- 
915970: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=915970
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919730: Bug #919730 in lemonldap-ng marked as pending

[Xavier Guimard]

Control: tag -1 pending

Hello,

Bug #919730 in lemonldap-ng reported by you has been fixed in the
Git repository and is awaiting an upload. You can see the commit
message below and you can check the diff of the fix at:

https://salsa.debian.org/perl-team/modules/packages/lemonldap-ng/commit/44b4c095b5855b2990c23a7cd1cd1f283db5d9e5


Remove useless test

Closes: #919730


(this message was generated automatically)
-- 
Greetings

https://bugs.debian.org/919730

Bug#919763: adios: armhf FTBFS when built on arm64

[Adrian Bunk]

Source: adios
Version: 1.13.1-11
Severity: serious
Tags: ftbfs

https://buildd.debian.org/status/logs.php?pkg=adios&arch=armhf

...
make  check-TESTS
make[5]: Entering directory '/<>/build-mpich/tests/test_src'
make[6]: Entering directory '/<>/build-mpich/tests/test_src'
PASS: copy_subvolume
PASS: test_strutil
PASS: text_to_pairstruct
PASS: trim_spaces
PASS: group_free_test
PASS: transforms_specparse
../../../config/test-driver: line 107: 15948 Bus error   "$@" > 
$log_file 2>&1
../../../config/test-driver: line 107: 15949 Bus error   "$@" > 
$log_file 2>&1
FAIL: read_points_2d
FAIL: array_attribute
PASS: selection_api
../../../config/test-driver: line 107: 15944 Bus error   "$@" > 
$log_file 2>&1
FAIL: query_minmax
../../../config/test-driver: line 107: 15950 Bus error   "$@" > 
$log_file 2>&1
FAIL: read_points_3d
PASS: points_1DtoND
PASS: hashtest
=
   adios 1.13.1: tests/test_src/test-suite.log
=

# TOTAL: 14
# PASS:  9
# SKIP:  0
# XFAIL: 0
# FAIL:  5
# XPASS: 0
# ERROR: 0

.. contents:: :depth: 2

FAIL: query_minmax
==

Running query_minmax  
[rank=000, line 196]: Write step 0 to query_minmax.bp
[rank=000, line 200]:   groupsize calculated = 48
[rank=000, line 202]:   groupsize calculated = 448
[rank=000, line 205]:   groupsize 448, totalsize 1844
[rank=000, line 237]:   Write time for step 0 was  0.000 seconds
[rank=000, line 196]: Write step 1 to query_minmax.bp
FAIL query_minmax (exit status: 135)

FAIL: read_points_2d


Running read_points  
[rank=000, line 221]: Write step 0 to read_points_2d.bp
[rank=000, line 264]:   Write time for step 0 was  0.000 seconds
[rank=000, line 221]: Write step 1 to read_points_2d.bp
FAIL read_points_2d (exit status: 135)

FAIL: read_points_3d


Running read_points  
[rank=000, line 238]: Write step 0 to read_points_3d.bp
[rank=000, line 274]:   Write time for step 0 was  0.001 seconds
[rank=000, line 238]: Write step 1 to read_points_3d.bp
FAIL read_points_3d (exit status: 135)

FAIL: array_attribute
=

FAIL array_attribute (exit status: 135)

FAIL: array_attribute
=

FAIL array_attribute (exit status: 135)


Testsuite summary for adios 1.13.1

# TOTAL: 14
# PASS:  9
# SKIP:  0
# XFAIL: 0
# FAIL:  5
# XPASS: 0
# ERROR: 0

See tests/test_src/test-suite.log

make[6]: *** [Makefile:1343: test-suite.log] Error 1


These are likely alignment problems.

Backtrace of array_attribute:

#0  0x00b6ac76 in bp_parse_vars (fh=fh@entry=0x14dc940) at 
../../src/core/bp_utils.c:1585
#1  0x00b6bc1e in bp_open (fname=, comm=comm@entry=1, 
fh=fh@entry=0x14dc940)
at ../../src/core/bp_utils.c:384
#2  0x00b780ae in open_stream (timeout_sec=, comm=1, 
fname=, fp=0x14ddfb0)
at ../../src/read/read_bp.c:1685
#3  adios_read_bp_open (fname=, comm=1, lock_mode=, timeout_sec=)
at ../../src/read/read_bp.c:1713
#4  0x00b6d76e in common_read_open (fname=0xbbe394  
"array_attribute.bp", method=ADIOS_READ_METHOD_BP, 
comm=1, lock_mode=ADIOS_LOCKMODE_NONE, timeout_sec=0) at 
../../src/core/common_read.c:424
#5  0x00b50698 in read_attrs () at ../../../tests/test_src/array_attribute.c:267
#6  0x00b4ff1c in main (argc=, argv=) at 
../../../tests/test_src/array_attribute.c:115

Processed: Bug #919730 in lemonldap-ng marked as pending

[Debian Bug Tracking System]

Processing control commands:

> tag -1 pending
Bug #919730 [src:lemonldap-ng] lemonldap-ng: FTBFS (failing tests)
Added tag(s) pending.

-- 
919730: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919730
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919707: matrix-synapse: Missing depends

[Kurt Roeckx]

On Sat, Jan 19, 2019 at 12:24:45PM +0300, sergio wrote:
> On Fri, 18 Jan 2019 23:02:28 +0100 Kurt Roeckx  wrote:
> 
> > You have python3-msgpack (>= 0.3.0), while it should be be >= 0.4.2.
> 
> 
> The python3-msgpack dependency is absent.
> 
> % apt show matrix-synapse | grep msgpack
> %
> 
> But it's required!

You're right. It has the Depends in testing, but not in
stretch-backports.

Testing has:
Depends: adduser, debconf, libjs-jquery, lsb-base (>= 3.0-6), 
python3-canonicaljson (>= 1.1.3), python3-nacl (>= 1.2.1), python3-pymacaroons, 
python3-pysaml2 (>= 4.0.0), python3-systemd, python3-twisted (>= 17.1.0), 
debconf (>= 0.5) | debconf-2.0, python3-attr (>= 16.0.0), python3-bcrypt, 
python3-daemonize, python3-frozendict (>= 1), python3-jsonschema (>= 2.5.1), 
python3-msgpack (>= 0.3.0), python3-netaddr (>= 0.7.18), python3-openssl (>= 
0.14), python3-phonenumbers, python3-pil, python3-prometheus-client, 
python3-psutil, python3-pyasn1 (>= 0.1.9), python3-pyasn1-modules, 
python3-service-identity (>= 1.0.0), python3-signedjson (>= 1.0.0), python3-six 
(>= 1.10), python3-sortedcontainers, python3-treq (>= 18), 
python3-unpaddedbase64 (>= 1.0.1), python3-yaml, python3:any

stretch-backports has:
Depends: adduser, debconf, libjs-jquery, lsb-base (>= 3.0-6), 
python3-canonicaljson (>= 1.1.3), python3-nacl (>= 1.2.1), python3-pymacaroons, 
python3-pysaml2 (>= 4.0.0), python3-systemd, python3-twisted (>= 17.1.0), 
debconf (>= 0.5) | debconf-2.0, init-system-helpers (>= 1.18~), python3-attr 
(>= 16.0.0), python3-bcrypt, python3-daemonize, python3-frozendict (>= 1), 
python3-jsonschema (>= 2.5.1), python3-netaddr (>= 0.7.18), python3-openssl (>= 
0.14), python3-phonenumbers, python3-pil, python3-prometheus-client, 
python3-psutil, python3-pyasn1 (>= 0.1.9), python3-pyasn1-modules, 
python3-service-identity (>= 1.0.0), python3-signedjson, python3-six (>= 1.10), 
python3-sortedcontainers, python3-treq (>= 18), python3-unpaddedbase64, 
python3-yaml, python3:any (>= 3.3.2-2~)

debdiff shows:
Depends: adduser, debconf, libjs-jquery, lsb-base (>= 3.0-6), 
python3-canonicaljson (>= 1.1.3), python3-nacl (>= 1.2.1), python3-pymacaroons, 
python3-pysaml2 (>= 4.0.0), python3-systemd, python3-twisted (>= 17.1.0), 
debconf (>= 0.5) | debconf-2.0, {+init-system-helpers (>= 1.18~),+} 
python3-attr (>= 16.0.0), python3-bcrypt, python3-daemonize, python3-frozendict 
(>= 1), python3-jsonschema (>= 2.5.1), [-python3-msgpack (>= 0.3.0),-] 
python3-netaddr (>= 0.7.18), python3-openssl
(>= 0.14), python3-phonenumbers, python3-pil, python3-prometheus-client, 
python3-psutil, python3-pyasn1 (>= 0.1.9), python3-pyasn1-modules, 
python3-service-identity (>= 1.0.0), [-python3-signedjson (>= 1.0.0),-] 
{+python3-signedjson,+} python3-six (>= 1.10), python3-sortedcontainers, 
python3-treq (>= 18), [-python3-unpaddedbase64 (>= 1.0.1),-] 
{+python3-unpaddedbase64,+} python3-yaml, python3:any {+(>= 3.3.2-2~)+}


Kurt

Bug#919764: octave-image FTBFS on big endian: test failures

[Adrian Bunk]

Source: octave-image
Version: 2.10.0-1
Severity: serious
Tags: ftbfs

https://buildd.debian.org/status/package.php?p=octave-image

Bug#919730: marked as done (lemonldap-ng: FTBFS (failing tests))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 12:04:29 +
with message-id 
and subject line Bug#919730: fixed in lemonldap-ng 2.0.1+ds-2
has caused the Debian Bug report #919730,
regarding lemonldap-ng: FTBFS (failing tests)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919730: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919730
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: src:lemonldap-ng
Version: 2.0.1+ds-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep --with systemd
   dh_update_autotools_config -i
   dh_autoreconf -i
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<>/lemonldap-ng-2.0.1+ds'
/usr/bin/make configure STORAGECONFFILE=/etc/lemonldap-ng/lemonldap-ng.ini \
PERLOPTIONS="INSTALLDIRS=vendor"
make[2]: Entering directory '/<>/lemonldap-ng-2.0.1+ds'
Checking if your kit is complete...
Looks good
Generating a Unix-style Makefile
Writing Makefile for Lemonldap::NG::Common
Writing MYMETA.yml and MYMETA.json

[... snipped ...]

make[2]: Entering directory 
'/<>/lemonldap-ng-2.0.1+ds/lemonldap-ng-common'
PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" 
"-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" 
t/*.t
t/01-Common-Conf.t . ok

#   Failed test 'File is  encoded'
#   at t/02-Common-Conf-File.t line 51.
Result: t/lmConf-1.json: JSON data


#   Failed test 'File is  encoded'
#   at t/02-Common-Conf-File.t line 51.
Result: t/lmConf-1.json: JSON data


#   Failed test 'File is  encoded'
#   at t/02-Common-Conf-File.t line 51.
Result: t/lmConf-1.json: JSON data

# Looks like you failed 3 tests of 14.
t/02-Common-Conf-File.t  
Dubious, test returned 3 (wstat 768, 0x300)
Failed 3/14 subtests 
t/03-Common-Conf-CDBI.t  ok
t/03-Common-Conf-RDBI.t  ok
t/05-Common-Conf-LDAP.t  ok
t/30-Common-Safelib.t .. ok
t/35-Common-Crypto.t ... ok
t/36-Common-Regexp.t ... ok
t/40-Common-Session.t .. ok
t/50-Combination-Parser.t .. ok
t/99-pod.t . ok

Test Summary Report
---
t/02-Common-Conf-File.t  (Wstat: 768 Tests: 14 Failed: 3)
  Failed tests:  4, 8, 12
  Non-zero exit status: 3
Files=11, Tests=191,  3 wallclock secs ( 0.11 usr  0.04 sys +  2.55 cusr  0.45 
csys =  3.15 CPU)
Result: FAIL
Failed 1/11 test programs. 3/191 subtests failed.
make[2]: *** [Makefile:973: test_dynamic] Error 255
make[2]: Leaving directory 
'/<>/lemonldap-ng-2.0.1+ds/lemonldap-ng-common'
make[1]: *** [Makefile:361: common_test] Error 2
make[1]: Leaving directory '/<>/lemonldap-ng-2.0.1+ds'
dh_auto_test: make -j1 test returned exit code 2
make: *** [debian/rules:20: build-indep] Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/lemonldap-ng.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.
--- End Message ---
--- Begin Message ---
Source: lemonldap-ng
Source-Version: 2.0.1+ds-2

We believe that the bug you reported is fixed in the latest version of
lemonldap-ng, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Xavier Guimard  (supplier of updated lemonldap-ng package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 12:32:57 +0100
Source: lemonldap-ng
Binary: lemonldap-ng lemonldap-ng-doc lemonldap-ng-fastcgi-server 
lemonldap-ng-uwsgi-app lemonldap-ng-handler liblemonldap-ng-handler-perl 
liblemonldap-ng-common-perl liblemonldap-ng-manager-perl 
liblemonldap-ng-portal-pe

Processed (with 1 error): forcibly merging 919527 919713

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> forcemerge 919527 919713
Bug #919527 [virtinst] Missing dependency against python3-distutils
Unable to merge bugs because:
package of #919713 is 'src:virt-manager' not 'virtinst'
Failed to forcibly merge 919527: Did not alter merged bugs.

> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919527: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919527
919713: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919713
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: Splitting into separate bugs for separate problems

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> severity 919555 serious
Bug #919555 [src:libemf] libemf: FTBFS on several architectures including arm64 
and s390x
Severity set to 'serious' from 'important'
> clone 919555 -1
Bug #919555 [src:libemf] libemf: FTBFS on several architectures including arm64 
and s390x
Bug 919555 cloned as bug 919766
> retitle 919555 libemf FTBFS on arm64: #error Unknown CPU architecture!
Bug #919555 [src:libemf] libemf: FTBFS on several architectures including arm64 
and s390x
Changed Bug title to 'libemf FTBFS on arm64: #error Unknown CPU architecture!' 
from 'libemf: FTBFS on several architectures including arm64 and s390x'.
> retitle -1 libemf FTBFS on big endian: FAIL: docheck2
Bug #919766 [src:libemf] libemf: FTBFS on several architectures including arm64 
and s390x
Changed Bug title to 'libemf FTBFS on big endian: FAIL: docheck2' from 'libemf: 
FTBFS on several architectures including arm64 and s390x'.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919555: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919555
919766: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919766
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919310: marked as done (kdiff3: ships documentation already in kdiff3-doc)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 12:34:34 +
with message-id 
and subject line Bug#919310: fixed in kdiff3 1.7.90-2
has caused the Debian Bug report #919310,
regarding kdiff3: ships documentation already in kdiff3-doc
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919310: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919310
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: kdiff3
Version: 1.7.90-1
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts
Control: affects -1 + kdiff3-doc

Hi,

during a test with piuparts I noticed your package failed to install
because it tries to overwrite other packages files.

>From the attached log (scroll to the bottom...):

  Selecting previously unselected package kdiff3-doc.
  Preparing to unpack .../kdiff3-doc_1.7.90-1_all.deb ...
  Unpacking kdiff3-doc (1.7.90-1) ...
  dpkg: error processing archive 
/var/cache/apt/archives/kdiff3-doc_1.7.90-1_all.deb (--unpack):
   trying to overwrite '/usr/share/doc/HTML/en/kdiff3/dirbrowser.png', which is 
also in package kdiff3 1.7.90-1
  dpkg-deb: error: paste subprocess was killed by signal (Broken pipe)
  Errors were encountered while processing:
   /var/cache/apt/archives/kdiff3-doc_1.7.90-1_all.deb

To ensure smooth upgrades from the buggy kdiff3 package, kdiff3-doc
should get appropriate Breaks+Replaces.

These files are currently shipped by both packages:

  usr/share/doc/HTML/en/kdiff3/dirbrowser.png
  usr/share/doc/HTML/en/kdiff3/dirmergebig.png
  usr/share/doc/HTML/en/kdiff3/index.cache.bz2
  usr/share/doc/HTML/en/kdiff3/index.docbook
  usr/share/doc/HTML/en/kdiff3/iteminfo.png
  usr/share/doc/HTML/en/kdiff3/letter_by_letter.png
  usr/share/doc/HTML/en/kdiff3/merge_current.png
  usr/share/doc/HTML/en/kdiff3/new.png
  usr/share/doc/HTML/en/kdiff3/open_dialog.png
  usr/share/doc/HTML/en/kdiff3/screenshot_diff.png
  usr/share/doc/HTML/en/kdiff3/screenshot_merge.png
  usr/share/doc/HTML/en/kdiff3/triple_diff.png
  usr/share/doc/HTML/en/kdiff3/white_space.png
  usr/share/doc/kdiff3-doc/html/credits.html
  usr/share/doc/kdiff3-doc/html/dirmerge.html
  usr/share/doc/kdiff3-doc/html/dirmergeoptions.html
  usr/share/doc/kdiff3-doc/html/dirmergevisible.html
  usr/share/doc/kdiff3-doc/html/documentation.html
  usr/share/doc/kdiff3-doc/html/dothemerge.html
  usr/share/doc/kdiff3-doc/html/faq.html
  usr/share/doc/kdiff3-doc/html/features.html
  usr/share/doc/kdiff3-doc/html/find.html
  usr/share/doc/kdiff3-doc/html/git.html
  usr/share/doc/kdiff3-doc/html/index.docbook
  usr/share/doc/kdiff3-doc/html/index.html
  usr/share/doc/kdiff3-doc/html/interpretinginformation.html
  usr/share/doc/kdiff3-doc/html/introduction.html
  usr/share/doc/kdiff3-doc/html/kpart.html
  usr/share/doc/kdiff3-doc/html/merging.html
  usr/share/doc/kdiff3-doc/html/misc.html
  usr/share/doc/kdiff3-doc/html/navigation.html
  usr/share/doc/kdiff3-doc/html/opendialog.html
  usr/share/doc/kdiff3-doc/html/options.html
  usr/share/doc/kdiff3-doc/html/other.html
  usr/share/doc/kdiff3-doc/html/pasteinput.html
  usr/share/doc/kdiff3-doc/html/preprocessors.html
  usr/share/doc/kdiff3-doc/html/printing.html
  usr/share/doc/kdiff3-doc/html/saving.html
  usr/share/doc/kdiff3-doc/html/screenshots.html
  usr/share/doc/kdiff3-doc/html/selections.html
  usr/share/doc/kdiff3-doc/html/startingdirmerge.html


cheers,

Andreas


kdiff3=1.7.90-1_kdiff3-doc=1.7.90-1.log.gz
Description: application/gzip
--- End Message ---
--- Begin Message ---
Source: kdiff3
Source-Version: 1.7.90-2

We believe that the bug you reported is fixed in the latest version of
kdiff3, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Eike Sauer  (supplier of updated kdiff3 package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sat, 19 Jan 2019 12:12:00 +0100
Source: kdiff3
Binary: kdiff3 kdiff3-qt kdiff3-doc
Architecture: source amd64 all
Version: 1.7.90-2
Distribution: unstable
Urgency: low
Maintainer: Eike Sauer 
Changed-By: Eike Sauer 
Description:
 kdiff3 - compares and merges 2 or 3 files or directories
 

Bug#919768: squidguard: frequent parallel FTBFS

[Adrian Bunk]

Source: squidguard
Version: 1.5-7
Severity: serious
Tags: ftbfs

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/arm64/squidguard.html

...
sg.l: In function 'yylex':
sg.l:90:8: error: 'START_BRACKET' undeclared (first use in this function); did 
you mean 'SOCK_PACKET'?
 "}" return STOP_BRACKET;
^
SOCK_PACKET
sg.l:90:8: note: each undeclared identifier is reported only once for each 
function it appears in
sg.l:91:8: error: 'STOP_BRACKET' undeclared (first use in this function); did 
you mean 'SOL_PACKET'?
 ^destreturn DESTINATION;
^~~~
SOL_PACKET
...


https://buildd.debian.org/status/fetch.php?pkg=squidguard&arch=s390x&ver=1.5-7&stamp=1546505416&raw=0

...
   dh_auto_test -a
make -j2 test VERBOSE=1
make[1]: Entering directory '/<>'
making test in squidguard-1.5
(cd test && make  test)
make[2]: Entering directory '/<>/test'
test1..
test2..
Database size:
Database size:
  5643 blacklist/domains
  7442 blacklist/urls
 13085 total
  5643 blacklist/domains
  7442 blacklist/urls
 3 blacklist/expressions
 13088 total
Running test1 with 1005 requests..Running test2 with 1005 requests..2019-01-03 
08:50:12 [12657] ../src/squidGuard: can't write to logfile 
/var/log/squidguard/squidGuard.log
2019-01-03 08:50:12 [12657] INFO: New setting: logdir: /<>/test
2019-01-03 08:50:12 [12657] INFO: New setting: dbhome: /<>/test
2019-01-03 08:50:12 [12657] Added User: foo
2019-01-03 08:50:12 [12657] Added User: bar
2019-01-03 08:50:12 [12657] init domainlist 
/<>/test/blacklist/domains
2019-01-03 08:50:12 [12661] ../src/squidGuard: can't write to logfile 
/var/log/squidguard/squidGuard.log
2019-01-03 08:50:12 [12661] INFO: New setting: logdir: /<>/test
2019-01-03 08:50:12 [12661] INFO: New setting: dbhome: /<>/test
2019-01-03 08:50:12 [12657] init urllist /<>/test/blacklist/urls
2019-01-03 08:50:12 [12661] Added User: foo
2019-01-03 08:50:12 [12661] Added User: bar
2019-01-03 08:50:12 [12661] init domainlist 
/<>/test/blacklist/domains
2019-01-03 08:50:12 [12661] init urllist /<>/test/blacklist/urls
2019-01-03 08:50:12 [12661] init expressionlist 
/<>/test/blacklist/expressions
.Done
Checking number of output lines..
.OK
Checking the output against the expected..
make[2]: [Makefile:42: test1] Error 1 (ignored)
.OK
squidGuard initialization took 0.013 seconds
squidGuard handled 1005 requests in 0.001 seconds

benchmark..
Database size:
  5643 blacklist/domains
  7442 blacklist/urls
 13085 total
Running benchmark test with 100500 requests..2019-01-03 08:50:12 [12686] 
../src/squidGuard: can't write to logfile /var/log/squidguard/squidGuard.log
2019-01-03 08:50:12 [12686] INFO: New setting: logdir: /<>/test
2019-01-03 08:50:12 [12686] INFO: New setting: dbhome: /<>/test
2019-01-03 08:50:12 [12686] Added User: foo
2019-01-03 08:50:12 [12686] Added User: bar
2019-01-03 08:50:12 [12686] init domainlist 
/<>/test/blacklist/domains
.Done
Checking number of output lines..
.OK
Checking the output against the expected..
make[2]: [Makefile:42: test2] Error 1 (ignored)
.OK
awk: cannot open squidGuard.log (No such file or directory)
make[2]: *** [Makefile:44: test2] Error 2


dh compat 10 defaults to parallel building.

Ideally the Makefiles should be fixed, but if this is not
easily possible the previous default of non-parallel building
can be restored by passing --no-parallel to dh.

Bug#919398: marked as done (nim FTBFS on big endian)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 12:51:33 +
with message-id 
and subject line Bug#919398: fixed in nim 0.19.2-2
has caused the Debian Bug report #919398,
regarding nim FTBFS on big endian
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919398: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919398
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: nim
Version: 0.19.2-1
Severity: serious
Tags: ftbfs

https://buildd.debian.org/status/package.php?p=nim

...
Hint:  [Link]
Hint: operation successful (30380 lines compiled; 8.532 sec total; 31.883MiB 
peakmem; Debug Build) [SuccessX]
Hint: /<>/.cache/nim/times_d/runnableExamples/times_examples6  
[Exec]
times_examples6.nim(5)   times_examples6
system.nim(3877) failedAssertImpl
system.nim(3870) raiseAssert
system.nim(2916) sysFatal
Error: unhandled exception: 
/<>/.cache/nim/times_d/runnableExamples/times_examples6.nim(5, 12) 
`$utc(fromUnix(0)) == "1970-01-01T00:00:00Z"`  [AssertionError]
Error: execution of an external program failed: 
'/<>/.cache/nim/times_d/runnableExamples/times_examples6 '
[Examples] failed: see 
/<>/.cache/nim/times_d/runnableExamples/times_examples6.nim

make[1]: *** [debian/rules:30: override_dh_auto_build] Error 1
--- End Message ---
--- Begin Message ---
Source: nim
Source-Version: 0.19.2-2

We believe that the bug you reported is fixed in the latest version of
nim, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Federico Ceratto  (supplier of updated nim package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Thu, 17 Jan 2019 22:21:08 +
Source: nim
Binary: nim nim-doc
Architecture: source
Version: 0.19.2-2
Distribution: unstable
Urgency: medium
Maintainer: Federico Ceratto 
Changed-By: Federico Ceratto 
Description:
 nim- Nim programming language - compiler
 nim-doc- Nim programming language - documentation
Closes: 919398
Changes:
 nim (0.19.2-2) unstable; urgency=medium
 .
   * Remove MIPS arch (Closes: #919398)
Checksums-Sha1:
 6be7c18d7892eed668cc3d677508baa6bd5d2378 2004 nim_0.19.2-2.dsc
 7e065c7eea4782061b4ff5db967f5c9efcf772c4 10296 nim_0.19.2-2.debian.tar.xz
 540ec2f72b9cfe8fcaf8cc97864c3c406247baff 5827 nim_0.19.2-2_amd64.buildinfo
Checksums-Sha256:
 0e13b81b08a05f0da1c67b49b209345c222c4936dbee2c7541a7b08de777376a 2004 
nim_0.19.2-2.dsc
 8e9e3874976f73d6cf1019d99c1ec580355f729d6324a33c0a99b84add5ae077 10296 
nim_0.19.2-2.debian.tar.xz
 51755728569f1a35ae59bf2fa60fdee8853ed1cdcc3e5da6413cdaba77b2da16 5827 
nim_0.19.2-2_amd64.buildinfo
Files:
 9bb43e94cabb43d43fd977eddfa040bc 2004 devel optional nim_0.19.2-2.dsc
 4bb98bbd54447bc47d28950e9715d0e6 10296 devel optional 
nim_0.19.2-2.debian.tar.xz
 6092cca9322c2a3f1b9906cea36c0815 5827 devel optional 
nim_0.19.2-2_amd64.buildinfo

-BEGIN PGP SIGNATURE-

iQIzBAEBCgAdFiEEfKfd+zM5IUCMbyuWbzG8RPUXfaoFAlxDGX8ACgkQbzG8RPUX
farTiBAAn83UPkiz2vHu99yJK4cCtg6cYEMJlml8ipEPdNGfhebXle3+xFZyywBX
ss8Az3UDLpgPLGaEmSU3zHl7OKHjp7lZS0RUJzMrWdSf0kFClUgRwZpLdF0TXXrT
SbfWFTqQu1CY1fVlul+ZIof4eORp+t80psVbrCDnveJv/J8Kq/nRmbQQQ4jvHa8g
Pi4Dg1Pjrp01OZqWoOSmYwEAbCqb9vYufiOdHkTm7hfzt0Twk6WE9sNFfRji08XX
hSNnvNSEevJFNmxbFcVbugeKdQEmHrZ29Hir64cYPEXrwV/Ig4VT9wxSvG9uhKIf
y3f1VFP/KVB9UfnUSnx8yTuadLPr/jdSxNsDC46Ynk2yVPLIHUx2WmTAgIhVDc/s
cKupRS3jf7vedqTTZ8SyWDJR2z1ak+MmPl8U3YOCinecotWjwylXoBlkRrXB0Tg8
Dml4vn4BSlGsRltDuClCd6FkZ4HXc8NUdkNfMvvS0e18fRfC8kuPfCaytiduNHkD
DF5XmeNg7QJzxVBb/nGlNhMIJ+/3F9rDVEq2v7EIHc4HJqUIBPU1oIb2DwTfcMQc
xQs2w+vfapOWUvaXe3u2EMBu979BnTNjTl6J1fDsyccpSoh/oPjMH/7e7lbd+ci3
9AZiLnzJacL6lEoaXPbun2wGReeKx243oVc/A9M9CE905fFcdcc=
=YG4h
-END PGP SIGNATURE End Message ---

Bug#919769: firefox-esr: OB Firefox 60.4 crashes immediately on amrhf (Raspberry Pi)

[Samuel Lindner]

Package: firefox-esr
Version: 60.4.0esr-1~deb9u1
Severity: grave
Justification: renders package unusable

Dear Maintainer,

I have freshly installed Debian on a Raspberry Pi 3 with XFCE.
After starting firefox-esr it crashes instantly even when running in safe-mode 
or headless.
It produces the following error messages:

ExceptionHandler::GenerateDump cloned child 5256
ExceptionHandler::WaitForContinueSignal waiting for continue signal...
ExceptionHandler::SendContinueSignalToChild sent continue signal to child

The bug appears to be similar to #908396 (https://bugs.debian.org/908396),
which is reported to be closed.


Here is the backtrace:
Starting program: /usr/bin/firefox-esr 
[Thread debugging using libthread_db enabled]
Using host libthread_db library "/lib/arm-linux-gnueabihf/libthread_db.so.1".
[New Thread 0x712ec450 (LWP 5352)]
[Thread 0x712ec450 (LWP 5352) exited]
[New Thread 0x712ec450 (LWP 5354)]
[New Thread 0x6d4ff450 (LWP 5355)]
[New Thread 0x6ccff450 (LWP 5356)]
[New Thread 0x6c4ff450 (LWP 5357)]
[New Thread 0x6bbff450 (LWP 5358)]
[New Thread 0x6b3ff450 (LWP 5359)]
[New Thread 0x6b1ff450 (LWP 5360)]
[New Thread 0x6afff450 (LWP 5361)]
[New Thread 0x6adff450 (LWP 5362)]
[New Thread 0x6a6ff450 (LWP 5363)]
[New Thread 0x6a4ff450 (LWP 5364)]
[New Thread 0x6a2ff450 (LWP 5365)]
[New Thread 0x69aff450 (LWP 5366)]
[New Thread 0x6926d450 (LWP 5374)]
[New Thread 0x68a6d450 (LWP 5375)]
[New Thread 0x67fff450 (LWP 5376)]
[New Thread 0x6826d450 (LWP 5378)]
[New Thread 0x677ff450 (LWP 5379)]

Thread 1 "firefox-esr" received signal SIGSEGV, Segmentation fault.


0x73a22aba in ?? () from /usr/lib/firefox-esr/libxul.so
#0  0x73a22aba in ?? () from /usr/lib/firefox-esr/libxul.so
No symbol table info available.
#1  0x73a22a8e in ?? () from /usr/lib/firefox-esr/libxul.so
No symbol table info available.
Backtrace stopped: previous frame identical to this frame (corrupt stack?)

-- Package-specific info:


-- Addons package information

-- System Information:
Distributor ID: Raspbian
Description:Raspbian GNU/Linux 9.6 (stretch)
Release:9.6
Codename:   stretch
Architecture: armv7l

Kernel: Linux 4.14.79-v7+ (SMP w/4 CPU cores)
Locale: LANG=de_DE.UTF-8, LC_CTYPE=de_DE.UTF-8 (charmap=UTF-8), 
LANGUAGE=de_DE.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages firefox-esr depends on:
ii  debianutils   4.8.1.1
ii  fontconfig2.11.0-6.7+b1
ii  libasound21.1.3-5+rpi3
ii  libatk1.0-0   2.22.0-1
ii  libc6 2.24-11+deb9u3
ii  libcairo-gobject2 1.14.8-1+rpi1
ii  libcairo2 1.14.8-1+rpi1
ii  libdbus-1-3   1.10.26-0+deb9u1
ii  libdbus-glib-1-2  0.108-2
ii  libffi6   3.2.1-6
ii  libfontconfig12.11.0-6.7+b1
ii  libfreetype6  2.6.3-3.2
ii  libgcc1   1:6.3.0-18+rpi1+deb9u1
ii  libgdk-pixbuf2.0-02.36.5-2+deb9u2
ii  libglib2.0-0  2.50.3-2
ii  libgtk-3-03.22.11-1+rpi3
ii  libjsoncpp1   1.7.4-3
ii  libpango-1.0-01.40.5-1
ii  libstartup-notification0  0.12-4+b2
ii  libstdc++66.3.0-18+rpi1+deb9u1
ii  libvpx4   1.6.1-3+deb9u1
ii  libx11-6  2:1.6.4-3+deb9u1
ii  libx11-xcb1   2:1.6.4-3+deb9u1
ii  libxcb-shm0   1.12-1
ii  libxcb1   1.12-1
ii  libxcomposite11:0.4.4-2
ii  libxdamage1   1:1.1.4-2+b3
ii  libxext6  2:1.3.3-1+b2
ii  libxfixes31:5.0.3-1
ii  libxrender1   1:0.9.10-1
ii  libxt61:1.1.5-1
ii  procps2:3.3.12-3+deb9u1
ii  zlib1g1:1.2.8.dfsg-5

Versions of packages firefox-esr recommends:
ii  libavcodec57  7:3.2.12-1~deb9u1

Versions of packages firefox-esr suggests:
pn  fonts-lmodern  
pn  fonts-stix | otf-stix  
ii  libcanberra0   0.30-3+b2
ii  libgssapi-krb5-2   1.15-1+deb9u1
ii  libgtk2.0-02.24.31-2
ii  pulseaudio 10.0-1+deb9u1

-- no debconf information

Bug#919527: marked as done (Missing dependency against python3-distutils)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 13:23:19 +
with message-id 
and subject line Bug#919527: fixed in virt-manager 1:2.0.0-3
has caused the Debian Bug report #919527,
regarding Missing dependency against python3-distutils
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919527: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919527
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: virtinst
Version: 1:2.0.0-2
Severity: serious

Hi,

The regression tests are currently failing because the virtinst is
missing a dependency against python3-distutils:

autopkgtest [04:39:33]: test help.sh:  - - - - - - - - - - stderr - - - - - - - 
- - -
Traceback (most recent call last):
  File "/usr/share/virt-manager/virt-convert", line 19, in 
from virtconv import VirtConverter
  File "/usr/share/virt-manager/virtconv/__init__.py", line 10, in 
from virtconv.formats import VirtConverter
  File "/usr/share/virt-manager/virtconv/formats.py", line 10, in 
from distutils.spawn import find_executable
ModuleNotFoundError: No module named 'distutils.spawn'

https://ci.debian.net/data/autopkgtest/testing/amd64/v/virt-manager/1712093/log.gz

Could you please add the needed dependency?

Kind regards,

Laurent Bigonville

-- System Information:
Debian Release: buster/sid
  APT prefers unstable-debug
  APT policy: (500, 'unstable-debug'), (500, 'unstable'), (1, 
'experimental-debug'), (1, 'experimental')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 4.19.0-1-amd64 (SMP w/8 CPU cores)
Locale: LANG=fr_BE.UTF-8, LC_CTYPE=fr_BE.UTF-8 (charmap=UTF-8), 
LANGUAGE=fr_BE.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /usr/bin/dash
Init: systemd (via /run/systemd/system)
LSM: SELinux: enabled - Mode: Permissive - Policy name: refpolicy

Versions of packages virtinst depends on:
ii  e2fsprogs 1.44.5-1
ii  genisoimage   9:1.1.11-3+b2
ii  gir1.2-libosinfo-1.0  1.2.0-1
ii  python3   3.7.1-3
ii  python3-gi3.30.4-1
ii  python3-libvirt   4.10.0-1
ii  python3-libxml2   2.9.4+dfsg1-7+b3
ii  python3-requests  2.20.0-2

Versions of packages virtinst recommends:
ii  qemu-utils   1:3.1+dfsg-2+b1
ii  virt-viewer  7.0-1

virtinst suggests no packages.

-- no debconf information
--- End Message ---
--- Begin Message ---
Source: virt-manager
Source-Version: 1:2.0.0-3

We believe that the bug you reported is fixed in the latest version of
virt-manager, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Guido Günther  (supplier of updated virt-manager package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sat, 19 Jan 2019 13:30:01 +0100
Source: virt-manager
Binary: virt-manager virtinst
Architecture: source
Version: 1:2.0.0-3
Distribution: unstable
Urgency: medium
Maintainer: Debian Libvirt Maintainers 

Changed-By: Guido Günther 
Description:
 virt-manager - desktop application for managing virtual machines
 virtinst   - Programs to create and clone virtual machines
Closes: 919527 919713
Changes:
 virt-manager (1:2.0.0-3) unstable; urgency=medium
 .
   * Mark autopkgtest scripts executable
   * d/control: Depend on python3-distutils.
 (Closes: #919527, #919713)
Checksums-Sha1:
 2eda24d579926132f27d471ec6566a7828b55c15 2294 virt-manager_2.0.0-3.dsc
 45d6a9320faf7f9abfaadacf87bc00b1bc38fd5f 14108 
virt-manager_2.0.0-3.debian.tar.xz
 ac98a981b504c10c687117389e3344ba8b49e500 10054 
virt-manager_2.0.0-3_amd64.buildinfo
Checksums-Sha256:
 8e4cd72ae79d0f3f977388c230b964f644d944e288fa721951a1b0eaf5739b27 2294 
virt-manager_2.0.0-3.dsc
 2d8a87308ddb0e02e0929783d436e6195c37212b11eaef15b7219b0360931a75 14108 
virt-manager_2.0.0-3.debian.tar.xz
 980664b7850bcbf4610992d18f1c03ad0b0f6232323340fde2f84558bacc22a3 10054 
virt-manager_2.0.0-3_amd64.buildinfo
Files:
 66fe425d8c0ff9290628bfe8703805a4 2294 admin optional virt-manager_2.0.0-3.dsc
 684d1e37143b111e0a08e56b40dbd36a 14108 admin optional 
virt-manager_2.0.0-3.debian.tar.xz
 4146b0d63a951eb66a45d5cafbadd999 10054 admin optional 
virt-manager_2.0.0-3_amd64.bui

Bug#919773: libdbd-sqlite3-perl FTBFS on mips: test failure

[Adrian Bunk]

Source: libdbd-sqlite3-perl
Version: 1.62-1
Severity: serious
Tags: ftbfs

https://buildd.debian.org/status/fetch.php?pkg=libdbd-sqlite3-perl&arch=mips&ver=1.62-1&stamp=1546291045&raw=0

...
t/65_db_config.t .. 
1..79
ok 1 - An object of class 'DBI::db' isa 'DBI::db'
ok 2 - LOOKASIDE is not supported
ok 3
ok 4 - An object of class 'DBI::db' isa 'DBI::db'
ok 5 - LOOKASIDE is not supported
ok 6
ok 7 - An object of class 'DBI::db' isa 'DBI::db'
ok 8 - MAINDBNAME is not supported
ok 9
ok 10 - An object of class 'DBI::db' isa 'DBI::db'
ok 11 - MAINDBNAME is not supported
ok 12
ok 13 - An object of class 'DBI::db' isa 'DBI::db'
ok 14 - enable foreign key
ok 15 - disable foreign key
ok 16 - An object of class 'DBI::db' isa 'DBI::db'
ok 17 - enable foreign key
ok 18 - disable foreign key
ok 19 - An object of class 'DBI::db' isa 'DBI::db'
ok 20 - enable trigger
ok 21 - disable trigger
ok 22 - An object of class 'DBI::db' isa 'DBI::db'
ok 23 - enable trigger
ok 24 - disable trigger
ok 25 - An object of class 'DBI::db' isa 'DBI::db'
ok 26 - enable fts3_tokenizer
ok 27 - disable fts3_tokenizer
ok 28 - An object of class 'DBI::db' isa 'DBI::db'
ok 29 - enable fts3_tokenizer
ok 30 - disable fts3_tokenizer
ok 31 - An object of class 'DBI::db' isa 'DBI::db'
ok 32 - enable load_extension
ok 33 - disable load_extension
ok 34 - An object of class 'DBI::db' isa 'DBI::db'
ok 35 - enable load_extension
ok 36 - disable load_extension
ok 37 - An object of class 'DBI::db' isa 'DBI::db'
ok 38 - no checkpoint on close
ok 39 - checkpoint on close
ok 40 - An object of class 'DBI::db' isa 'DBI::db'
ok 41 - no checkpoint on close
ok 42 - checkpoint on close
ok 43 - An object of class 'DBI::db' isa 'DBI::db'
ok 44 - enable query planner stability guarantee
ok 45 - disable query planner stability guarantee
ok 46 - An object of class 'DBI::db' isa 'DBI::db'
ok 47 - enable query planner stability guarantee
ok 48 - disable query planner stability guarantee
ok 49 - An object of class 'DBI::db' isa 'DBI::db'
ok 50 - trigger explain query plan
ok 51 - no trigger explain query plan
ok 52 - An object of class 'DBI::db' isa 'DBI::db'
ok 53 - trigger explain query plan
ok 54 - no trigger explain query plan
ok 55 - An object of class 'DBI::db' isa 'DBI::db'
ok 56 - enable reset database
ok 57 - disable reset database
ok 58 - An object of class 'DBI::db' isa 'DBI::db'
ok 59 - enable reset database
ok 60 - disable reset database
ok 61 - An object of class 'DBI::db' isa 'DBI::db'
ok 62 - found sql
ok 63
ok 64 - updating sqlite_master is prohibited
ok 65
ok 66
ok 67 - updating sqlite_master is succeeded
ok 68 - sql not found
ok 69 - An object of class 'DBI::db' isa 'DBI::db'
ok 70 - found sql
ok 71
ok 72 - updating sqlite_master is prohibited
ok 73
ok 74
ok 75 - updating sqlite_master is succeeded
ok 76 - sql not found
Failed 3/79 subtests
...
Test Summary Report
---
t/65_db_config.t(Wstat: 11 Tests: 76 
Failed: 0)
  Non-zero wait status: 11
  Parse errors: Bad plan.  You planned 79 tests but ran 76.
Files=111, Tests=3794, 61 wallclock secs ( 2.80 usr  0.48 sys + 48.42 cusr  
4.10 csys = 55.80 CPU)
Result: FAIL
Failed 1/111 test programs. 0/3794 subtests failed.
make[1]: *** [Makefile:1086: test_dynamic] Error 255

Bug#919293: [pkg-gnupg-maint] Bug#919293: FTBFS: Test keys expired 2019-01-06

[Roger Shimizu]

user debian-rele...@lists.debian.org
usertag -1 + bsp-2019-01-jp-tokyo
thanks

On Tue, Jan 15, 2019 at 2:03 AM Julian Andres Klode  wrote:
>
> Source: gpgme1.0
> Severity: serious
> User: ubuntu-de...@lists.ubuntu.com
> Usertags: origin-ubuntu disco
>
> See https://dev.gnupg.org/T3815 and
> https://git.gnupg.org/cgi-bin/gitweb.cgi?p=gpgme.git;a=commit;h=66376f3e206a1aa791d712fb8577bb3490268f60

I'm trying to see this issue in Tokyo BSP 2019/January.
- https://wiki.debian.org/BSP/2019/01/ja/Tokyo

This issue can be reproduced under my ARCH=i386 git-pbuilder environment:
  gbp buildpackage --git-pristine-tar --git-pbuilder

However it cannot be reproduced under simple git-buildpackage command
in stretch:
  gbp buildpackage -us -uc --git-pristine-tar

I'll try to dig more later.

Cheers,
-- 
Roger Shimizu, GMT +9 Tokyo
PGP/GPG: 4096R/6C6ACD6417B3ACB1

Processed: Re: Bug#917130: gimp: crashes at start: segmentation fault in g_slice_alloc() (memory corruption?)

[Debian Bug Tracking System]

Processing control commands:

> reassign -1 src:openexr 2.3.0-1
Bug #917130 [gimp] libIlmImf-2_2.so.23: cannot open shared object file
Bug reassigned from package 'gimp' to 'src:openexr'.
No longer marked as found in versions gimp/2.10.8-1.
Ignoring request to alter fixed versions of bug #917130 to the same values 
previously set
Bug #917130 [src:openexr] libIlmImf-2_2.so.23: cannot open shared object file
Marked as found in versions openexr/2.3.0-1.
> affects -1 libopenexr23 gimp
Bug #917130 [src:openexr] libIlmImf-2_2.so.23: cannot open shared object file
Added indication that 917130 affects libopenexr23 and gimp
> close -1 2.3.0-4
Bug #917130 [src:openexr] libIlmImf-2_2.so.23: cannot open shared object file
Marked as fixed in versions openexr/2.3.0-4.
Bug #917130 [src:openexr] libIlmImf-2_2.so.23: cannot open shared object file
Marked Bug as done

-- 
917130: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917130
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#917130: gimp: crashes at start: segmentation fault in g_slice_alloc() (memory corruption?)

[Adrian Bunk]

Control: reassign -1 src:openexr 2.3.0-1
Control: affects -1 libopenexr23 gimp
Control: close -1 2.3.0-4

On Sun, Jan 06, 2019 at 12:55:13AM +0800, 積丹尼 Dan Jacobson wrote:
> retitle 917130 libIlmImf-2_2.so.23: cannot open shared object file
> thanks
> 
> On my other machine gimp starts, but is in an ugly grey color.
> Let's clean up these warnings first,
> 
> # su - nobody -c "DISPLAY=$DISPLAY HOME=/tmp/ gimp"&
> GEGL-Message: 00:12:37.527: Module 
> '/usr/lib/x86_64-linux-gnu/gegl-0.4/exr-save.so' load error: 
> libIlmImf-2_2.so.23: cannot open shared object file: No such file or directory
> GEGL-Message: 00:12:37.926: Module 
> '/usr/lib/x86_64-linux-gnu/gegl-0.4/exr-load.so' load error: 
> libIlmImf-2_2.so.23: cannot open shared object file: No such file or directory
> And many
> (gimp:1448): Gtk-WARNING **: 00:12:40.336: Unable to locate theme engine in 
> module_path: "pixmap",
> And
> /usr/lib/gimp/2.0/plug-ins/file-exr/file-exr: error while loading shared 
> libraries: libIlmImf-2_2.so.23: cannot open shared object file: No such file 
> or directory
> gimp: LibGimpBase-WARNING: gimp: gimp_wire_read(): error
> 
> $ dlocate libIlmImf
> libopenexr23:amd64: /usr/lib/x86_64-linux-gnu/libIlmImf-2_3.so.24.0.0
> libopenexr23:amd64: /usr/lib/x86_64-linux-gnu/libIlmImfUtil-2_3.so.24.0.0
> libopenexr23:amd64: /usr/lib/x86_64-linux-gnu/libIlmImf-2_3.so.24
> libopenexr23:amd64: /usr/lib/x86_64-linux-gnu/libIlmImfUtil-2_3.so.24
> $ aptitude search libopenexr
> p   libopenexr-dev - development 
> files for the OpenEXR image library
> i A libopenexr23   - runtime files 
> for the OpenEXR image library
> p   libopenexr24   - runtime files 
> for the OpenEXR image library
> $ apt-cache policy libopenexr23
> libopenexr23:
>   Installed: 2.3.0-3
>   Candidate: 2.3.0-3
>   Version table:
>  *** 2.3.0-3 990
> 990 http://opensource.nchc.org.tw/debian experimental/main amd64 
> Packages
> 100 /var/lib/dpkg/status
>  2.2.1-4 500
> 500 http://opensource.nchc.org.tw/debian unstable/main amd64 Packages
> # aptitude install libopenexr23=2.2.1-4
> The following packages will be DOWNGRADED:
>   libopenexr23  
> # su - nobody -c "DISPLAY=$DISPLAY HOME=/tmp/ gimp"&
> GEGL-Message: 00:49:09.357: Module 
> '/usr/lib/x86_64-linux-gnu/gegl-0.4/exr-save.so' load error: 
> libImath-2_2.so.23: cannot open shared object file: No such file or directory
> GEGL-Message: 00:49:09.387: Module 
> '/usr/lib/x86_64-linux-gnu/gegl-0.4/exr-load.so' load error: 
> libImath-2_2.so.23: cannot open shared object file: No such file or directory
> and
> /usr/lib/gimp/2.0/plug-ins/file-exr/file-exr: error while loading shared 
> libraries: libIex-2_2.so.23: cannot open shared object file: No such file or 
> directory
> 
> Now the message becomes libImath and libIex.
>...

Thanks for the update, I'm moving this bug to the package where it was fixed.

cu
Adrian

-- 

   "Is there not promise of rain?" Ling Tan asked suddenly out
of the darkness. There had been need of rain for many days.
   "Only a promise," Lao Er said.
   Pearl S. Buck - Dragon Seed

Bug#919773: libdbd-sqlite3-perl FTBFS on mips: test failure

[Xavier]

Le 19/01/2019 à 14:44, Adrian Bunk a écrit :
> Source: libdbd-sqlite3-perl
> Version: 1.62-1
> Severity: serious
> Tags: ftbfs
> 
> https://buildd.debian.org/status/fetch.php?pkg=libdbd-sqlite3-perl&arch=mips&ver=1.62-1&stamp=1546291045&raw=0
> 
> ...
> t/65_db_config.t .. 
> 1..79
> ok 1 - An object of class 'DBI::db' isa 'DBI::db'
> ok 2 - LOOKASIDE is not supported
> ok 3
> ok 4 - An object of class 'DBI::db' isa 'DBI::db'
> ok 5 - LOOKASIDE is not supported
> ok 6
> ok 7 - An object of class 'DBI::db' isa 'DBI::db'
> ok 8 - MAINDBNAME is not supported
> ok 9
> ok 10 - An object of class 'DBI::db' isa 'DBI::db'
> ok 11 - MAINDBNAME is not supported
> ok 12
> ok 13 - An object of class 'DBI::db' isa 'DBI::db'
> ok 14 - enable foreign key
> ok 15 - disable foreign key
> ok 16 - An object of class 'DBI::db' isa 'DBI::db'
> ok 17 - enable foreign key
> ok 18 - disable foreign key
> ok 19 - An object of class 'DBI::db' isa 'DBI::db'
> ok 20 - enable trigger
> ok 21 - disable trigger
> ok 22 - An object of class 'DBI::db' isa 'DBI::db'
> ok 23 - enable trigger
> ok 24 - disable trigger
> ok 25 - An object of class 'DBI::db' isa 'DBI::db'
> ok 26 - enable fts3_tokenizer
> ok 27 - disable fts3_tokenizer
> ok 28 - An object of class 'DBI::db' isa 'DBI::db'
> ok 29 - enable fts3_tokenizer
> ok 30 - disable fts3_tokenizer
> ok 31 - An object of class 'DBI::db' isa 'DBI::db'
> ok 32 - enable load_extension
> ok 33 - disable load_extension
> ok 34 - An object of class 'DBI::db' isa 'DBI::db'
> ok 35 - enable load_extension
> ok 36 - disable load_extension
> ok 37 - An object of class 'DBI::db' isa 'DBI::db'
> ok 38 - no checkpoint on close
> ok 39 - checkpoint on close
> ok 40 - An object of class 'DBI::db' isa 'DBI::db'
> ok 41 - no checkpoint on close
> ok 42 - checkpoint on close
> ok 43 - An object of class 'DBI::db' isa 'DBI::db'
> ok 44 - enable query planner stability guarantee
> ok 45 - disable query planner stability guarantee
> ok 46 - An object of class 'DBI::db' isa 'DBI::db'
> ok 47 - enable query planner stability guarantee
> ok 48 - disable query planner stability guarantee
> ok 49 - An object of class 'DBI::db' isa 'DBI::db'
> ok 50 - trigger explain query plan
> ok 51 - no trigger explain query plan
> ok 52 - An object of class 'DBI::db' isa 'DBI::db'
> ok 53 - trigger explain query plan
> ok 54 - no trigger explain query plan
> ok 55 - An object of class 'DBI::db' isa 'DBI::db'
> ok 56 - enable reset database
> ok 57 - disable reset database
> ok 58 - An object of class 'DBI::db' isa 'DBI::db'
> ok 59 - enable reset database
> ok 60 - disable reset database
> ok 61 - An object of class 'DBI::db' isa 'DBI::db'
> ok 62 - found sql
> ok 63
> ok 64 - updating sqlite_master is prohibited
> ok 65
> ok 66
> ok 67 - updating sqlite_master is succeeded
> ok 68 - sql not found
> ok 69 - An object of class 'DBI::db' isa 'DBI::db'
> ok 70 - found sql
> ok 71
> ok 72 - updating sqlite_master is prohibited
> ok 73
> ok 74
> ok 75 - updating sqlite_master is succeeded
> ok 76 - sql not found
> Failed 3/79 subtests
> ...
> Test Summary Report
> ---
> t/65_db_config.t(Wstat: 11 Tests: 76 
> Failed: 0)
>   Non-zero wait status: 11
>   Parse errors: Bad plan.  You planned 79 tests but ran 76.
> Files=111, Tests=3794, 61 wallclock secs ( 2.80 usr  0.48 sys + 48.42 cusr  
> 4.10 csys = 55.80 CPU)
> Result: FAIL
> Failed 1/111 test programs. 0/3794 subtests failed.
> make[1]: *** [Makefile:1086: test_dynamic] Error 255
> 
> ___
> pkg-perl-maintainers mailing list
> pkg-perl-maintain...@alioth-lists.debian.net
> https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/pkg-perl-maintainers
> 

I think the failure is here. I'm testing

diff --git a/t/65_db_config.t b/t/65_db_config.t
index 6820736..1e336cf 100644
--- a/t/65_db_config.t
+++ b/t/65_db_config.t
@@ -211,7 +211,7 @@ for my $func (@CALL_FUNCS) {

 # DEFENSIVE at connection
 SKIP: {
-skip 'DEFENSIVE is not supported', 8 if !SQLITE_DBCONFIG_DEFENSIVE;
+skip 'DEFENSIVE is not supported', 3 if !SQLITE_DBCONFIG_DEFENSIVE;
 my $dbh = connect_ok(RaiseError => 1, PrintError => 0,
sqlite_defensive => 1);

 my $sql = 'CREATE TABLE foo (id, text)';

Bug#917117: grub-efi-amd64-signed: doesn't mount cryptodisk

[Alexander Batischev]

Hi, sorry it took me a while to respond.

On Sat, Jan 12, 2019 at 10:53:37AM +, Colin Watson wrote:

Could you please see if 2.02+dfsg1-10 fixes this?


Both grub-efi-amd64 and -signed are now in testing, but they don't fix 
the issue. When I upgraded, my /boot/efi/EFI/debian/grub.cfg was 
rewritten with insmod and cryptomount commands removed.



A couple of people
pointed out that I forgot to add the luks module to the output of
build-efi-images, which may have caused this.


I might be misunderstanding you because I don't know anything about 
build-efi-images, but: to me the problem appears to be with the config, 
not modules. Even back on 2.02+dfsg1-6 I could `insmod` both "luks" and 
"lvm" modules, and boot Debian. So the modules *are* present, it's just 
that the config doesn't load them.


--
Regards,
Alexander Batischev

PGP key 356961A20C8BFD03
Fingerprint: CE6C 4307 9348 58E3 FD94  A00F 3569 61A2 0C8B FD03



signature.asc
Description: PGP signature

Bug#919773: Bug #919773 in libdbd-sqlite3-perl marked as pending

[Xavier Guimard]

Control: tag -1 pending

Hello,

Bug #919773 in libdbd-sqlite3-perl reported by you has been fixed in the
Git repository and is awaiting an upload. You can see the commit
message below and you can check the diff of the fix at:

https://salsa.debian.org/perl-team/modules/packages/libdbd-sqlite3-perl/commit/332ab3df41fcfe381697a0ab102c6b992e37cc6c


Fix bad test count

Closes: #919773


(this message was generated automatically)
-- 
Greetings

https://bugs.debian.org/919773

Processed: Re: Bug#919731: libpoe-component-client-mpd-perl: FTBFS (Can't locate object method "format" via package "Audio::MPD::Common::Item::Song")

[Debian Bug Tracking System]

Processing control commands:

> reassign 919731 libaudio-mpd-common-perl
Bug #919731 [src:libpoe-component-client-mpd-perl] 
libpoe-component-client-mpd-perl: FTBFS (Can't locate object method "format" 
via package "Audio::MPD::Common::Item::Song")
Bug reassigned from package 'src:libpoe-component-client-mpd-perl' to 
'libaudio-mpd-common-perl'.
No longer marked as found in versions libpoe-component-client-mpd-perl/2.001-2.
Ignoring request to alter fixed versions of bug #919731 to the same values 
previously set
> affects 919731 libpoe-component-client-mpd-perl
Bug #919731 [libaudio-mpd-common-perl] libpoe-component-client-mpd-perl: FTBFS 
(Can't locate object method "format" via package 
"Audio::MPD::Common::Item::Song")
Added indication that 919731 affects libpoe-component-client-mpd-perl

-- 
919731: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919731
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: Bug #919773 in libdbd-sqlite3-perl marked as pending

[Debian Bug Tracking System]

Processing control commands:

> tag -1 pending
Bug #919773 [src:libdbd-sqlite3-perl] libdbd-sqlite3-perl FTBFS on mips: test 
failure
Added tag(s) pending.

-- 
919773: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919773
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919731: libpoe-component-client-mpd-perl: FTBFS (Can't locate object method "format" via package "Audio::MPD::Common::Item::Song")

[Florian Schlichting]

Control: reassign 919731 libaudio-mpd-common-perl
Control: affects 919731 libpoe-component-client-mpd-perl

On Fri, Jan 18, 2019 at 11:40:42PM +, Santiago Vila wrote:
> Package: src:libpoe-component-client-mpd-perl
> Version: 2.001-2
> Severity: serious
> Tags: ftbfs
> 
> Dear maintainer:
> 
> I tried to build this package in buster but it failed:
> 
> 
> [...]
> Can't locate object method "format" via package 
> "Audio::MPD::Common::Item::Song" at 
> /<>/blib/lib/POE/Component/Client/MPD/Connection.pm line 232.
> # No tests run!
> t/62-coll-pick.t . 

the issue here is that Audio::MPD::Common::Item::Song cannot deal with
all of the tags and metadata sent by current MPDs. Reassigning to
libaudio-mpd-common-perl, where the list of attributes for a song can be
extended.

Florian

Bug#918026: ruby-sinatra-contrib: uninstallable; depends on versions not present in the archive

[Antonio Terceiro]

On Wed, Jan 16, 2019 at 10:50:03AM +0900, Hideki Yamane wrote:
> On Fri, 4 Jan 2019 10:22:08 -0300
> Antonio Terceiro  wrote:
> > Are you working on updating sinatra? I started working on a new sinatra
> > upstream release to unbreak debci after a new rack was uploaded, and
> > could build binaries for ruby-sinatra-contrib (and ruby-rack-protection,
> > which was also moved into sinatra) from the ruby-sinatra source in one
> > go.
> 
>  Thanks Antonio for updating sinatra package!
>  
>  And now I've found that ruby-sinatra-contrib was removed from repository,
>  is that intended?
> 
>  See https://ftp-master.debian.org/removals.txt

it turns out that sinatra-contrib is now part of sinatra itself (same
git repository, releases in sync), so the corresponding binary is now
provided by src:ruby-sinatra


signature.asc
Description: PGP signature

Bug#919776: mariadb-10.1 FTBFS on most architectures, testsuite failures.

[peter green]

Package: mariadb-10.1
Version: 1:10.1.37-3
Severity: serious

During rebuilds for the jemalloc transition mariadb-10.1 failed to build on 
most architectures with the following error on most architectures ().


Completed: Failed 2/4906 tests, 99.96% were successful.

Failing test(s): main.mysqldump

The log files in var/log may give you some hint of what went wrong.

If you want to report this error, please read first the documentation
athttp://dev.mysql.com/doc/mysql/en/mysql-test-suite.html

678 tests were skipped, 302 by the test itself.

mysql-test-run: *** ERROR: there were failing test cases

Bug#919731: Bug #919731 in libaudio-mpd-common-perl marked as pending

[Florian Schlichting]

Control: tag -1 pending

Hello,

Bug #919731 in libaudio-mpd-common-perl reported by you has been fixed in the
Git repository and is awaiting an upload. You can see the commit
message below and you can check the diff of the fix at:

https://salsa.debian.org/perl-team/modules/packages/libaudio-mpd-common-perl/commit/19e8863349e65db4305fa3b0b9a44685003d403a


Add support for more song tags and metadata (closes: #919731)


(this message was generated automatically)
-- 
Greetings

https://bugs.debian.org/919731

Processed: Bug #919731 in libaudio-mpd-common-perl marked as pending

[Debian Bug Tracking System]

Processing control commands:

> tag -1 pending
Bug #919731 [libaudio-mpd-common-perl] libpoe-component-client-mpd-perl: FTBFS 
(Can't locate object method "format" via package 
"Audio::MPD::Common::Item::Song")
Added tag(s) pending.

-- 
919731: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919731
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: bug 919731 is forwarded to https://github.com/jquelin/audio-mpd-common/pull/4

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> forwarded 919731 https://github.com/jquelin/audio-mpd-common/pull/4
Bug #919731 [libaudio-mpd-common-perl] libpoe-component-client-mpd-perl: FTBFS 
(Can't locate object method "format" via package 
"Audio::MPD::Common::Item::Song")
Set Bug forwarded-to-address to 
'https://github.com/jquelin/audio-mpd-common/pull/4'.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919731: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919731
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919778: mash FTBFS on armhf when built on arm64 hardware

[Adrian Bunk]

Source: mash
Version: 2.1-2
Severity: serious
Tags: ftbfs

https://buildd.debian.org/status/fetch.php?pkg=mash&arch=armhf&ver=2.1-2&stamp=1545838322&raw=0

...
   dh_auto_test -a
make -j8 test VERBOSE=1
make[1]: Entering directory '/<>'
cd test ; ../mash sketch -o genomes.msh genome1.fna genome2.fna genome3.fna
cd test ; ../mash sketch -r -I reads reads1.fastq reads2.fastq -o reads.msh
Sketching genome1.fna...
Sketching genome2.fna...
Sketching genome3.fna...
Bus error
make[1]: *** [Makefile:94: test/reads.msh] Error 135


Backtrace:

#0  0x00638d2e in MurmurHash3_x64_128 (key=0xf523a009, len=len@entry=21, 
seed=, out=out@entry=0xf6b2dbd4)
at src/mash/MurmurHash3.cpp:277
#1  0x00635b4c in getHash (seq=, length=length@entry=21, 
seed=, use64=true)
at src/mash/hash.cpp:23
#2  0x00639a50 in addMinHashes (minHashHeap=..., 
seq=0xf523a008 
"AGCCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATATTACAGAGTACACAACATCCATGAAACGCAT"...,
 
length=, parameters=...) at src/mash/Sketch.cpp:601
#3  0x0063a7d6 in sketchFile (input=0x692268) at src/mash/Sketch.cpp:1264
#4  0x006400a0 in ThreadPool::thread 
(arg=0xffeea370)
at src/mash/ThreadPool.hxx:182
#5  0xf6cd2bbe in start_thread () from /lib/arm-linux-gnueabihf/libpthread.so.0
#6  0xf6bc94dc in ?? () from /lib/arm-linux-gnueabihf/libc.so.6



void MurmurHash3_x64_128 ( const void * key, const int len,
   const uint32_t seed, void * out )
{
  const uint8_t * data = (const uint8_t*)key;
...
  const uint64_t * blocks = (const uint64_t *)(data);
...


key=0xf523a009 is not properly aligned for that.

Bug#919554: virtualbox-qt: Cannot launch Virtualbox

[Gianfranco Costamagna]

Hello, please go ahead! I completely trust your work as always :)
G.

Sent from Yahoo Mail on Android 
 
  On Sat, 19 Jan 2019 at 9:57, Daniel 
Baumann wrote:   Hi,

newer Qt does the right thing here: VirtualBox does not need to be 
setuid root but VirtualBoxVM needs to be.

I've tested and commited this in git. Gianfranco, may I upload this to 
experimental?

Regards,
Daniel
  

Bug#919781: mash FTBFS: This code requires C++14. Either your compiler does not support it or it is not enabled.

[Adrian Bunk]

Source: mash
Version: 2.0-2
Severity: serious
Tags: ftbfs
Control: close -1 2.1-2

https://tests.reproducible-builds.org/debian/rb-pkg/buster/amd64/mash.html

...
checking for capnp... yes
checking capnp/common.h usability... no
checking capnp/common.h presence... no
checking for capnp/common.h... no
configure: error: Cap'n Proto headers not found.
...
configure:3004: checking capnp/common.h presence
configure:3004: g++ -E -I/usr/include -std=c++11 conftest.cpp
In file included from /usr/include/kj/memory.h:28,
 from /usr/include/kj/array.h:28,
 from /usr/include/kj/string.h:29,
 from /usr/include/capnp/common.h:33,
 from conftest.cpp:19:
/usr/include/kj/common.h:36:4: error: #error "This code requires C++14. Either 
your compiler does not support it or it is not enabled."
   #error "This code requires C++14. Either your compiler does not support it 
or it is not enabled."
^
/usr/include/kj/common.h:39:6: error: #error "Pass -std=c++14 on the compiler 
command line to enable C++14."
 #error "Pass -std=c++14 on the compiler command line to enable C++14."
  ^


This bug is already fixed in unstable.

Processed: mash FTBFS: This code requires C++14. Either your compiler does not support it or it is not enabled.

[Debian Bug Tracking System]

Processing control commands:

> close -1 2.1-2
Bug #919781 [src:mash] mash FTBFS: This code requires C++14. Either your 
compiler does not support it or it is not enabled.
Marked as fixed in versions mash/2.1-2.
Bug #919781 [src:mash] mash FTBFS: This code requires C++14. Either your 
compiler does not support it or it is not enabled.
Marked Bug as done

-- 
919781: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919781
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#917884: (no subject)

[John Scott]

Control: severity -1 important
Control: found -1 0.75-1

Could you be using Wayland by any chance, like with GNOME 3? For me,
mate-panel crashes there regardless of applets used. Since the applet works 
fine for me, I hope you don't mind that I reduce the bug severity.

I suggest that you try invoking mate-panel from the command-line, attempt to 
add the applet again, and see if it gives any output that might be meaningful 
to be posted here.

signature.asc
Description: This is a digitally signed message part.

Bug#919783: libdfp: FTBFS on s390x: printf_dfp.c:120:20: error: unknown type name '_IO_size_t'

[Andreas Beckmann]

Source: libdfp
Version: 1.0.13-1
Severity: serious
Tags: sid buster
Justification: fails to build from source

Hi,

libdfp FTBFS in a sid chroot on the s390x porterbox zelenka:

gcc  -DSHARED -O2 -fpic -g -march=zEC12  -mzarch -MT printf_dfp.o -MD -MP -MF 
printf_dfp.d -c ../printf_dfp.c -D__STDC_DEC_FP__=200704L 
-D__STDC_WANT_DEC_FP__=1 -DOPTION_EGLIBC_LOCALE_CODE=1 -std=gnu99 -D_ISOC99_
SOURCE -W -Wall -Wwrite-strings -Wstrict-prototypes -Wmissing-prototypes 
-Wold-style-definition -Wmissing-format-attribute -Wno-long-long -include 
./config.h -include ../include/libdfp-symbols.h  -I../include  -I
../dfp  -I../dfp/decimal  -I../libdecnumber/dpd  -I../libdecnumber  
-I../sysdeps/s390/dfpu  -I../sysdeps/s390/fpu  -I../sysdeps/s390  
-I../sysdeps/dpd  -I../sysdeps/generic  -I../decNumberMath/  -I../ieee754/  -I
../base-math/  -I..  -I. -o printf_dfp.o
In file included from ../sysdeps/s390/dfpu/numdigits.h:39,
 from ../printf_dfp.c:52:
../sysdeps/dpd/dpd-private.h:307:14: warning: duplicate 'const' declaration 
specifier [-Wduplicate-decl-specifier]
 extern const const short int dpd_to_bcd[1024];
  ^
../sysdeps/dpd/dpd-private.h:308:14: warning: duplicate 'const' declaration 
specifier [-Wduplicate-decl-specifier]
 extern const const short int dpd_to_bin[1024];
  ^
../printf_dfp.c:120:20: error: unknown type name '_IO_size_t'; did you mean 
'__ssize_t'?
 #define size_t _IO_size_t
^~
../printf_dfp.c:308:44: note: in expansion of macro 'size_t'
 __dfp_ais (const struct printf_info *info, size_t n __attribute__ ((unused)), 
int *argtype, int *size)
^~
../printf_dfp.c:121:19: error: unknown type name '_IO_FILE'; did you mean 
'__FILE'?
 #define FILE  _IO_FILE
   ^~~~
../printf_dfp.c:346:15: note: in expansion of macro 'FILE'
 __printf_dfp (FILE *fp,
   ^~~~
In file included from :
./../include/libdfp-symbols.h:95:26: error: '__EI___printf_dfp' aliased to 
undefined symbol '__GI___printf_dfp'
   extern __typeof (name) __EI_##name \
  ^
./../include/libdfp-symbols.h:100:41: note: in expansion of macro 
'__hidden_ver1'
 #  define _hidden_def(name) __hidden_ver1(__GI_##name, name, name);
 ^
./../include/libdfp-symbols.h:99:41: note: in expansion of macro '_hidden_def'
 #  define hidden_def(name)  _hidden_def(name)
 ^~~
../printf_dfp.c:888:1: note: in expansion of macro 'hidden_def'
 hidden_def (__printf_dfp)
 ^~
./../include/libdfp-symbols.h:95:26: error: '__EI___dfp_ais' aliased to 
undefined symbol '__GI___dfp_ais'
   extern __typeof (name) __EI_##name \
  ^
./../include/libdfp-symbols.h:100:41: note: in expansion of macro 
'__hidden_ver1'
 #  define _hidden_def(name) __hidden_ver1(__GI_##name, name, name);
 ^
./../include/libdfp-symbols.h:99:41: note: in expansion of macro '_hidden_def'
 #  define hidden_def(name)  _hidden_def(name)
 ^~~
../printf_dfp.c:332:1: note: in expansion of macro 'hidden_def'
 hidden_def(__dfp_ais)
 ^~
../printf_dfp.c:84:1: warning: 'padn' defined but not used [-Wunused-function]
 padn (FILE *fp, int pad, int count)
 ^~~~
../printf_dfp.c:71:1: warning: 'wpadn' defined but not used [-Wunused-function]
 wpadn (FILE *fp, wint_t pad, int count)
 ^
make[1]: *** [Makefile:241: printf_dfp.o] Error 1
make[1]: Leaving directory 
'/home/anbe/rebuild/tmp_rebuild_libdfp_0Gyy4A4r/libdfp-1.0.13/build'


Cheers,

Andreas


libdfp_1.0.13-1.log.gz
Description: application/gzip

Processed: tagging 919731

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 919731 + buster sid
Bug #919731 [libaudio-mpd-common-perl] libpoe-component-client-mpd-perl: FTBFS 
(Can't locate object method "format" via package 
"Audio::MPD::Common::Item::Song")
Added tag(s) buster and sid.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919731: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919731
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: affects 919731

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> affects 919731 src:libpoe-component-client-mpd-perl
Bug #919731 [libaudio-mpd-common-perl] libpoe-component-client-mpd-perl: FTBFS 
(Can't locate object method "format" via package 
"Audio::MPD::Common::Item::Song")
Added indication that 919731 affects src:libpoe-component-client-mpd-perl
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919731: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919731
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#916065: marked as done (fdutils FTBFS with glibc 2.28)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 15:08:30 +
with message-id 
and subject line Bug#916065: fixed in fdutils 5.5-20060227-8
has caused the Debian Bug report #916065,
regarding fdutils FTBFS with glibc 2.28
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
916065: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=916065
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: fdutils
Version: 5.5-20060227-7
Severity: serious
Tags: ftbfs buster sid

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/fdutils.html

...
driveprm.c: In function 'getdrivenum':
driveprm.c:143:6: warning: implicit declaration of function 'major' 
[-Wimplicit-function-declaration]
  major(buf->st_rdev) != FLOPPY_MAJOR) {
  ^
driveprm.c:148:8: warning: implicit declaration of function 'minor'; did you 
mean 'mknod'? [-Wimplicit-function-declaration]
  num = minor( buf->st_rdev );
^
...
gcc -Wl,-z,relro -o getfdprm getfdprm.o -L. -lfdutils 
/usr/bin/ld: ./libfdutils.a(driveprm.o): in function `getdrivenum':
./src/driveprm.c:143: undefined reference to `major'
/usr/bin/ld: ./src/driveprm.c:148: undefined reference to `minor'
collect2: error: ld returned 1 exit status
make[3]: *** [Makefile:102: getfdprm] Error 1
--- End Message ---
--- Begin Message ---
Source: fdutils
Source-Version: 5.5-20060227-8

We believe that the bug you reported is fixed in the latest version of
fdutils, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 916...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Matteo Cypriani  (supplier of updated fdutils package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA256

Format: 1.8
Date: Sat, 19 Jan 2019 15:45:30 +0100
Source: fdutils
Binary: fdutils
Architecture: source amd64
Version: 5.5-20060227-8
Distribution: unstable
Urgency: medium
Maintainer: Matteo Cypriani 
Changed-By: Matteo Cypriani 
Description:
 fdutils- Linux floppy utilities
Closes: 916065
Changes:
 fdutils (5.5-20060227-8) unstable; urgency=medium
 .
   [ Ondřej Nový  ]
   * d/copyright: Use https protocol in Format field
   * d/changelog: Remove trailing whitespaces
   * d/control: Set Vcs-* to salsa.debian.org
 .
   [ Andreas Henriksson  ]
   * Add debian/config-ftbfs.patch (Closes: #916065)
 .
   [ Matteo Cypriani ]
   * Bumped Standards-Version to 4.3.0 (no changes needed)
   * Bumped compat-level to debhelper 12 (with --no-parallel)
   * d/rules: hardening is now enabled
   * Added lintian-overrides files
   * d/control: secure Homepage URI
   * d/watch: fixed broken mirror, updated to version 4
   * d/README.Debian: proof-read and reformatted
   * Patches:
 + dont_strip_binaries.patch: fixed a typo in the header
 + documentation-spelling_errors.patch: a few more errors fixed
   * d/config: dropped support for fdutils 5.2
Checksums-Sha1:
 c015d636a85c49019e11d8e44fe91f85b64086d0 2033 fdutils_5.5-20060227-8.dsc
 368cb0bb73983da0db9637d83329cb5452bee607 48480 
fdutils_5.5-20060227-8.debian.tar.xz
 57d4d2f54b6705d9756b4e660e0b1e1971102f7f 219588 
fdutils-dbgsym_5.5-20060227-8_amd64.deb
 27ab97368f3a2ef1e55fef94c9854ee014be9c3a 8501 
fdutils_5.5-20060227-8_amd64.buildinfo
 05e311e0c1f8c3c80bba793f4d300c540604eb70 331248 
fdutils_5.5-20060227-8_amd64.deb
Checksums-Sha256:
 38e1f1415a5fae907ce3b87819bb632cb777ad822d624f8d447612ffb57fb50c 2033 
fdutils_5.5-20060227-8.dsc
 44afd8460cc386b74ced9fcaf6ed57f651904425a85972beea7189d57b6b550e 48480 
fdutils_5.5-20060227-8.debian.tar.xz
 6a9a68431273d323ab55b40947eb0a2089a172016762028484aa486c7cfd8fb2 219588 
fdutils-dbgsym_5.5-20060227-8_amd64.deb
 20ad965ca8cdf6ba5236c6ea051b42c27a1fd1c40ab44188d2f3452f9644d521 8501 
fdutils_5.5-20060227-8_amd64.buildinfo
 e708aae9b36049b6d3c075f2fa57f80a4cc8e3a2d24f1ed7a2c908cbb0c475fc 331248 
fdutils_5.5-20060227-8_amd64.deb
Files:
 32f7b13567b9f13dc9be35c259d6b82d 2033 utils optional fdutils_5.5-20060227-8.dsc
 7b5d2c27f8312790f973d3d66dea667f 48480 utils optional 
fdutils_5.5-20060227-8.debian.tar.xz
 549819f51bea0a8812c3e6c6ee36571a 219588 debug optional 
fdutils-dbgsym_5.5-20060227-8_amd64.deb
 fdfd7d0ebca803c4aab045de91dee77d 8501 util

Bug#893264: marked as done (libnb-javaparser-java FTBFS with openjdk-9)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 15:11:48 +
with message-id 
and subject line Bug#893264: fixed in libnb-javaparser-java 9+2018-1
has caused the Debian Bug report #893264,
regarding libnb-javaparser-java FTBFS with openjdk-9
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
893264: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=893264
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: libnb-javaparser-java
Version: 7.4-1
Severity: serious
Tags: buster sid

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/libnb-javaparser-java.html

...
-do-compile:
[mkdir] Created dir: 
/build/1st/libnb-javaparser-java-7.4/make/netbeans/nb-javac/build/empty
[mkdir] Created dir: 
/build/1st/libnb-javaparser-java-7.4/make/netbeans/nb-javac/build/generated-sources/ap-source-output
[javac] Compiling 529 source files to 
/build/1st/libnb-javaparser-java-7.4/make/netbeans/nb-javac/build/classes
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:86:
 error: cannot find symbol
[javac] private Map> contextMap;
[javac] ^
[javac]   symbol:   class TranslationContext
[javac]   location: class LambdaToMethod
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:89:
 error: cannot find symbol
[javac] private TranslationContext context;
[javac] ^
[javac]   symbol:   class TranslationContext
[javac]   location: class LambdaToMethod
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:179:
 error: cannot find symbol
[javac]  T translate(T tree, TranslationContext 
newContext) {
[javac]^
[javac]   symbol:   class TranslationContext
[javac]   location: class LambdaToMethod
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:190:
 error: cannot find symbol
[javac]  List translate(List trees, 
TranslationContext newContext) {
[javac] ^
[javac]   symbol:   class TranslationContext
[javac]   location: class LambdaToMethod
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:907:
 error: cannot find symbol
[javac] private void bridgeMemberReference(JCMemberReference tree, 
ReferenceTranslationContext localContext) {
[javac]^
[javac]   symbol:   class ReferenceTranslationContext
[javac]   location: class LambdaToMethod
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:922:
 error: cannot find symbol
[javac] private JCExpression 
makeMetafactoryIndyCall(TranslationContext context,
[javac]  ^
[javac]   symbol:   class TranslationContext
[javac]   location: class LambdaToMethod
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:726:
 error: cannot find symbol
[javac] private final ReferenceTranslationContext localContext;
[javac]   ^
[javac]   symbol:   class ReferenceTranslationContext
[javac]   location: class LambdaToMethod.MemberReferenceBridger
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:730:
 error: cannot find symbol
[javac] MemberReferenceBridger(JCMemberReference tree, 
ReferenceTranslationContext localContext) {
[javac]^
[javac]   symbol:   class ReferenceTranslationContext
[javac]   location: class LambdaToMethod.MemberReferenceBridger
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:175:
 error: cannot find symbol
[javac] TranslationContext newContext = contextMap.get(tree);
[javac] ^
[javac]   symbol:   class TranslationContext
[javac]   location: class LambdaToMethod
[javac] 
/build/1st/libnb-javaparser-java-7.4/src/share/classes/com/sun/tools/javac/comp/LambdaToMethod.java:180:
 error: cannot find symbol
[javac] TranslationContext prevContext = context;
[javac] ^
[javac]   symbo

Bug#919731: marked as done (libpoe-component-client-mpd-perl: FTBFS (Can't locate object method "format" via package "Audio::MPD::Common::Item::Song"))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 15:10:58 +
with message-id 
and subject line Bug#919731: fixed in libaudio-mpd-common-perl 2.003-2
has caused the Debian Bug report #919731,
regarding libpoe-component-client-mpd-perl: FTBFS (Can't locate object method 
"format" via package "Audio::MPD::Common::Item::Song")
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919731: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919731
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: src:libpoe-component-client-mpd-perl
Version: 2.001-2
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep
   dh_update_autotools_config -i
   dh_autoreconf -i
   dh_auto_configure -i
perl Build.PL --installdirs vendor --config "optimize=-g -O2 
-fdebug-prefix-map=/<>=. -fstack-protector-strong -Wformat 
-Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2" --config 
"ld=x86_64-linux-gnu-gcc -g -O2 -fdebug-prefix-map=/<>=. 
-fstack-protector-strong -Wformat -Werror=format-security -Wl,-z,relro"
Created MYMETA.yml and MYMETA.json
Creating new 'Build' script for 'POE-Component-Client-MPD' version '2.001'
   dh_auto_build -i
perl Build
Building POE-Component-Client-MPD
   dh_auto_test -i
perl Build test --verbose 1
t/00-compile.t ... 

[... snipped ...]

ok 5 - all_artists() return the artists
ok 6
ok 7 - command 'coll.all_titles' returned an ok status
ok 8 - all_titles() return the titles
ok 9
ok 10 - command 'coll.all_files' returned an ok status
ok 11 - all_files() return the pathes
ok 12 - all_files() return strings
ok
Can't locate object method "format" via package 
"Audio::MPD::Common::Item::Song" at 
/<>/blib/lib/POE/Component/Client/MPD/Connection.pm line 232.
# No tests run!
t/62-coll-pick.t . 
1..9
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 9/9 subtests 
Can't locate object method "format" via package 
"Audio::MPD::Common::Item::Song" at 
/<>/blib/lib/POE/Component/Client/MPD/Connection.pm line 232.
# Looks like you planned 38 tests but ran 3.
t/63-coll-relations.t  
1..38
ok 1 - command 'coll.albums_by_artist' returned an ok status
ok 2 - albums_by_artist() return the album
ok 3 - albums_by_artist() return plain strings
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 35/38 subtests 
t/author-pod-coverage.t .. skipped: these tests are for testing by the author
t/author-pod-syntax.t  skipped: these tests are for testing by the author

Test Summary Report
---
t/23-conn-dialog.t (Wstat: 65280 Tests: 9 Failed: 0)
  Non-zero exit status: 255
  Parse errors: Bad plan.  You planned 34 tests but ran 9.
t/60-coll-retrieve.t   (Wstat: 65280 Tests: 0 Failed: 0)
  Non-zero exit status: 255
  Parse errors: Bad plan.  You planned 35 tests but ran 0.
t/62-coll-pick.t   (Wstat: 65280 Tests: 0 Failed: 0)
  Non-zero exit status: 255
  Parse errors: Bad plan.  You planned 9 tests but ran 0.
t/63-coll-relations.t  (Wstat: 65280 Tests: 3 Failed: 0)
  Non-zero exit status: 255
  Parse errors: Bad plan.  You planned 38 tests but ran 3.
Files=21, Tests=260, 98 wallclock secs ( 0.17 usr  0.09 sys + 43.59 cusr  4.31 
csys = 48.16 CPU)
Result: FAIL
Failed 4/21 test programs. 0/260 subtests failed.
dh_auto_test: perl Build test --verbose 1 returned exit code 255
make: *** [debian/rules:7: build-indep] Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/libpoe-component-client-mpd-perl.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.
--- End Message ---
--- Begin Message ---
Source: libaudio-mpd-common-perl
Source-Version: 2.003-2

We believe that the bug you reported is fixed in the latest version of
libaudio-mpd-common-perl, which is due to be installed in the Debian FTP 
archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer 

Bug#902150: marked as done (ceres-solver FTBFS on arm64/ppc64el: evaluation_callback_test (Failed))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 16:31:49 +0100
with message-id <848a1da2-1cef-f587-f1e0-9f64918d5...@debian.org>
and subject line Re: ceres-solver FTBFS on arm64/ppc64el
has caused the Debian Bug report #902150,
regarding ceres-solver FTBFS on arm64/ppc64el: evaluation_callback_test (Failed)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
902150: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=902150
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: ceres-solver
Version: 1.14.0-1
Severity: serious
Tags: ftbfs

https://buildd.debian.org/status/package.php?p=ceres-solver&suite=sid

...
99% tests passed, 1 tests failed out of 127

Total Test time (real) = 272.54 sec

The following tests FAILED:
 30 - evaluation_callback_test (Failed)
Errors while running CTest
Makefile:88: recipe for target 'test' failed
make[1]: *** [test] Error 8
--- End Message ---
--- Begin Message ---
Since upstream has not shown any interest in fixing this for over 6
months, I have requested a removal for ceres-solver on arm64/ppc64el,
see #919786.

Regards,
-- 
 .''`.   Philipp Huebner 
: :'  :  pgp fp: 6719 25C5 B8CD E74A 5225  3DF9 E5CA 8C49 25E4 205F
`. `'`
  `-



signature.asc
Description: OpenPGP digital signature
--- End Message ---

Processed: severity of 883619 is important

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> severity 883619 important
Bug #883619 [libceres-dev] libceres-dev: dependency on libeigen3-dev isn't 
strong enough
Bug #917587 [libceres-dev] colmap: FTBFS (dh_auto_configure fails)
Severity set to 'important' from 'serious'
Severity set to 'important' from 'serious'
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
883619: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=883619
917587: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917587
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919788: libqxmpp1: missing Breaks+Replaces: libqxmpp0 (>= 1)

[Andreas Beckmann]

Package: libqxmpp1
Version: 1.0.0-3
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts

Hi,

during a test with piuparts I noticed your package fails to upgrade from
'testing'.
It installed fine in 'testing', then the upgrade to 'sid' fails
because it tries to overwrite other packages files without declaring a
Breaks+Replaces relation.

See policy 7.6 at
https://www.debian.org/doc/debian-policy/ch-relationships.html#overwriting-files-and-replacing-packages-replaces

>From the attached log (scroll to the bottom...):

  Preparing to unpack .../libqxmpp1_1.0.0-3_amd64.deb ...
  Unpacking libqxmpp1:amd64 (1.0.0-3) ...
  dpkg: error processing archive 
/var/cache/apt/archives/libqxmpp1_1.0.0-3_amd64.deb (--unpack):
   trying to overwrite '/usr/lib/x86_64-linux-gnu/libqxmpp.so.1.0.0', which is 
also in package libqxmpp0:amd64 1.0.0-1
  dpkg-deb: error: paste subprocess was killed by signal (Broken pipe)
  Errors were encountered while processing:
   /var/cache/apt/archives/libqxmpp1_1.0.0-3_amd64.deb


cheers,

Andreas


libqxmpp0=1.0.0-1_libqxmpp1=1.0.0-3.log.gz
Description: application/gzip

Bug#919293: marked as done (FTBFS: Test keys expired 2019-01-06)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 16:19:24 +
with message-id 
and subject line Bug#919293: fixed in gpgme1.0 1.12.0-5
has caused the Debian Bug report #919293,
regarding FTBFS: Test keys expired 2019-01-06
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919293: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919293
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: gpgme1.0
Severity: serious
User: ubuntu-de...@lists.ubuntu.com
Usertags: origin-ubuntu disco

See https://dev.gnupg.org/T3815 and
https://git.gnupg.org/cgi-bin/gitweb.cgi?p=gpgme.git;a=commit;h=66376f3e206a1aa791d712fb8577bb3490268f60

-- System Information:
Debian Release: buster/sid
  APT prefers disco
  APT policy: (500, 'disco'), (500, 'cosmic-security')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 4.18.0-13-generic (SMP w/8 CPU cores)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8), 
LANGUAGE=en_US.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)
LSM: AppArmor: enabled

-- 
debian developer - deb.li/jak | jak-linux.org - free software dev
ubuntu core developer  i speak de, en
--- End Message ---
--- Begin Message ---
Source: gpgme1.0
Source-Version: 1.12.0-5

We believe that the bug you reported is fixed in the latest version of
gpgme1.0, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Roger Shimizu  (supplier of updated gpgme1.0 package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sun, 20 Jan 2019 00:11:50 +0900
Source: gpgme1.0
Binary: libgpgme-dev libgpgme11 python3-gpg python-gpg libqgpgme7 libgpgmepp6 
libgpgmepp-dev libgpgmepp-doc
Architecture: source
Version: 1.12.0-5
Distribution: unstable
Urgency: medium
Maintainer: Debian GnuPG Maintainers 
Changed-By: Roger Shimizu 
Description:
 libgpgme-dev - GPGME - GnuPG Made Easy (development files)
 libgpgme11 - GPGME - GnuPG Made Easy (library)
 libgpgmepp-dev - C++ and Qt bindings for GPGME (development files)
 libgpgmepp-doc - C++ and Qt bindings for GPGME (documentation for developers)
 libgpgmepp6 - C++ wrapper library for GPGME
 libqgpgme7 - library for GPGME integration with Qt
 python-gpg - Python interface to the GPGME GnuPG encryption library (Python 2)
 python3-gpg - Python interface to the GPGME GnuPG encryption library (Python 3)
Closes: 919293
Changes:
 gpgme1.0 (1.12.0-5) unstable; urgency=medium
 .
   * Team upload.
   * Backport upstream patch to fix RC bug that TofuInfoTest key expires
 on 2019-Jan-06 (Closes: #919293).
Checksums-Sha1:
 7688942d5cf38d14c45f487816e6d0782c529f9e 2675 gpgme1.0_1.12.0-5.dsc
 8c67ff778d686038697466f48403efaa935d20d7 22036 gpgme1.0_1.12.0-5.debian.tar.xz
 55e3702b82e311266f6591d6eaf885fcf6c6c5e8 14262 
gpgme1.0_1.12.0-5_source.buildinfo
Checksums-Sha256:
 3762fcc6eb579c8bb37828d7561638ec394eb5952ee37e92929d4d5cbb9fe568 2675 
gpgme1.0_1.12.0-5.dsc
 736684edba17d5797b4b396a8d7453a4cd8cad3b0562ff1027c9e66de03c3349 22036 
gpgme1.0_1.12.0-5.debian.tar.xz
 4765900d864bd99c0d787458ebec32930e28e7c433077da28606aeb9d2b35cca 14262 
gpgme1.0_1.12.0-5_source.buildinfo
Files:
 da1306a4dfbfe3f03768b51cfde7f9b2 2675 libs optional gpgme1.0_1.12.0-5.dsc
 ada3147487987cee09eb5b61bb26060b 22036 libs optional 
gpgme1.0_1.12.0-5.debian.tar.xz
 b747a2b5c69b75eda604fd9d46fae6af 14262 libs optional 
gpgme1.0_1.12.0-5_source.buildinfo

-BEGIN PGP SIGNATURE-

iQJEBAEBCgAuFiEECjKtvoA5m+cWOFnspHhrDacDNKgFAlxDSMoQHHJvc2hAZGVi
aWFuLm9yZwAKCRCkeGsNpwM0qPcoD/94GQ9gvxXRVLF3PU2HSFgthL/snn1pIqz1
yvNpec/9czgxBgtmswyXgnh/ip7BlMdKEjhbbe9Z5g5ut9uJ7s4xJUirfVWX/PQi
viGU9C790j1FreEj/kGkcWJpfhuUv+ArrlwTSMV5RengVTNj54kynwDdUgamPjHA
b5eHgJ0lsV8FDy6SY1nuVJHkGrTpNvATUXOju85M1z/KaNeQ+ftvE//Q8mjuA/R/
mkfuVSuUSsIHc9hUKiQvvjkvscPERWC4Mjs/9lw/xdoeUJXKnbGUzg9Ih/+vxFqr
TekzuFkViGmhy8xLobBLtZ5Q/GlYQXNAT+VczRh0Q6OWj6ac1LFvCZctc03Mvgxv
5jiXaFMMfLJImDf/qavP8+TSp/Rpaa50JHfSYq4X31ga2ZQ6GcpzY+L8FIoCYzIp
bPHI9Jgu3y66dVByenuXXruWxNrUPViAio624CnslZDUvJxheyfJfKi8QDsdcZCm
eSee56AjjpP36EcpgU+gaJHIcZJcCq0B0NXf

Bug#919554: marked as done (virtualbox-qt: Cannot launch Virtualbox)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 16:22:45 +
with message-id 
and subject line Bug#919554: fixed in virtualbox 6.0.2-dfsg-1~exp4
has caused the Debian Bug report #919554,
regarding virtualbox-qt: Cannot launch Virtualbox
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919554: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919554
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: virtualbox-qt
Version: 6.0.2-dfsg-1~exp1
Severity: grave
Justification: renders package unusable

sh -x /usr/bin/VirtualBox
+ PATH=/usr/bin:/bin:/usr/sbin:/sbin
+ INSTALL_DIR=/usr/lib/virtualbox
+ [ ! -c /dev/vboxdrv ]
+ grep VBoxSVC
+ whoami
+ awk { print $1 }
+ ps -U valette
+ SERVER_PID=
+ [ -z  ]
+ [ -n valette ]
+ rm -rf /tmp/.vbox-valette-ipc
+ basename /usr/bin/VirtualBox
+ APP=VirtualBox
+ exec /usr/lib/virtualbox/VirtualBox
Qt FATAL: FATAL: The application binary appears to be running setuid, this is a 
security hole.
Abandon
valette@tri-yann4:~$ ls -l /usr/lib/virtualbox/VirtualBox
-rwsr-sr-x 1 root root 33083608 janv. 16 14:34 /usr/lib/virtualbox/VirtualBox
valette@tri-yann4:~$ dpkg -S /usr/lib/virtualbox/VirtualBox
virtualbox-qt: /usr/lib/virtualbox/VirtualBox
valette@tri-yann4:~$ reportbug virtualbox-qt


-- System Information:
Debian Release: buster/sid
  APT prefers unstable
  APT policy: (500, 'unstable'), (1, 'experimental')
Architecture: amd64 (x86_64)

Kernel: Linux 4.14.93 (SMP w/8 CPU cores; PREEMPT)
Locale: LANG=fr_FR.UTF8, LC_CTYPE=fr_FR.UTF8 (charmap=UTF-8), LANGUAGE= 
(charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)

Versions of packages virtualbox-qt depends on:
ii  libc62.28-5
ii  libgcc1  1:8.2.0-14
ii  libgl1   1.1.0-1
ii  libqt5core5a 5.11.3+dfsg-3
ii  libqt5gui5   5.11.3+dfsg-3
ii  libqt5opengl55.11.3+dfsg-3
ii  libqt5printsupport5  5.11.3+dfsg-3
ii  libqt5widgets5   5.11.3+dfsg-3
ii  libqt5x11extras5 5.11.3-2
ii  libstdc++6   8.2.0-14
ii  libx11-6 2:1.6.7-1
ii  libxcb1  1.13.1-2
ii  virtualbox   6.0.2-dfsg-1~exp1

virtualbox-qt recommends no packages.

virtualbox-qt suggests no packages.

-- no debconf information
--- End Message ---
--- Begin Message ---
Source: virtualbox
Source-Version: 6.0.2-dfsg-1~exp4

We believe that the bug you reported is fixed in the latest version of
virtualbox, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Daniel Baumann  (supplier of updated 
virtualbox package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 15:59:23 +0100
Source: virtualbox
Binary: virtualbox-qt virtualbox virtualbox-dkms virtualbox-source 
virtualbox-guest-dkms virtualbox-guest-source virtualbox-guest-x11 
virtualbox-guest-utils
Architecture: source amd64 all
Version: 6.0.2-dfsg-1~exp4
Distribution: experimental
Urgency: medium
Maintainer: Debian Virtualbox Team 
Changed-By: Daniel Baumann 
Description:
 virtualbox - x86 virtualization solution - base binaries
 virtualbox-dkms - x86 virtualization solution - kernel module sources for dkms
 virtualbox-guest-dkms - x86 virtualization solution - guest addition module 
source for dk
 virtualbox-guest-source - x86 virtualization solution - guest addition module 
source
 virtualbox-guest-utils - x86 virtualization solution - non-X11 guest utilities
 virtualbox-guest-x11 - x86 virtualization solution - X11 guest utilities
 virtualbox-qt - x86 virtualization solution - Qt based user interface
 virtualbox-source - x86 virtualization solution - kernel module source
Closes: 919554
Changes:
 virtualbox (6.0.2-dfsg-1~exp4) experimental; urgency=medium
 .
   * Setting setuid bit on VirtualBoxVM instead of VirtualBox to fix
 startup (Closes: #919554).
Checksums-Sha1:
 d010150736790edfaedf5a5ffe030f118976bf44 3659 virtualbox_6.0.2-dfsg-1~exp4.dsc
 48bc46f8d62599208b5173f86a80492a94026f05 83516 
virtualbox_6.0.2-dfsg-1~exp4.debian.tar.xz
 9cb75d4cd227580d7c14c09b8488d0e01c273027 138964440 
virtualbox-dbgsym_6.0.2-dfsg-1~

Bug#919790: openjdk-12-dbg: file conflict with openjdk-11-dbg: /usr/lib/debug/.build-id/37/f4d49104d24279b3c0275df2f763e95c9964fd.debug

[Andreas Beckmann]

Package: openjdk-12-dbg
Version: 12~28-1
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts

Hi,

during a test with piuparts I noticed your package failed to install
because it tries to overwrite other packages files without declaring a
Breaks+Replaces relation.

See policy 7.6 at
https://www.debian.org/doc/debian-policy/ch-relationships.html#overwriting-files-and-replacing-packages-replaces

>From the attached log (scroll to the bottom...):

  Selecting previously unselected package openjdk-12-jre-headless:amd64.
  Preparing to unpack .../openjdk-12-jre-headless_12~28-1_amd64.deb ...
  Unpacking openjdk-12-jre-headless:amd64 (12~28-1) ...
  Selecting previously unselected package openjdk-12-dbg:amd64.
  Preparing to unpack .../openjdk-12-dbg_12~28-1_amd64.deb ...
  Unpacking openjdk-12-dbg:amd64 (12~28-1) ...
  dpkg: error processing archive 
/var/cache/apt/archives/openjdk-12-dbg_12~28-1_amd64.deb (--unpack):
   trying to overwrite 
'/usr/lib/debug/.build-id/37/f4d49104d24279b3c0275df2f763e95c9964fd.debug', 
which is also in package openjdk-11-dbg:amd64 11.0.2+7-1
  dpkg-deb: error: paste subprocess was killed by signal (Broken pipe)
  Errors were encountered while processing:
   /var/cache/apt/archives/openjdk-12-dbg_12~28-1_amd64.deb

Either add Breaks+Replaces or change the build process s.t.
openjdk-11 and openjdk-12 cannot produce the same build ids.


cheers,

Andreas


openjdk-11-dbg=11.0.2+7-1_openjdk-12-dbg=12~28-1.log.gz
Description: application/gzip

Bug#919792: gyoto,gyoto-doc: both packages ship /usr/share/doc/gyoto/README.md

[Andreas Beckmann]

Package: gyoto,gyoto-doc
Version: 1.3.0-1
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts

Hi,

during a test with piuparts I noticed your package failed to install
because it tries to overwrite other packages files.

>From the attached log (scroll to the bottom...):

  Selecting previously unselected package gyoto-doc.
  Preparing to unpack .../gyoto-doc_1.3.0-1_all.deb ...
  Unpacking gyoto-doc (1.3.0-1) ...
  dpkg: error processing archive 
/var/cache/apt/archives/gyoto-doc_1.3.0-1_all.deb (--unpack):
   trying to overwrite '/usr/share/doc/gyoto/README.md', which is also in 
package gyoto 1.3.0-1
  dpkg-deb: error: paste subprocess was killed by signal (Broken pipe)
  Errors were encountered while processing:
   /var/cache/apt/archives/gyoto-doc_1.3.0-1_all.deb


cheers,

Andreas


gyoto=1.3.0-1_gyoto-doc=1.3.0-1.log.gz
Description: application/gzip

Bug#919651: libperlx-define-perl: missing Breaks+Replaces: libmoops-perl (<= 0.034-1)

[Andreas Beckmann]

Followup-For: Bug #919651
Control: found -1 0.101-3

Hi,

you added B+R against non-existing libmoops instead of libmoops-perl.


Andreas

Processed: Re: libperlx-define-perl: missing Breaks+Replaces: libmoops-perl (<= 0.034-1)

[Debian Bug Tracking System]

Processing control commands:

> found -1 0.101-3
Bug #919651 {Done: Jonas Smedegaard } [libperlx-define-perl] 
libperlx-define-perl: missing Breaks+Replaces: libmoops-perl (<= 0.034-1)
Marked as found in versions libperlx-define-perl/0.101-3; no longer marked as 
fixed in versions libperlx-define-perl/0.101-3 and reopened.

-- 
919651: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919651
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919794: python3-sbml5-doc: missing Breaks+Replaces: libsbml5-python-doc

[Andreas Beckmann]

Package: python3-sbml5-doc
Version: 5.17.2+dfsg-1
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts

Hi,

during a test with piuparts I noticed your package fails to upgrade from
'stable'.
It installed fine in 'stable', then the upgrade to 'sid' fails
because it tries to overwrite other packages files without declaring a
Breaks+Replaces relation.

See policy 7.6 at
https://www.debian.org/doc/debian-policy/ch-relationships.html#overwriting-files-and-replacing-packages-replaces

This test intentionally skipped 'testing' to find file overwrite
problems before packages migrate from 'unstable' to 'testing'.

>From the attached log (scroll to the bottom...):

  Preparing to unpack .../python3-sbml5-doc_5.17.2+dfsg-1_all.deb ...
  Unpacking python3-sbml5-doc (5.17.2+dfsg-1) ...
  dpkg: error processing archive 
/var/cache/apt/archives/python3-sbml5-doc_5.17.2+dfsg-1_all.deb (--unpack):
   trying to overwrite '/usr/share/doc/libsbml5/python-api', which is also in 
package libsbml5-python-doc 5.13.0+dfsg-1
  Errors were encountered while processing:
   /var/cache/apt/archives/python3-sbml5-doc_5.17.2+dfsg-1_all.deb


cheers,

Andreas


libsbml5-python-doc=5.13.0+dfsg-1_python3-sbml5-doc=5.17.2+dfsg-1.log.gz
Description: application/gzip

Bug#919651: libperlx-define-perl: missing Breaks+Replaces: libmoops-perl (<= 0.034-1)

[Jonas Smedegaard]

Quoting Andreas Beckmann (2019-01-19 17:55:40)
> you added B+R against non-existing libmoops instead of libmoops-perl.

Oh my - thanks for persisting!

 - Jonas

-- 
 * Jonas Smedegaard - idealist & Internet-arkitekt
 * Tlf.: +45 40843136  Website: http://dr.jones.dk/

 [x] quote me freely  [ ] ask before reusing  [ ] keep private


signature.asc
Description: signature

Processed: Bug #919651 in libperlx-define-perl marked as pending

[Debian Bug Tracking System]

Processing control commands:

> tag -1 pending
Bug #919651 [libperlx-define-perl] libperlx-define-perl: missing 
Breaks+Replaces: libmoops-perl (<= 0.034-1)
Ignoring request to alter tags of bug #919651 to the same tags previously set

-- 
919651: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919651
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919651: Bug #919651 in libperlx-define-perl marked as pending

[Jonas Smedegaard]

Control: tag -1 pending

Hello,

Bug #919651 in libperlx-define-perl reported by you has been fixed in the
Git repository and is awaiting an upload. You can see the commit
message below and you can check the diff of the fix at:

https://salsa.debian.org/perl-team/modules/packages/libperlx-define-perl/commit/3d694342803a044d7378dbd61a8a467328bafb49


Really fix break and replace older libmoops-perl (not bogus libmoose). Closes: 
Bug#919651. Thanks to Andreas Beckmann.


(this message was generated automatically)
-- 
Greetings

https://bugs.debian.org/919651

Bug#919806: sbcl: FTBFS (failing tests)

[Santiago Vila]

Package: src:sbcl
Version: 2:1.4.15-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules binary-indep
dh binary-indep
   dh_update_autotools_config -i
   dh_autoreconf -i
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<>'
echo "\"1.4.15.debian\"" > version.lisp-expr
make[1]: Leaving directory '/<>'
   debian/rules override_dh_auto_build
make[1]: Entering directory '/<>'
# Create stage 1
./make.sh --xc-host="/usr/bin/sbcl --disable-debugger --no-sysinit 
--no-userinit" --prefix=/<>/stage1 --fancy
make[2]: Entering directory '/<>/tools-for-build'
make[2]: Leaving directory '/<>/tools-for-build'

[... snipped ...]

; compilation unit finished
;   Undefined type:
; A-CLASS
;   caught 1 STYLE-WARNING condition
STYLE-WARNING:
   Previously compiled call to COMMON-LISP-USER::A-STRUCT-SLOT could not be
   inlined because the structure definition for COMMON-LISP-USER::A-STRUCT was
   not yet seen. To avoid this warning, DEFSTRUCT should precede references to
   the affected functions, or they must be declared locally notinline at each
   call site.
; compiling file 
"/<>/tests/undefined-classoid-bug-test-8997/undefined-classoid-bug-1.lisp"
 (written 19 JAN 2019 01:35:56 AM):
; compiling (IN-PACKAGE "CL-USER")
; compiling (DEFUN A-STRUCT-REFERENCER-1 ...)
; compiling (DEFUN A-CLASS-TYPEP-2 ...)

; wrote 
/<>/tests/undefined-classoid-bug-test-8997/undefined-classoid-bug-1.fasl
; compilation finished in 0:00:00.008
; compiling file 
"/<>/tests/undefined-classoid-bug-test-8997/undefined-classoid-bug-2.lisp"
 (written 19 JAN 2019 01:35:56 AM):
; compiling (IN-PACKAGE "CL-USER")
; compiling (DEFUN A-STRUCT-REFERENCER-2 ...)
; compiling (DEFUN A-CLASS-TYPEP ...)
; compiling (DEFSTRUCT A-STRUCT ...)
; compiling (DEFCLASS A-CLASS ...)

; wrote 
/<>/tests/undefined-classoid-bug-test-8997/undefined-classoid-bug-2.fasl
; compilation finished in 0:00:00.019
test undefined-classoid-bug ok

Finished running tests.
Status:
 Expected failure:   threads.pure.lisp / (WAIT-ON-SEMAPHORE 
SEMAPHORE-NOTIFICATION LP-1038034)
 Expected failure:   dynamic-extent.impure.lisp / DX-COMPILER-NOTES
 Expected failure:   fopcompiler.impure.lisp / 
FOPCOMPILER-DEPRECATED-VAR-WARNING
 Expected failure:   full-eval.impure.lisp / INLINE-FUN-CAPTURES-DECL
 Expected failure:   packages.impure.lisp / USE-PACKAGE-CONFLICT-SET
 Expected failure:   packages.impure.lisp / IMPORT-SINGLE-CONFLICT
 Skipped (broken):   threads.impure.lisp / (HASH-TABLE UNSYNCHRONIZED)
 Skipped (broken):   threads.impure.lisp / BACKTRACE
 Failure:timer.impure.lisp / (TIMER THREADED-STRESS)
 (13 tests skipped for this combination of platform and features)
test failed, expected 104 return code, got 1
make[1]: *** [debian/rules:48: override_dh_auto_test] Error 1
make[1]: Leaving directory '/<>'
make: *** [debian/rules:18: binary-indep] Error 2
dpkg-buildpackage: error: debian/rules binary-indep subprocess returned exit 
status 2


(The above is just how the builds ends and not necessarily the most relevant 
part)

The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/sbcl.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.

Bug#919651: marked as done (libperlx-define-perl: missing Breaks+Replaces: libmoops-perl (<= 0.034-1))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 17:35:48 +
with message-id 
and subject line Bug#919651: fixed in libperlx-define-perl 0.101-4
has caused the Debian Bug report #919651,
regarding libperlx-define-perl: missing Breaks+Replaces: libmoops-perl (<= 
0.034-1)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919651: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919651
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: libperlx-define-perl
Version: 0.101-2
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts
Control: block -1 with 919650

Hi,

during a test with piuparts I noticed your package failed to install
because it tries to overwrite other packages files without declaring a
Breaks+Replaces relation.

See policy 7.6 at
https://www.debian.org/doc/debian-policy/ch-relationships.html#overwriting-files-and-replacing-packages-replaces

>From the attached log (scroll to the bottom...):

  Preparing to unpack .../libperlx-define-perl_0.101-2_all.deb ...
  Unpacking libperlx-define-perl (0.101-2) ...
  dpkg: error processing archive 
/var/cache/apt/archives/libperlx-define-perl_0.101-2_all.deb (--unpack):
   trying to overwrite '/usr/share/man/man3/PerlX::Define.3pm.gz', which is 
also in package libmoops-perl 0.034-1
  Errors were encountered while processing:
   /var/cache/apt/archives/libperlx-define-perl_0.101-2_all.deb


libmoops-perl also needs to stop shipping these now duplicated
files (#919650)


cheers,

Andreas


libmoops-perl=0.034-1_libperlx-define-perl=0.101-2.log.gz
Description: application/gzip
--- End Message ---
--- Begin Message ---
Source: libperlx-define-perl
Source-Version: 0.101-4

We believe that the bug you reported is fixed in the latest version of
libperlx-define-perl, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Jonas Smedegaard  (supplier of updated libperlx-define-perl 
package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 18:17:22 +0100
Source: libperlx-define-perl
Binary: libperlx-define-perl
Architecture: source
Version: 0.101-4
Distribution: unstable
Urgency: medium
Maintainer: Debian Perl Group 
Changed-By: Jonas Smedegaard 
Description:
 libperlx-define-perl - cute syntax for defining constants
Closes: 919651
Changes:
 libperlx-define-perl (0.101-4) unstable; urgency=medium
 .
   * Really fix break and replace older libmoops-perl
 (not bogus libmoose).
 Closes: Bug#919651. Thanks to Andreas Beckmann.
Checksums-Sha1:
 c4749e252ce944f71d007b40098b73f8999a41c4 2139 libperlx-define-perl_0.101-4.dsc
 b4da64d35bf0a4ce8d7db2d220c305b7f803d96f 3276 
libperlx-define-perl_0.101-4.debian.tar.xz
 a7eb5f9402d57856f23837bba697811f40ccc0d1 5939 
libperlx-define-perl_0.101-4_amd64.buildinfo
Checksums-Sha256:
 8e8a3e5b0fc64a4b8f24763cb54c3bc229394a0862c9dc20bc0c1ff9df5889f5 2139 
libperlx-define-perl_0.101-4.dsc
 ae4cfb9313efb69e6d859cb03a643eae2f2b83a183226c663aff6b51cc3703f4 3276 
libperlx-define-perl_0.101-4.debian.tar.xz
 a344edcd2e6e609d989ddf55868c2af35b0a7aabfcba98a3111d26aa6339bb91 5939 
libperlx-define-perl_0.101-4_amd64.buildinfo
Files:
 b3b0a0632cc221b70cbba91ff6f6ffd5 2139 perl optional 
libperlx-define-perl_0.101-4.dsc
 76cb4840679500debc32b8f3c02faf5a 3276 perl optional 
libperlx-define-perl_0.101-4.debian.tar.xz
 90ef17805a42db6669a9d51654398059 5939 perl optional 
libperlx-define-perl_0.101-4_amd64.buildinfo

-BEGIN PGP SIGNATURE-

iQIzBAEBCgAdFiEEn+Ppw2aRpp/1PMaELHwxRsGgASEFAlxDXEkACgkQLHwxRsGg
ASHnihAAoa0kLC6zshmM4+nuo62i9FGPp5dlYimWkcTtk5VL7eBdEAUPm2NQeqhT
bhZu91Ye3MvfpXQ+Vto1saTVCOQJ9HkpCToqdhd+pDZTRPruScnbvTQ1IRv3dxZT
s+fVf6UTzqOfZjLQ9E6vnLTjBqeBcFLtJWgPAkXyLlKw6iTkQWly++Mi5/uJkQA0
ZzQ1gEBEDHSLPC2ZQr//aMQkH4EmXGgiEZDB5IxEBZBVccdXGnA4bdqacQDoswcQ
g8FaEC1tUiBFPr4YayCE+JtswLiKm/hySa5eWTq7NQqGTykUuKQujPrPltzJnkrt
0QWwfN706fBIEPvizuTI6E6p/e4EQ1RfSglEnmKaYV2L1Lt4q/1PeyqRZV7QwuAI
fBaBqQrXvaEdvw+rPsRE7Fo0W8flCQ7h+mOfmAvZZGZhZ8ggPUWDxihz2wzjufv0
zXibn5WhsGjNKG5p4+FkxbI8ZAwJqcZuKiRLzkeT23V44trQ94Zt5GGu4u5OgpHi
BhOJ6KxmkIjRByV2RS9SF2seAE8SlrvKJMjO/1N2cqt5oV

Bug#919801: libgoogle-gson-java: FTBFS (Failed to execute goal org.apache.maven.plugins:maven-javadoc-plugin:3.0.1:jar)

[Santiago Vila]

Package: src:libgoogle-gson-java
Version: 2.8.5-2
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep --with javahelper --buildsystem=maven
   dh_update_autotools_config -i -O--buildsystem=maven
   dh_autoreconf -i -O--buildsystem=maven
   dh_auto_configure -i -O--buildsystem=maven
mh_patchpoms -plibgoogle-gson-java --debian-build --keep-pom-version 
--maven-repo=/<>/debian/maven-repo
[ERROR] Cannot find parent dependency 
com.google.code.gson:gson-parent:pom:2.8.5, use --no-parent option to resolve 
this issue or install the parent POM in the Maven repository
   jh_linkjars -i -O--buildsystem=maven
   debian/rules override_dh_auto_build
make[1]: Entering directory '/<>'
cp -Rvp gson/src/main/java-templates/* gson/src/main/java/
'gson/src/main/java-templates/com/google/gson/internal/GsonBuildConfig.java' -> 
'gson/src/main/java/com/google/gson/internal/GsonBuildConfig.java'
sed -i s/\$\{project.version\}/2.8.5/ 
gson/src/main/java/com/google/gson/internal/GsonBuildConfig.java
dh_auto_build

[... snipped ...]

[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:87: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:100: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:102: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:103: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:104: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:105: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:123: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:125: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:126: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:127: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/FieldNamingPolicy.java:128: 
warning - invalid usage of tag >
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Expose.java:37: 
warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Expose.java:38: 
warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Expose.java:39: 
warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/JsonAdapter.java:34:
 warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/JsonAdapter.java:43:
 warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/JsonAdapter.java:51:
 warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/JsonAdapter.java:62:
 warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/JsonAdapter.java:68:
 warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/SerializedName.java:38:
 warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/SerializedName.java:39:
 warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Since.java:39: 
warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Since.java:40: 
warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Since.java:41: 
warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Until.java:41: 
warning - invalid usage of tag @
[ERROR] 
/<>/gson/src/main/java/com/google/gson/annotations/Until.java:42: 
warning - invalid usage of tag @
[ERROR] 
[ERROR] Command line was: /usr/lib/jvm/java-11-openjdk-amd64/bin/javadoc 
@options @packages
[ERROR] 
[ERROR] Refer to the generated Javadoc files in 
'/<>/gson/target/apidocs' dir.
[ERROR] -> [Help 1]
[ERROR] 
[ERROR] To see the full stack trace of the errors, re-run Maven with the -e 
switch.
[ERROR] Re-run Maven using the -X switch to enable full debug logging.
[ERROR] 
[ERROR] For more information about the errors and possible solutions, please 
read the following articles:
[ERROR] [Help 1] 
http://cwiki.apache.org/confluence/display/MAVEN/MojoExecutionException
[ERROR] 
[ERROR] After correcting the problems, you can resume the build with the command
[ERROR]   mvn  -rf :gson
dh_auto_build: /usr/lib/jvm/default-java/bin/java -noverify -cp 
/usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven 
-Dmaven.multiModuleProjectDirectory=/<> 
-Dclass

Bug#919805: redmine: FTBFS (Could not find gem mail)

[Santiago Vila]

Package: src:redmine
Version: 3.4.6-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep
   dh_update_autotools_config -i
   dh_autoreconf -i
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<>'
./debian/check-locales
bundle --local --quiet
`/sbuild-nonexistent` is not a directory.
Bundler will use `/tmp/bundler-20190119-2834-1oobqh6' as your home directory 
temporarily.
Could not find gem 'mail (~> 2.6.4)' in any of the gem sources listed in your
Gemfile.
make[1]: *** [debian/rules:9: override_dh_auto_configure] Error 7
make[1]: Leaving directory '/<>'
make: *** [debian/rules:5: build-indep] Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


(The above is just how the builds ends and not necessarily the most relevant 
part)

The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/redmine.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.

Bug#919799: cockpit: FTBFS (failing tests)

[Santiago Vila]

Package: src:cockpit
Version: 185-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep
   dh_update_autotools_config -i
   dh_autoreconf -i
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<>'
set -ex; if [ -d debian/git-patches ]; then \
git init; \
git config user.email "unu...@example.com"; git config user.name 
"Unused"; \
git config core.autocrlf false; git config core.safecrlf false && git 
config gc.auto 0; \
git add -f . && git commit -a -q -m "Base" && git tag -a initial 
--message="initial"; \
git am --whitespace=nowarn debian/git-patches/*.patch; \
touch -r $(git diff --name-only initial..HEAD) .git; \
fi

[... snipped ...]

1..0 # skip web browser not found

SKIP: dist/machines/test-machines
=

# ./tools/tap-driver --test-name dist/machines/test-machines.html --log-file 
dist/machines/test-machines.log --trs-file dist/machines/test-machines.trs 
--color-tests no --enable-hard-errors yes --expect-failure no -- 
/usr/bin/python3 ./test/common/tap-cdp --strip=/<>/ -- 
./test-server ./dist/machines/test-machines.html
1..0 # skip web browser not found

SKIP: dist/networkmanager/test-utils


# ./tools/tap-driver --test-name dist/networkmanager/test-utils.html --log-file 
dist/networkmanager/test-utils.log --trs-file 
dist/networkmanager/test-utils.trs --color-tests no --enable-hard-errors yes 
--expect-failure no -- /usr/bin/python3 ./test/common/tap-cdp 
--strip=/<>/ -- ./test-server ./dist/networkmanager/test-utils.html
1..0 # skip web browser not found

SKIP: dist/storaged/test-util
=

# ./tools/tap-driver --test-name dist/storaged/test-util.html --log-file 
dist/storaged/test-util.log --trs-file dist/storaged/test-util.trs 
--color-tests no --enable-hard-errors yes --expect-failure no -- 
/usr/bin/python3 ./test/common/tap-cdp --strip=/<>/ -- 
./test-server ./dist/storaged/test-util.html
1..0 # skip web browser not found


Testsuite summary for Cockpit 185

# TOTAL: 879
# PASS:  803
# SKIP:  45
# XFAIL: 0
# FAIL:  31
# XPASS: 0
# ERROR: 0

See ./test-suite.log
Please report to de...@lists.cockpit-project.org

make[4]: *** [Makefile:8130: test-suite.log] Error 1
make[4]: Leaving directory '/<>'
make[3]: *** [Makefile:8238: check-TESTS] Error 2
make[3]: Leaving directory '/<>'
make[2]: *** [Makefile:8800: check-am] Error 2
make[2]: Leaving directory '/<>'
make[1]: *** [Makefile:8802: check] Error 2
make[1]: Leaving directory '/<>'
dh_auto_test: make -j1 check VERBOSE=1 returned exit code 2
make: *** [debian/rules:18: build-indep] Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


(The above is just how the builds ends and not necessarily the most relevant 
part)

The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/cockpit.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.

Bug#919802: libjstun-java: FTBFS (The code being documented uses packages in the unnamed module)

[Santiago Vila]

Package: src:libjstun-java
Version: 0.7.3+dfsg-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep --with javahelper
   dh_update_autotools_config -i
   jh_linkjars -i
   jh_build -i
find src/de -name *.java -and -type f -print0 | xargs -s 512000 -0 
/usr/lib/jvm/default-java/bin/javac -g -cp 
/usr/share/java/slf4j-jdk14.jar:/usr/share/java/slf4j-api.jar:/usr/share/java/junit.jar:debian/_jh_build.libjstun-java
 -d debian/_jh_build.libjstun-java -source 1.7 -target 1.7 -encoding ISO8859-1
warning: [options] bootstrap class path not set in conjunction with -source 7
Note: src/de/javawi/jstun/test/demo/ice/ICENegociator.java uses unchecked or 
unsafe operations.
Note: Recompile with -Xlint:unchecked for details.
1 warning
find src/de -name *.java -and -type f -print0 | xargs -s 512000 -0 
/usr/lib/jvm/default-java/bin/javadoc -locale en_US -link 
/usr/share/doc/default-jdk-doc/api -link 
/usr/share/doc/default-jre-headless/api -classpath 
/usr/share/java/slf4j-jdk14.jar:/usr/share/java/slf4j-api.jar:/usr/share/java/junit.jar:debian/_jh_build.libjstun-java
 -d debian/_jh_build.javadoc/api -quiet -encoding ISO8859-1 -notimestamp 
-source 1.7
Creating destination directory: "debian/_jh_build.javadoc/api/"
javadoc: error - The code being documented uses packages in the unnamed module, 
but the packages defined in /usr/share/doc/default-jdk-doc/api/ are in named 
modules.
javadoc: error - The code being documented uses packages in the unnamed module, 
but the packages defined in /usr/share/doc/default-jre-headless/api/ are in 
named modules.
2 errors
make: *** [debian/rules:11: build-indep] Error 123
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


(The above is just how the builds ends and not necessarily the most relevant 
part)

The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/libjstun-java.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.

Bug#919800: jackson-databind: FTBFS (Failed to execute goal org.apache.maven.plugins:maven-javadoc-plugin:3.0.1:jar)

[Santiago Vila]

Package: src:jackson-databind
Version: 2.9.8-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep --with javahelper
   dh_update_autotools_config -i
   dh_autoreconf -i
   dh_auto_configure -i
mh_patchpoms -plibjackson2-databind-java --debian-build 
--keep-pom-version --maven-repo=/<>/debian/maven-repo
   jh_linkjars -i
   dh_auto_build -i
/usr/lib/jvm/default-java/bin/java -noverify -cp 
/usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven 
-Dmaven.multiModuleProjectDirectory=/<> 
-Dclassworlds.conf=/etc/maven/m2-debian.conf 
-Dproperties.file.manual=/<>/debian/maven.properties 
org.codehaus.plexus.classworlds.launcher.Launcher 
-s/etc/maven/settings-debian.xml -Ddebian.dir=/<>/debian 
-Dmaven.repo.local=/<>/debian/maven-repo --batch-mode package 
javadoc:jar javadoc:aggregate -DskipTests -Dnotimestamp=true -Dlocale=en_US
WARNING: An illegal reflective access operation has occurred
WARNING: Illegal reflective access by 
com.google.inject.internal.cglib.core.$ReflectUtils$1 
(file:/usr/share/maven/lib/guice.jar) to method 
java.lang.ClassLoader.defineClass(java.lang.String,byte[],int,int,java.security.ProtectionDomain)
WARNING: Please consider reporting this to the maintainers of 
com.google.inject.internal.cglib.core.$ReflectUtils$1
WARNING: Use --illegal-access=warn to enable warnings of further illegal 
reflective access operations
WARNING: All illegal access operations will be denied in a future release

[... snipped ...]

[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/DeserializationFeature.java:87:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/DeserializationFeature.java:87:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/DeserializationFeature.java:89:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/deser/std/EnumMapDeserializer.java:22:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/deser/std/EnumMapDeserializer.java:22:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:635:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:646:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:658:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:998:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:1010:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:1023:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:635:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:646:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:658:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:998:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:1010:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/AnnotationIntrospector.java:1023:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/module/SimpleModule.java:17:
 warning - Tag @link: reference not found: Module
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/node/ArrayNode.java:311:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/type/TypeFactory.java:918:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/type/TypeFactory.java:918:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/type/TypeFactory.java:927:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/type/TypeFactory.java:954:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/type/TypeFactory.java:954:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/type/TypeFactory.java:963:
 warning - invalid usage of tag >
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/module/SimpleModule.java:17:
 warning - Tag @link: reference not found: Module
[ERROR] 
/<>/src/main/java/com/fasterxml/jackson/databind/module/SimpleModule.jav

Bug#919804: ndcube: FTBFS (No module named 'sphinx_astropy')

[Santiago Vila]

Package: src:ndcube
Version: 1.0.1-2
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep --with python3,sphinxdoc --buildsystem=pybuild
   dh_update_autotools_config -i -O--buildsystem=pybuild
   dh_autoreconf -i -O--buildsystem=pybuild
   dh_auto_configure -i -O--buildsystem=pybuild
I: pybuild base:217: python3.7 setup.py config 
running config
   debian/rules override_dh_auto_build
make[1]: Entering directory '/<>'
dh_auto_build
I: pybuild base:217: /usr/bin/python3 setup.py build 
running build
running build_py
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/_sunpy_init.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/ndcube_sequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/ndcube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/version.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
creating 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/visualization
copying ndcube/visualization/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/visualization
copying ndcube/visualization/animation.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/visualization
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/wcs.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/cube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/sequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_ndcubesequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_utils_cube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_utils_wcs.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/setup_package.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_utils_sequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/helpers.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_ndcube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
copying ndcube/mixins/plotting.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
copying ndcube/mixins/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
copying ndcube/mixins/ndslicing.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils/tests
copying ndcube/utils/tests/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils/tests
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/data
copying ndcube/data/README.rst -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/data
copying ndcube/tests/coveragerc -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
PYTHONPATH=. sphinx-build -D html_last_updated_fmt="November 19, 2018" -D 
html_show_copyright=0 -N -bhtml docs/ build/html # HTML generator
Running Sphinx v1.7.9

Configuration error:
There is a programable error in your configuration file:

Traceback (most recent call last):
  File "/usr/lib/python3/dist-packages/sphinx/config.py", line 161, in __init__
execfile_(filename, config)
  File "/usr/lib/python3/dist-packages/sphinx/util/pycompat.py", line 150, in 
execfile_
exec_(code, _globals)
  File "conf.py", line 42, in 
from astropy_helpers.sphinx.conf import *
  File "/usr/lib/python3/dist-packages/astropy_helpers/sphinx/conf.py", line 3, 
in 
from sphinx_astropy.conf import *
ModuleNotFoundError: No module named 'sphinx_astropy'

make[1]: *** [debian/rules:18: override_dh_auto_build] Error 2
make[1]: Leaving directory '/<>'
make: *** [debian/rules:14: build-indep] Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


(The above is just how the builds ends and not necessarily the most relevant 
part)

The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/ndcube.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.

Bug#919798: antlr4: FTBFS (Failed to execute goal org.apache.maven.plugins:maven-javadoc-plugin:3.0.1:jar)

[Santiago Vila]

Package: src:antlr4
Version: 4.7.1-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep
   dh_update_autotools_config -i
   dh_autoreconf -i
   dh_auto_configure -i
mh_patchpoms -pantlr4 --debian-build --keep-pom-version 
--maven-repo=/<>/debian/maven-repo
   debian/rules override_dh_auto_build
make[1]: Entering directory '/<>'
cp -r debian/generated-sources/antlr4/* runtime/Java/src/
dh_auto_build
/usr/lib/jvm/default-java/bin/java -noverify -cp 
/usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven 
-Dmaven.multiModuleProjectDirectory=/<> 
-Dclassworlds.conf=/etc/maven/m2-debian.conf 
-Dproperties.file.manual=/<>/debian/maven.properties 
org.codehaus.plexus.classworlds.launcher.Launcher 
-s/etc/maven/settings-debian.xml -Ddebian.dir=/<>/debian 
-Dmaven.repo.local=/<>/debian/maven-repo --batch-mode package 
javadoc:jar javadoc:aggregate -DskipTests -Dnotimestamp=true -Dlocale=en_US
WARNING: An illegal reflective access operation has occurred
WARNING: Illegal reflective access by 
com.google.inject.internal.cglib.core.$ReflectUtils$1 
(file:/usr/share/maven/lib/guice.jar) to method 
java.lang.ClassLoader.defineClass(java.lang.String,byte[],int,int,java.security.ProtectionDomain)
WARNING: Please consider reporting this to the maintainers of 
com.google.inject.internal.cglib.core.$ReflectUtils$1

[... snipped ...]

[ERROR] Exit code: 1 - javadoc: error - The code being documented uses modules 
but the packages defined in https://docs.oracle.com/javase/7/docs/api/ are in 
the unnamed module.
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/CharStreams.java:27: 
warning - invalid usage of tag >
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/CodePointCharStream.java:19:
 warning - invalid usage of tag >
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/ParserInterpreter.java:72:
 warning - invalid usage of tag >
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/ParserInterpreter.java:72:
 warning - invalid usage of tag >
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/RuleContext.java:34: 
warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/RuleContext.java:35: 
warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/RuleContext.java:37: 
warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/RuleContext.java:51: 
warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/RuleContext.java:52: 
warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/RuleContext.java:53: 
warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/RuleContext.java:166: 
warning - invalid usage of tag {@see ParseTree#setParent}
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:16:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:18:
 warning - invalid usage of tag >
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:23:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:37:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:23:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:37:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/tree/ParseTreeListener.java:15:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:23:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:37:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:23:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:37:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:23:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/atn/CodePointTransitions.java:37:
 warning - invalid usage of tag <
[ERROR] 
/<>/runtime/Java/src/org/antlr/v4/runtime/ParserInterpreter.java:72:
 warning - invalid usage of tag >
[ERROR] 
[ERROR] Command line was: /usr/lib/jvm/java-11-openjdk-amd64/bin/javadoc 
@options @packages
[ERROR] 
[ERROR] Refer to the generated Javadoc files in 
'/<>/runtime/Java/target/apidocs' dir.
[ERROR] -> [Help 1]
[ERROR] 
[ERROR] To see the full stack trace of the errors, re-run Maven with the -e 
switch.
[ERROR] Re-run Maven using the -X switch to enable full debug logging.
[ERROR] 

Bug#919803: mac-widgets: FTBFS (The code being documented uses packages in the unnamed module)

[Santiago Vila]

Package: src:mac-widgets
Version: 0.10.0+svn416-dfsg1-2
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep --with javahelper
dh: Compatibility levels before 9 are deprecated (level 7 in use)
   dh_update_autotools_config -i
   jh_linkjars -i
   debian/rules override_jh_build
make[1]: Entering directory '/<>/mac-widgets-0.10.0+svn416-dfsg1'
ln -s source/com com
ln -s 
/<>/mac-widgets-0.10.0+svn416-dfsg1/demo/com/explodingpixels/macwidgets/icons
 com/explodingpixels/macwidgets/icons
JAVA_HOME=/usr/lib/jvm/default-java \
CLASSPATH=/usr/share/java/forms.jar \
JH_JAR_EXTRA="com/explodingpixels/macwidgets/images 
com/explodingpixels/widgets/images com/explodingpixels/macwidgets/icons" \
jh_build mac_widgets.jar source demo
find source demo -name *.java -and -type f -print0 | xargs -s 512000 -0 
/usr/lib/jvm/default-java/bin/javac -g -cp 
/usr/share/java/forms.jar:debian/_jh_build.mac_widgets -d 
debian/_jh_build.mac_widgets -source 1.7 -target 1.7 -encoding ISO8859-1

[... snipped ...]

source/com/explodingpixels/macwidgets/WidgetColorScheme.java:28: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:37: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:19: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:28: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:37: warning - Tag 
@link: reference not found: Painter
javadoc: warning - Tag @link: reference not found: Painter
javadoc: warning - Tag @link: reference not found: Painter
javadoc: warning - Tag @link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:19: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:28: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:37: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetStandardColorScheme.java:14: 
warning - Tag @link: reference not found: Painter
javadoc: warning - Tag @link: reference not found: Painter
javadoc: warning - Tag @link: reference not found: Painter
javadoc: warning - Tag @link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:19: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:28: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:37: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/plaf/HudCheckBoxUI.java:32: warning - Tag 
@link: reference not found: javax.swing.plaf.CheckBoxUI
source/com/explodingpixels/macwidgets/plaf/HudCheckBoxUI.java:40: warning - Tag 
@link: reference not found: javax.swing.plaf.CheckBoxUI
source/com/explodingpixels/macwidgets/plaf/HudCheckBoxUI.java:32: warning - Tag 
@link: reference not found: javax.swing.plaf.CheckBoxUI
source/com/explodingpixels/macwidgets/plaf/HudCheckBoxUI.java:40: warning - Tag 
@link: reference not found: javax.swing.plaf.CheckBoxUI
source/com/explodingpixels/macwidgets/plaf/HudPaintingUtils.java:156: warning - 
invalid usage of tag {@link Graphics2D) if the given
 {@link Component
source/com/explodingpixels/macwidgets/plaf/HudPaintingUtils.java:156: warning - 
invalid usage of tag {@link Graphics2D) if the given
 {@link Component
source/com/explodingpixels/macwidgets/ActivePanel.java:13: warning - Tag @link: 
reference not found: com.explodingpixels.WidgetColorScheme
source/com/explodingpixels/macwidgets/WidgetStandardColorScheme.java:14: 
warning - Tag @link: reference not found: Painter
source/com/explodingpixels/macwidgets/ActivePanel.java:13: warning - Tag @link: 
reference not found: com.explodingpixels.WidgetColorScheme
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:19: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:28: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/WidgetColorScheme.java:37: warning - Tag 
@link: reference not found: Painter
source/com/explodingpixels/macwidgets/plaf/HudCheckBoxUI.java:32: warning - Tag 
@link: reference not found: javax.swing.plaf.CheckBoxUI
source/com/explodingpixels/macwidgets/plaf/HudCheckBoxUI.java:40: warning - Tag 
@link: reference not found: javax.swing.plaf.CheckBoxUI
source/com/explodingpixels/macwidgets/plaf/HudPaintingUtils.java:156: warning - 
invalid usage of tag {@link Graphics2D) if the given
 {@link Component
source/com/ex

Bug#903698: sphinxbase: build appears broken for multiple python3 versions

[anarcat]

user debian-rele...@lists.debian.org
usertag nn + bsp-2019-01-ca-montreal   
tags -1 -patch +moreinfo
thank you

On Thu, Jan 03, 2019 at 10:16:13AM +0100, Samuel Thibault wrote:
> Oops, this bug was erroneously closed because its mention was remaining
> in the sphinxbase changelog.

So after reviewing this bug during the montreal BSP, I'm a little
confused - it shows up in the "sponsor" UDD dashboard because it's
marked as affecting buster and sid but with a patch.

Yet, I don't see a recent patch that will fix the issue in dh-python.
I'm not even sure there *is* an issue in dh-python at all anymore...

Could someone summarize the current state of this bug report?

Thanks!

-- 
Be yourself. Everyone else is already taken!
- Oscar Wilde


signature.asc
Description: PGP signature

Bug#919799: marked as done (cockpit: FTBFS (failing tests))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 18:43:32 +0100
with message-id <20190119174332.heneqloqjumqpa6f@nucold>
and subject line Closing, duplicate of #918439
has caused the Debian Bug report #919799,
regarding cockpit: FTBFS (failing tests)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919799: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919799
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: src:cockpit
Version: 185-1
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep
   dh_update_autotools_config -i
   dh_autoreconf -i
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<>'
set -ex; if [ -d debian/git-patches ]; then \
git init; \
git config user.email "unu...@example.com"; git config user.name 
"Unused"; \
git config core.autocrlf false; git config core.safecrlf false && git 
config gc.auto 0; \
git add -f . && git commit -a -q -m "Base" && git tag -a initial 
--message="initial"; \
git am --whitespace=nowarn debian/git-patches/*.patch; \
touch -r $(git diff --name-only initial..HEAD) .git; \
fi

[... snipped ...]

1..0 # skip web browser not found

SKIP: dist/machines/test-machines
=

# ./tools/tap-driver --test-name dist/machines/test-machines.html --log-file 
dist/machines/test-machines.log --trs-file dist/machines/test-machines.trs 
--color-tests no --enable-hard-errors yes --expect-failure no -- 
/usr/bin/python3 ./test/common/tap-cdp --strip=/<>/ -- 
./test-server ./dist/machines/test-machines.html
1..0 # skip web browser not found

SKIP: dist/networkmanager/test-utils


# ./tools/tap-driver --test-name dist/networkmanager/test-utils.html --log-file 
dist/networkmanager/test-utils.log --trs-file 
dist/networkmanager/test-utils.trs --color-tests no --enable-hard-errors yes 
--expect-failure no -- /usr/bin/python3 ./test/common/tap-cdp 
--strip=/<>/ -- ./test-server ./dist/networkmanager/test-utils.html
1..0 # skip web browser not found

SKIP: dist/storaged/test-util
=

# ./tools/tap-driver --test-name dist/storaged/test-util.html --log-file 
dist/storaged/test-util.log --trs-file dist/storaged/test-util.trs 
--color-tests no --enable-hard-errors yes --expect-failure no -- 
/usr/bin/python3 ./test/common/tap-cdp --strip=/<>/ -- 
./test-server ./dist/storaged/test-util.html
1..0 # skip web browser not found


Testsuite summary for Cockpit 185

# TOTAL: 879
# PASS:  803
# SKIP:  45
# XFAIL: 0
# FAIL:  31
# XPASS: 0
# ERROR: 0

See ./test-suite.log
Please report to de...@lists.cockpit-project.org

make[4]: *** [Makefile:8130: test-suite.log] Error 1
make[4]: Leaving directory '/<>'
make[3]: *** [Makefile:8238: check-TESTS] Error 2
make[3]: Leaving directory '/<>'
make[2]: *** [Makefile:8800: check-am] Error 2
make[2]: Leaving directory '/<>'
make[1]: *** [Makefile:8802: check] Error 2
make[1]: Leaving directory '/<>'
dh_auto_test: make -j1 check VERBOSE=1 returned exit code 2
make: *** [debian/rules:18: build-indep] Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


(The above is just how the builds ends and not necessarily the most relevant 
part)

The build was made in my autobuilder with "dpkg-buildpackage -A"
and it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/cockpit.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web page for this package.

Thanks.
--- End Message ---
--- Begin Message ---
This was really a bug in libssh-4 but it didn't propagate to testing,
that's why cockpit still fails.

Thanks.--- End Message ---

Bug#855958: xserver-xorg-video-nv: not installable in sid, on any architecture

[Andreas Beckmann]

Followup-For: Bug #855958
Control: retitle -1 xserver-xorg-video-nv: FTBFS with current Xorg: 
nv_driver.c:1181:6: error: too many arguments to function 
'pScreen->BlockHandler'
Control: tags -1 ftbfs

Hi,

  CC   nv_driver.lo
In file included from ../../src/nv_include.h:19,
 from ../../src/nv_driver.c:31:
/usr/include/xorg/xf86PciInfo.h:50:2: warning: #warning "xf86PciInfo.h is 
deprecated.  For greater compatibility, drivers should include necessary PCI 
IDs locally rather than relying on this file from xorg-server
." [-Wcpp]
 #warning "xf86PciInfo.h is deprecated.  For greater compatibility, drivers 
should include necessary PCI IDs locally rather than relying on this file from 
xorg-server."
  ^~~
In file included from ../../src/nv_include.h:34,
 from ../../src/nv_driver.c:31:
../../src/nv_driver.c: In function 'NVPciProbe':
../../src/nv_const.h:5:17: warning: format '%x' expects argument of type 
'unsigned int', but argument 4 has type 'CARD32' {aka 'const long unsigned 
int'} [-Wformat=]
 #define NV_NAME "NV"
 ^~~~
../../src/nv_driver.c:916:20: note: in expansion of macro 'NV_NAME'
NV_NAME ": The PCI device 0x%x (%s) at 
%2.2d@%2.2d:%2.2d:%1.1d has a kernel module claiming it.\n",
^~~
../../src/nv_driver.c:916:49: note: format string is defined here
NV_NAME ": The PCI device 0x%x (%s) at 
%2.2d@%2.2d:%2.2d:%1.1d has a kernel module claiming it.\n",
~^
%lx
In file included from ../../src/nv_include.h:34,
 from ../../src/nv_driver.c:31:
../../src/nv_const.h:5:17: warning: format '%x' expects argument of type 
'unsigned int', but argument 4 has type 'CARD32' {aka 'const long unsigned 
int'} [-Wformat=]
 #define NV_NAME "NV"
 ^~~~
../../src/nv_driver.c:929:24: note: in expansion of macro 'NV_NAME'
NV_NAME ": Ignoring unsupported device 0x%x (%s) at 
%2.2d@%2.2d:%2.2d:%1.1d\n",
^~~
../../src/nv_driver.c:929:66: note: format string is defined here
NV_NAME ": Ignoring unsupported device 0x%x (%s) at 
%2.2d@%2.2d:%2.2d:%1.1d\n",
 ~^
 %lx
In file included from ../../src/nv_include.h:34,
 from ../../src/nv_driver.c:31:
../../src/nv_const.h:5:17: warning: format '%x' expects argument of type 
'unsigned int', but argument 4 has type 'CARD32' {aka 'const long unsigned 
int'} [-Wformat=]
 #define NV_NAME "NV"
 ^~~~
../../src/nv_driver.c:933:24: note: in expansion of macro 'NV_NAME'
NV_NAME ": Ignoring unsupported device 0x%x at 
%2.2d@%2.2d:%2.2d:%1.1d\n",
^~~
../../src/nv_driver.c:933:66: note: format string is defined here
NV_NAME ": Ignoring unsupported device 0x%x at 
%2.2d@%2.2d:%2.2d:%1.1d\n",
 ~^
 %lx
../../src/nv_driver.c: In function 'NVBlockHandler':
../../src/nv_driver.c:1181:6: error: too many arguments to function 
'pScreen->BlockHandler'
 (*pScreen->BlockHandler) (BLOCKHANDLER_ARGS);
 ~^~~
../../src/nv_driver.c:1182:27: warning: assignment to 
'ScreenBlockHandlerProcPtr' {aka 'void (*)(struct _Screen *, void *)'} from 
incompatible pointer type 'void (*)(struct _Screen *, void *, void *)' 
[-Wincompatible-pointer-types]
 pScreen->BlockHandler = NVBlockHandler;
   ^
../../src/nv_driver.c: In function 'NVScreenInit':
../../src/nv_driver.c:2593:16: warning: implicit declaration of function 
'xf86DisableRandR'; did you mean 'xf86DisableIO'? 
[-Wimplicit-function-declaration]
xf86DisableRandR();
^~~~
xf86DisableIO
../../src/nv_driver.c:2620:27: warning: assignment to 
'ScreenBlockHandlerProcPtr' {aka 'void (*)(struct _Screen *, void *)'} from 
incompatible pointer type 'void (*)(struct _Screen *, void *, void *)' 
[-Wincompatible-pointer-types]
 pScreen->BlockHandler = NVBlockHandler;
   ^
make[3]: *** [Makefile:582: nv_driver.lo] Error 1


Andreas

Processed: Re: xserver-xorg-video-nv: not installable in sid, on any architecture

[Debian Bug Tracking System]

Processing control commands:

> retitle -1 xserver-xorg-video-nv: FTBFS with current Xorg: 
> nv_driver.c:1181:6: error: too many arguments to function 
> 'pScreen->BlockHandler'
Bug #855958 [xserver-xorg-video-nv] xserver-xorg-video-nv: not installable in 
sid, on any architecture
Changed Bug title to 'xserver-xorg-video-nv: FTBFS with current Xorg: 
nv_driver.c:1181:6: error: too many arguments to function 
'pScreen->BlockHandler'' from 'xserver-xorg-video-nv: not installable in sid, 
on any architecture'.
> tags -1 ftbfs
Bug #855958 [xserver-xorg-video-nv] xserver-xorg-video-nv: FTBFS with current 
Xorg: nv_driver.c:1181:6: error: too many arguments to function 
'pScreen->BlockHandler'
Added tag(s) ftbfs.

-- 
855958: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=855958
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: 903698 correction

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> user debian-rele...@lists.debian.org
Setting user to debian-rele...@lists.debian.org (was b...@sourcerer.ca).
> usertag 903698 + bsp-2019-01-ca-montreal
There were no usertags set.
Usertags are now: bsp-2019-01-ca-montreal.
> tags 903698 -patch +moreinfo
Bug #903698 [dh-python] sphinxbase: build appears broken for multiple python3 
versions
Removed tag(s) patch.
Bug #903698 [dh-python] sphinxbase: build appears broken for multiple python3 
versions
Added tag(s) moreinfo.
> thank you
Stopping processing here.

Please contact me if you need assistance.
-- 
903698: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=903698
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#915768: marked as done (mangler: B-D libg15-dev libg15daemon-client-dev are no longer available)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 18:34:38 +
with message-id 
and subject line Bug#915768: fixed in mangler 1.2.5-4.1
has caused the Debian Bug report #915768,
regarding mangler: B-D libg15-dev libg15daemon-client-dev are no longer 
available
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
915768: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=915768
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Source: mangler
Version: 1.2.5-4
Severity: serious
Tags: sid buster
User: debian...@lists.debian.org
Usertags: piuparts
Control: affects -1 + libventrilo3-0

Hi,

the
  Build-Depends: libg15-dev, libg15daemon-client-dev
and the
  Depends: libg15daemon-client1
are no longer available in sid.


Andreas
--- End Message ---
--- Begin Message ---
Source: mangler
Source-Version: 1.2.5-4.1

We believe that the bug you reported is fixed in the latest version of
mangler, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 915...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Christopher Knadle  (supplier of updated mangler 
package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Thu, 17 Jan 2019 17:56:52 +
Source: mangler
Binary: mangler libventrilo3-0 libventrilo-dev
Architecture: source
Version: 1.2.5-4.1
Distribution: unstable
Urgency: medium
Maintainer: Vincent Cheng 
Changed-By: Christopher Knadle 
Description:
 libventrilo-dev - library for communicating with Ventrilo servers (development)
 libventrilo3-0 - library for communicating with Ventrilo servers
 mangler- Ventrilo compatible client for Linux
Closes: 915768
Changes:
 mangler (1.2.5-4.1) unstable; urgency=medium
 .
   * Non-maintainer upload.
 .
   [ William Panlener ]
   * debian/control:
 - Remove libg15 Build-Depends (g15 library has been removed)
   (Closes: #915768)
   * debian/rules:
 - Disable g15 in dh_auto_configure
Checksums-Sha1:
 02dc65c7612ef7c217f2b7e0ae2670455867737b 2154 mangler_1.2.5-4.1.dsc
 94b0a309a03449bb9899681f3f502fe269faa48c 2108367 mangler_1.2.5.orig.tar.gz
 15759113adee09361fad38b63ebcb929e7ba39e0 4872 mangler_1.2.5-4.1.debian.tar.xz
 dc8e757ad53e277f64050ac348c53b148525b6ca 6874 
mangler_1.2.5-4.1_source.buildinfo
Checksums-Sha256:
 4b5403f5c334a2313a29d1872fe55f5f7356af024aef7b4bdbba8fb08dfe64b9 2154 
mangler_1.2.5-4.1.dsc
 53fcce24d7e1e28a41784204a8f946ecd131eec82bf1db10f8d552a06b6ceb67 2108367 
mangler_1.2.5.orig.tar.gz
 59ebba1f354bd0ce93c65b21fe01b3a7606bb6ef5e6d06640d8a8fd2c175fe3b 4872 
mangler_1.2.5-4.1.debian.tar.xz
 11a0a4d14242abb39d1621c63928c2a5165b46410027b5fe23664ae55ef50d3b 6874 
mangler_1.2.5-4.1_source.buildinfo
Files:
 d0004647626ac972c7f75dcbd150e975 2154 net optional mangler_1.2.5-4.1.dsc
 c1d23c6e4b1d3eef48fb2cc34da1329c 2108367 net optional mangler_1.2.5.orig.tar.gz
 0c733b7b5d6d674163548fed88eb3c4a 4872 net optional 
mangler_1.2.5-4.1.debian.tar.xz
 9efe72ba6a32f9346687d800050fd941 6874 net optional 
mangler_1.2.5-4.1_source.buildinfo

-BEGIN PGP SIGNATURE-

iQIzBAEBCgAdFiEEe1KzyGmRW/4DhtV6ieLKD9m6RHAFAlxAwlkACgkQieLKD9m6
RHCO1Q/+NrU+PZ/QDOf1OmFIfVqyq0j1ir3gHnek1SfbUtxkQgBsl7kxFBtqTqus
0a+cTcWTGFWUXKgDpB2k/IgJgqISYcPri7UW4qJTFzsU1kCmyTZOoj1snteapt+3
sv+DLzICLbNsgrr9clwFX6OoSZn4ISc9+sZL/EXSTZP4G8PlH2EKvytB/m2UfyIN
WdIz0j8XmQ7HP+zaz+DHkY2f1bIujce2xpgYRSoWpaj+8lWu9TiBsl2fKJDgkCL6
CjydJKOXhRk7G8jsuwIIAeSgzm1pxZ6Sv+ggbhV6VfjnPlNGskvUAo3uN06h4IMZ
qPzfnG9s2hvhEtnjIpM3O1zsP+HM3fPbRToLzHmx4RQMqsJnaF3g7gaJtJ3V+AjY
Jb4lSoN6lKZG3+i/1eFGi4/vZU7LfmreA/9Wfa33xSkliIBfPv7yZZ3TT8nIThbm
rb/+DNZENucjkK6FLBCs0hle7t5k/QextUjBYgxLfhQmITnagTACV/RWUo54TJlA
bauGmJXlPJxy4Zvwr6GCymfdYQKech1PkJz5RsaYO0mmxaHqv9kCD8Bb05pZKawr
IAu9FOQSHqH8bXn36Vdm1bKYrn1P2Y3EBzOZhiJv+Ff7hYGsAaYzCP7xxvuY4n2g
JrZPdRgxX/UQUtqHIN4HoreTzLfsN3T+7ulZd/79onI3xb44Cp0=
=CYzG
-END PGP SIGNATURE End Message ---

Bug#919217: Acknowledgement (Missing dependency on devscripts)

[anarcat]

tags 919217 +pendingo
user debian-rele...@lists.debian.org
usertag 919217 + bsp-2019-01-ca-montreal   
thanks

On Mon, Jan 14, 2019 at 09:27:08PM +0100, Jeroen Dekkers wrote:
> Control: tag -1 +patch
> 
> https://salsa.debian.org/jelmer/lintian-brush/merge_requests/1

That MR was accepted and jelmer will upload the package this weekend.

A.

Processed (with 1 error): Re: Bug#919217: Acknowledgement (Missing dependency on devscripts)

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 919217 +pendingo
Unknown tag/s: pendingo.
Recognized are: patch wontfix moreinfo unreproducible help security upstream 
pending confirmed ipv6 lfs d-i l10n newcomer a11y ftbfs fixed-upstream fixed 
fixed-in-experimental sid experimental potato woody sarge sarge-ignore etch 
etch-ignore lenny lenny-ignore squeeze squeeze-ignore wheezy wheezy-ignore 
jessie jessie-ignore stretch stretch-ignore buster buster-ignore bullseye 
bullseye-ignore.

Bug #919217 [lintian-brush] Missing dependency on devscripts
Requested to add no tags; doing nothing.
> user debian-rele...@lists.debian.org
Setting user to debian-rele...@lists.debian.org (was anar...@orangeseeds.org).
> usertag 919217 + bsp-2019-01-ca-montreal
There were no usertags set.
Usertags are now: bsp-2019-01-ca-montreal.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919217: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919217
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: Re: Bug#909974: backports.ssl-match-hostname should be removed for buster

[Debian Bug Tracking System]

Processing control commands:

> severity 909974 important
Bug #909974 [docker-compose] remove unneeded dependency on 
backports.ssl-match-hostname
Severity set to 'important' from 'serious'

-- 
869896: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=869896
909974: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=909974
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#869896: Bug#909974: backports.ssl-match-hostname should be removed for buster

[Felipe Sateler]

Control: severity 909974 important

On Fri, Jan 11, 2019 at 10:15 AM Felipe Sateler  wrote:

>
>
> On Tue, Oct 2, 2018 at 4:22 PM Felipe Sateler  wrote:
>
>> Hi Matthias, Ivo,
>>
>> On Sun, 30 Sep 2018 22:59:26 +0200 Ivo De Decker 
>> wrote:
>> > clone 869896 -1
>> > retitle -1 remove unneeded dependency on backports.ssl-match-hostname
>> > block 869896 by -1
>> > clone -1 -2 -3 -4 -5
>> > reassign -1 libcloud
>> > reassign -2 python-docker
>> > reassign -3 websocket-client
>> > reassign -4 docker-compose
>> > reassign -5 sagemath
>> > thanks
>>
>
> Turns out the version of match_hostname in py2 does not accept ip
> addresses:
>
> py2:
> ssl.match_hostname = match_hostname(cert, hostname)
> Verify that *cert* (in decoded format as returned by
> SSLSocket.getpeercert()) matches the *hostname*.  RFC 2818 and RFC 6125
> rules are followed, but IP addresses are not accepted for *hostname*.
>
> CertificateError is raised on failure. On success, the function
> returns nothing.
>
> py3
> ssl.match_hostname = match_hostname(cert, hostname)
> Verify that *cert* (in decoded format as returned by
> SSLSocket.getpeercert()) matches the *hostname*.  RFC 2818 and RFC 6125
> rules are followed.
>
> The function matches IP addresses rather than dNSNames if hostname is a
> valid ipaddress string. IPv4 addresses are supported on all platforms.
> IPv6 addresses are supported on platforms with IPv6 support (AF_INET6
> and inet_pton).
>
> CertificateError is raised on failure. On success, the function
> returns nothing.
>
> So, if python2 backport of match_hostname does not match behavior of
> python3.5, I cannot drop the dependency. I have reverted the change and
> reopened this bug.
>
> I urge you to reconsider if the py2 version really needs to be dropped.
>
>
I'm downgrading severity to prevent autoremoval. I don't think
ssl-match-hostname can be dropped from buster.
-- 

Saludos,
Felipe Sateler

Processed: tagging 919217

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> tags 919217 + pending
Bug #919217 [lintian-brush] Missing dependency on devscripts
Added tag(s) pending.
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919217: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919217
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Processed: Re-assign to correct package

[Debian Bug Tracking System]

Processing commands for cont...@bugs.debian.org:

> reassign 919804 python3-astropy-helpers 3.1-1
Bug #919804 [src:ndcube] ndcube: FTBFS (No module named 'sphinx_astropy')
Bug reassigned from package 'src:ndcube' to 'python3-astropy-helpers'.
No longer marked as found in versions ndcube/1.0.1-2.
Ignoring request to alter fixed versions of bug #919804 to the same values 
previously set
Bug #919804 [python3-astropy-helpers] ndcube: FTBFS (No module named 
'sphinx_astropy')
Marked as found in versions astropy-helpers/3.1-1.
> affects 919804 src:ndcube
Bug #919804 [python3-astropy-helpers] ndcube: FTBFS (No module named 
'sphinx_astropy')
Added indication that 919804 affects src:ndcube
> thanks
Stopping processing here.

Please contact me if you need assistance.
-- 
919804: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919804
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#917492: fam: diff for NMU version 2.7.0-17.3

[anarcat]

Control: tags 917492 + pending

Dear maintainer,

I've prepared an NMU for fam (versioned as 2.7.0-17.3) and
uploaded it to DELAYED/0. Please feel free to tell me if I
should delay it longer.

Regards.

-- 
diff -u fam-2.7.0/debian/changelog fam-2.7.0/debian/changelog
--- fam-2.7.0/debian/changelog
+++ fam-2.7.0/debian/changelog
@@ -1,3 +1,11 @@
+fam (2.7.0-17.3) unstable; urgency=high
+
+  * Non-maintainer upload.
+  * Fix build failure with recent glibc ('minor' was not declared in this
+scope), thanks to Logan Rosen (Closes: #917492).
+
+ -- Antoine Beaupré   Sat, 19 Jan 2019 13:58:08 -0500
+
 fam (2.7.0-17.2) unstable; urgency=medium
 
   * Non-maintainer upload.
only in patch2:
unchanged:
--- fam-2.7.0.orig/.pc/.quilt_patches
+++ fam-2.7.0/.pc/.quilt_patches
@@ -0,0 +1 @@
+debian/patches
only in patch2:
unchanged:
--- fam-2.7.0.orig/.pc/.quilt_series
+++ fam-2.7.0/.pc/.quilt_series
@@ -0,0 +1 @@
+series
only in patch2:
unchanged:
--- fam-2.7.0.orig/.pc/.version
+++ fam-2.7.0/.pc/.version
@@ -0,0 +1 @@
+2
only in patch2:
unchanged:
--- fam-2.7.0.orig/debian/patches/19_glibc_2.28.patch
+++ fam-2.7.0/debian/patches/19_glibc_2.28.patch
@@ -0,0 +1,17 @@
+## Description: Fix FTBFS against glibc 2.28
+## Origin/Author: Logan Rosen 
+## Bug: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917492
+diff -Nur -x '*.orig' -x '*~' fam-2.7.0/build-tree/fam-2.7.0/src/DNotify.c++ fam-2.7.0.new/build-tree/fam-2.7.0/src/DNotify.c++
+--- fam-2.7.0/src/DNotify.c++	2019-01-08 23:35:20.513574095 -0500
 fam-2.7.0/src/DNotify.c++	2019-01-08 23:36:37.568605429 -0500
+@@ -36,6 +36,10 @@
+ #include 
+ #include 
+ 
++#ifdef __GNU_LIBRARY__
++#include 
++#endif
++
+ #include "DNotify.h"
+ 
+ #include "Interest.h"


signature.asc
Description: PGP signature

Processed: fam: diff for NMU version 2.7.0-17.3

[Debian Bug Tracking System]

Processing control commands:

> tags 917492 + pending
Bug #917492 [src:fam] fam: FTBFS ('minor' was not declared in this scope)
Added tag(s) pending.

-- 
917492: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917492
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919788: marked as done (libqxmpp1: missing Breaks+Replaces: libqxmpp0 (>= 1))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 19:19:57 +
with message-id 
and subject line Bug#919788: fixed in qxmpp 1.0.0-4
has caused the Debian Bug report #919788,
regarding libqxmpp1: missing Breaks+Replaces: libqxmpp0 (>= 1)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919788: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919788
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: libqxmpp1
Version: 1.0.0-3
Severity: serious
User: debian...@lists.debian.org
Usertags: piuparts

Hi,

during a test with piuparts I noticed your package fails to upgrade from
'testing'.
It installed fine in 'testing', then the upgrade to 'sid' fails
because it tries to overwrite other packages files without declaring a
Breaks+Replaces relation.

See policy 7.6 at
https://www.debian.org/doc/debian-policy/ch-relationships.html#overwriting-files-and-replacing-packages-replaces

>From the attached log (scroll to the bottom...):

  Preparing to unpack .../libqxmpp1_1.0.0-3_amd64.deb ...
  Unpacking libqxmpp1:amd64 (1.0.0-3) ...
  dpkg: error processing archive 
/var/cache/apt/archives/libqxmpp1_1.0.0-3_amd64.deb (--unpack):
   trying to overwrite '/usr/lib/x86_64-linux-gnu/libqxmpp.so.1.0.0', which is 
also in package libqxmpp0:amd64 1.0.0-1
  dpkg-deb: error: paste subprocess was killed by signal (Broken pipe)
  Errors were encountered while processing:
   /var/cache/apt/archives/libqxmpp1_1.0.0-3_amd64.deb


cheers,

Andreas


libqxmpp0=1.0.0-1_libqxmpp1=1.0.0-3.log.gz
Description: application/gzip
--- End Message ---
--- Begin Message ---
Source: qxmpp
Source-Version: 1.0.0-4

We believe that the bug you reported is fixed in the latest version of
qxmpp, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Boris Pek  (supplier of updated qxmpp package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 21:56:20 +0300
Source: qxmpp
Binary: libqxmpp1 libqxmpp-dev libqxmpp-doc
Architecture: source
Version: 1.0.0-4
Distribution: unstable
Urgency: medium
Maintainer: Debian XMPP Maintainers 
Changed-By: Boris Pek 
Description:
 libqxmpp-dev - Development files for the QXmpp library
 libqxmpp-doc - Documentation for the QXmpp library
 libqxmpp1  - QXmpp library for XMPP client and server applications
Closes: 919788
Changes:
 qxmpp (1.0.0-4) unstable; urgency=medium
 .
   * Update debian/control:
 - package libqxmpp1 now Breaks and Replaces package libqxmpp0
   (Closes: #919788)
 - remove Pre-Depends field from package libqxmpp1
Checksums-Sha1:
 136e2cb1395985b7e3a93551bc66f6926ca9dbf2 2151 qxmpp_1.0.0-4.dsc
 4b68d569494e7daf3035c383bbafbd312986b63d 259635 qxmpp_1.0.0.orig.tar.gz
 534e38137cb716ef66c5dbb8e21800279ca77b60 4692 qxmpp_1.0.0-4.debian.tar.xz
Checksums-Sha256:
 e03e1da79c22e340ec4d0ba5377500733addf9f5b85bbb367ecd62a929860319 2151 
qxmpp_1.0.0-4.dsc
 bf62ac8d0b5741b3cb07ea92780b279d5c34d000dc7401d6c20a9b77865a5c1e 259635 
qxmpp_1.0.0.orig.tar.gz
 43dc73de56a9351f5548508272b14f233038099a59291911a568e8101b644118 4692 
qxmpp_1.0.0-4.debian.tar.xz
Files:
 bebd1a42ff04905bccd12960f9a783e8 2151 libs optional qxmpp_1.0.0-4.dsc
 539c4c4ad3a6efa123d94dbc22e4b520 259635 libs optional qxmpp_1.0.0.orig.tar.gz
 68662e61969ec47e918d834ea07409fc 4692 libs optional qxmpp_1.0.0-4.debian.tar.xz

-BEGIN PGP SIGNATURE-

iQJHBAEBCgAxFiEE74NZeBI5qRlNLX9Z0AFb0SjzkngFAlxDcu8THHRlaG5pY2tA
ZGViaWFuLm9yZwAKCRDQAVvRKPOSeNc5D/9GhFqjF/vZ8czTfkCGA+hydfw3AoCL
5eD/rv/Pjgve76GvAdk5Tyh0XqgaWRzqLdFwACwjJkzkcnJ9JwXyUWHdwK1HY0DT
/REgH+J4ABXxPBOjq1/nUCRdFA3AI0PGXPffgWZo5Mg2GNecqY6AxTqzzI5LcYIy
1+Ut8W3o/hYsOf+UVZ4r29lcc+QTqt0C5aRieF4Nb++zp4O9KfIQ0hUO1ebCplr9
JDeTslVD2X1Df1hjwm1wSgAXDfFhB5OwQxu5XYtRO0JKDiI0I/bj11ozaGvzAw9R
kgJDothNRYYsizY7Ym2rK/FhYfZG4xsMiZCQulFXRrbW5qr24/w/FIMMV7DyUxUR
G5VHFWGh76tgoiOgWbzs+3NSOiq/ocLP3P+xsrddd7ftqC/xxovVnaG13+54jS2/
IFbDffEIctKGhDXhahcpkmaVJbjfuqy3nm/SyU9kofLJPb93NdsrRM8+7fPcuoUj
YJfUT0ajOzFr/jA1ax1CQsq53AXVtez2aQZYDO4fOpIqaC0gxNbo8Y4rOMg6BNSq
CTP7RpBpGp/7d9MKlbuJisIPceXZW+kJWkBYdSdtQdRH+m2IoqW9gl6YdS1p0q5u
DHbPBhjGmv+CkiMUf9kXlLnYkosABl

Bug#919773: libdbd-sqlite3-perl FTBFS on mips: test failure

[gregor herrmann]

On Sat, 19 Jan 2019 15:03:24 +0100, Xavier wrote:

> > https://buildd.debian.org/status/fetch.php?pkg=libdbd-sqlite3-perl&arch=mips&ver=1.62-1&stamp=1546291045&raw=0
> > 
> > ...
> > t/65_db_config.t .. 
> > 1..79
...
> > ok 76 - sql not found
> > Failed 3/79 subtests
> > ...
> > Test Summary Report
> > ---
> > t/65_db_config.t(Wstat: 11 Tests: 76 
> > Failed: 0)
> >   Non-zero wait status: 11
> >   Parse errors: Bad plan.  You planned 79 tests but ran 76.
> > Files=111, Tests=3794, 61 wallclock secs ( 2.80 usr  0.48 sys + 48.42 cusr  
> > 4.10 csys = 55.80 CPU)
> > Result: FAIL
> 
> I think the failure is here. I'm testing
> 
> diff --git a/t/65_db_config.t b/t/65_db_config.t
> index 6820736..1e336cf 100644
> --- a/t/65_db_config.t
> +++ b/t/65_db_config.t
> @@ -211,7 +211,7 @@ for my $func (@CALL_FUNCS) {
> 
>  # DEFENSIVE at connection
>  SKIP: {
> -skip 'DEFENSIVE is not supported', 8 if !SQLITE_DBCONFIG_DEFENSIVE;
> +skip 'DEFENSIVE is not supported', 3 if !SQLITE_DBCONFIG_DEFENSIVE;
>  my $dbh = connect_ok(RaiseError => 1, PrintError => 0,
> sqlite_defensive => 1);
> 
>  my $sql = 'CREATE TABLE foo (id, text)';

While the '8' here is obviously wrong, I think this fix is not
enough. For starters, I don't see anything about "skipped DEFENSIVE is not
supported" in the log.

I've now tried on minkus (the mips porterbox) and I get the same test
failure as on the buildd, with or without the patch. The last test
block is not skipped, it looks (with some diag() sprinkled it) like
it just fails quietly in the first statement ('my $dbh =
connect_ok(...)') and never reaches the 3 tests.

So with the following code:

#v+
# DEFENSIVE at connection
SKIP: {
skip 'DEFENSIVE is not supported', 3 if !SQLITE_DBCONFIG_DEFENSIVE;
diag "We don't skip this section";
my $dbh = connect_ok(RaiseError => 1, PrintError => 0, sqlite_defensive => 
1);
diag "We have dbh";

my $sql = 'CREATE TABLE foo (id, text)';
$dbh->do($sql);
diag "do sql done";
$dbh->do('PRAGMA writable_schema=ON');
diag "do pragma done";
eval { $dbh->do('UPDATE sqlite_master SET name = ? WHERE name = ?', undef, 
'bar', 'foo'); };
diag "evald";
ok $@, "updating sqlite_master is prohibited";
like $@ => qr/table sqlite_master may not be modified/;
}   
  
#v-

I get

$ prove --blib --verbose t/65_db_config.t
t/65_db_config.t .. 
1..79
...
ok 76 - sql not found
# We don't skip this section
Failed 3/79 subtests 

Test Summary Report
---
t/65_db_config.t (Wstat: 11 Tests: 76 Failed: 0)
  Non-zero wait status: 11
  Parse errors: Bad plan.  You planned 79 tests but ran 76.
Files=1, Tests=76,  1 wallclock secs ( 0.20 usr  0.04 sys +  0.70 cusr  0.18 
csys =  1.12 CPU)
Result: FAIL



Cheers,
gregor

-- 
 .''`.  https://info.comodo.priv.at -- Debian Developer https://www.debian.org
 : :' : OpenPGP fingerprint D1E1 316E 93A7 60A8 104D  85FA BB3A 6801 8649 AA06
 `. `'  Member VIBE!AT & SPI Inc. -- Supporter Free Software Foundation Europe
   `-   NP: Red Hot Chili Peppers: Death Of A Martian


signature.asc
Description: Digital Signature

Bug#917492: marked as done (fam: FTBFS ('minor' was not declared in this scope))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 19:19:07 +
with message-id 
and subject line Bug#917492: fixed in fam 2.7.0-17.3
has caused the Debian Bug report #917492,
regarding fam: FTBFS ('minor' was not declared in this scope)
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
917492: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=917492
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: src:fam
Version: 2.7.0-17.2
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
CDBS: parsing fam-2.7.0.tar.gz ...
CDBS WARNING:tarball.mk is deprecated since 0.4.85 - please use source 
format 3.0 instead
CDBS WARNING:simple-patchsys.mk is deprecated since 0.4.85 - please use 
source format 3.0 (quilt) instead
test -x debian/rules
mkdir -p "build-tree/fam-2.7.0"
CDBS WARNING:DEB_UPDATE_RCD_PARAMS is deprecated since 0.4.85
tar -C build-tree  -x -z -f fam-2.7.0.tar.gz
touch debian/stamp-fam-2.7.0.tar.gz
if test -e /usr/share/misc/config.guess ; then \
for i in fam-2.7.0/config.guess ; do \
cp --remove-destination /usr/share/misc/config.guess \
build-tree/$i ; \
done ; \

[... snipped ...]

 ^
DNotify.c++:536:32: error: 'minor' was not declared in this scope
 major(status->st_dev), minor(status->st_dev),
^
DNotify.c++:536:32: note: suggested alternative: 'mknod'
 major(status->st_dev), minor(status->st_dev),
^
mknod
DNotify.c++:486:9: warning: unused variable 'res' [-Wunused-variable]
 int res;
 ^~~
DNotify.c++: In static member function 'static void DNotify::read_handler(int, 
void*)':
DNotify.c++:641:11: error: 'major' was not declared in this scope
   major(dw->dir_dev), minor(dw->dir_dev), dw->dir_ino);
   ^
DNotify.c++:641:31: error: 'minor' was not declared in this scope
   major(dw->dir_dev), minor(dw->dir_dev), dw->dir_ino);
   ^
DNotify.c++:641:31: note: suggested alternative: 'mknod'
   major(dw->dir_dev), minor(dw->dir_dev), dw->dir_ino);
   ^
   mknod
DNotify.c++:602:16: warning: unused variable 'fw' [-Wunused-variable]
 FileWatch *fw;
^~
DNotify.c++: In static member function 'static void 
DNotify::overflow_signal_handler(int, siginfo_t*, void*)':
DNotify.c++:233:11: warning: ignoring return value of 'ssize_t write(int, const 
void*, size_t)', declared with attribute warn_unused_result [-Wunused-result]
 write (STDERR_FILENO, str, strlen(str));
 ~~^
DNotify.c++:239:12: warning: ignoring return value of 'ssize_t write(int, const 
void*, size_t)', declared with attribute warn_unused_result [-Wunused-result]
   write(pipe_write_fd, &c, 1);
   ~^~
DNotify.c++: In static member function 'static void 
DNotify::signal_handler(int, siginfo_t*, void*)':
DNotify.c++:260:8: warning: ignoring return value of 'ssize_t write(int, const 
void*, size_t)', declared with attribute warn_unused_result [-Wunused-result]
  write (STDERR_FILENO, str, strlen(str));
  ~~^
DNotify.c++:270:12: warning: ignoring return value of 'ssize_t write(int, const 
void*, size_t)', declared with attribute warn_unused_result [-Wunused-result]
   write(pipe_write_fd, &c, 1);
   ~^~
make[3]: *** [Makefile:453: DNotify.o] Error 1
make[3]: Leaving directory '/<>/build-tree/fam-2.7.0/src'
make[2]: *** [Makefile:327: all-recursive] Error 1
make[2]: Leaving directory '/<>/build-tree/fam-2.7.0'
make[1]: *** [Makefile:258: all] Error 2
make[1]: Leaving directory '/<>/build-tree/fam-2.7.0'
make: *** [/usr/share/cdbs/1/class/makefile.mk:77: debian/stamp-makefile-build] 
Error 2
dpkg-buildpackage: error: debian/rules build-indep subprocess returned exit 
status 2


The build was made in my autobuilder with "dpkg-buildpackage -A"
but it also fails here:

https://tests.reproducible-builds.org/debian/rb-pkg/unstable/amd64/fam.html

where you can get a full build log if you need it.

If this is really a bug in one of the build-depends, please use reassign and 
affects,
so that this is still visible in the BTS web 

Bug#919617: python-gpiozero file conflict with python3-gpiozero

[Ben Nuttall]

On Fri, 18 Jan 2019 01:42:55 + Peter Green 
wrote:
> Package: python-gpiozero
> Version: 1.4.1-1
> Severity: serious
>
> The 1.4.1-1 upload of gpiozero added the "pinout" utility, unfortunately
it added it to both the python-gpiozero and python3-gpiozero packages. The
result is a file conflict between the two packages.

Agreed

>
> I see two possible solutions.
>
> 1. Drop the utility from one of the packages, if going down this road I
would probablly drop it from the python-gpiozero package since python 2 is
deprecated.
> 2. Install the utility with a different name or path in each package and
then use the alternatives mechanism to select between them.

We do 1) in RPF Raspbian. I think this is the correct approach.

Bug#903698: sphinxbase: build appears broken for multiple python3 versions

[Samuel Thibault]

Control: tags -1 + patch - moreinfo

Hello,

anarcat, le sam. 19 janv. 2019 12:42:44 -0500, a ecrit:
> On Thu, Jan 03, 2019 at 10:16:13AM +0100, Samuel Thibault wrote:
> > Oops, this bug was erroneously closed because its mention was remaining
> > in the sphinxbase changelog.
>
> So after reviewing this bug during the montreal BSP, I'm a little
> confused - it shows up in the "sponsor" UDD dashboard because it's
> marked as affecting buster and sid but with a patch.
>
> Yet, I don't see a recent patch that will fix the issue in dh-python.
> I'm not even sure there *is* an issue in dh-python at all anymore...
>
> Could someone summarize the current state of this bug report?

https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=903698#140 , attached
here, contains the proper information and patch.

Basically, the issue is that dh_python3's handling depends on the
order in which the installed files are processed in the for i in
os.listdir(srcdir): loop. When the target of a symlink is processed
before the symlink, the symlink is considered as non-existing,
because exists(fpath1) returns False in that case. Changing that into
lexists(fpath1), which does return True in that case, fixes things, and
I believe that's should just be done.

Samuel
--- Begin Message ---
Control: reassign -1 dh-python
Control: tags -1 + patch

Samuel Thibault, le mar. 16 oct. 2018 22:13:59 +0200, a ecrit:
> Samuel Thibault, le mar. 16 oct. 2018 03:04:16 +0200, a ecrit:
> > This is driving me crazy :)
> > 
> > I have uploaded the VM images on
> > https://people.debian.org/~sthibault/tmp/fails.img.gz
> > https://people.debian.org/~sthibault/tmp/works.img.gz
> > 
> > Booting one or the other does not matter. What does matter is the
> > disk image used to store the chroot. Each VM image has its own
> > /var/cache/pbuilder/sphinxbase-build directory (almost exactly the
> > same), and it does not matter which of the two I copy, if I copy it
> > inside the fails.img disk I'm getting the lintian issue, and if it's
> > inside the works.img disk I'm not getting it (there's a fresh checkout
> > of sphinbase in /tmp/sphinxbase inside the chroots). And of course my
> > own main system is in the fails case, thus preventing me from building
> > the package :) tune2fsk does not show any difference between the two
> > filesystem options, just creation time, mount count & such.
> > 
> > Any other idea of what could be different between the two filesystems?
> 
> It could very well be e.g. the resulting inode numbers and such, thus my
> hypothesis at the top of the quotes above. Python people can have a look
> at the fails.img.gz image, where the issue is notably reproducible from
> the chroot in /var/cache/pbuilder/sphinxbase-build , building for
> instance in /tmp/sphinxbase.

I overrided dh_python3 into /bin/false to catch the result just before
running dh_python3, the two build trees are similar except the .pyc
timestamps which are a few seconds apart in the 2.7 and 3.6 trees.

I then tried to pass -v to dh_python3, and got differing results,
as attached.  It seems in the failure case it indeed doesn't do
everything for 3.6: there are 4 lines less which rename the .so to a 36
variant.  I looked deeper in fs.py, and I found that in the succeeding
case, the main loop inside share_files sees _sphinbase.so before
_sphinxbase.so.0.0.0, and thus renames it, and in the failing case, that
loop sees _sphinxbase.so.0.0.0 before _sphinxbase.so.0, and when it
looks at _sphinxbase.so.0, exits() fails, because the target was moved,
and thus the symlink is now broken. I changed that exists() call into
lexists() to allow for broken symlinks, as the attached patch does, and
things got fixed. This seems like a logical thing to do, and possibly
needed in a few other places in fs.py

Samuel
D: dh_python3 dh_python3:161: version: 3.20180927
D: dh_python3 dh_python3:162: argv: ['/usr/bin/dh_python3', '-v']
D: dh_python3 dh_python3:163: options: {'guess_deps': True, 'skip_private': 
False, 'verbose': True, 'arch': None, 'package': None, 'no_package': None, 
'compile_all': False, 'vrange': None, 'regexpr': None, 
'accept_upstream_versions': False, 'depends': None, 'depends_section': None, 
'recommends': None, 'recommends_section': None, 'suggests': None, 
'suggests_section': None, 'requires': None, 'shebang': None, 'ignore_shebangs': 
False, 'clean_dbg_pkg': True, 'no_ext_rename': False, 'no_shebang_rewrite': 
False, 'O': None}
D: dh_python3 dh_python3:164: args: []
D: dh_python3 dh_python3:166: supported Python versions: 3.6,3.7 (default=3.6)
D: dh_python3 debhelper:100: skipping package libsphinxbase-doc (missing 
${python3:Depends} in Depends)
D: dh_python3 debhelper:100: skipping package libsphinxbase-dev (missing 
${python3:Depends} in Depends)
D: dh_python3 debhelper:100: skipping package sphinxbase-utils (missing 
${python3:Depends} in Depends)
D: dh_python3 debhelper:100: skipping package libsphinxbase3 (missing 
${python3:Depends} in Depends)
D: dh_python3 debhelper:1

Bug#919773: libdbd-sqlite3-perl FTBFS on mips: test failure

[Xavier]

Le 19/01/2019 à 20:16, gregor herrmann a écrit :
> On Sat, 19 Jan 2019 15:03:24 +0100, Xavier wrote:
> 
>>> https://buildd.debian.org/status/fetch.php?pkg=libdbd-sqlite3-perl&arch=mips&ver=1.62-1&stamp=1546291045&raw=0
>>>
>>> ...
>>> t/65_db_config.t .. 
>>> 1..79
> ...
>>> ok 76 - sql not found
>>> Failed 3/79 subtests
>>> ...
>>> Test Summary Report
>>> ---
>>> t/65_db_config.t(Wstat: 11 Tests: 76 
>>> Failed: 0)
>>>   Non-zero wait status: 11
>>>   Parse errors: Bad plan.  You planned 79 tests but ran 76.
>>> Files=111, Tests=3794, 61 wallclock secs ( 2.80 usr  0.48 sys + 48.42 cusr  
>>> 4.10 csys = 55.80 CPU)
>>> Result: FAIL
>>
>> I think the failure is here. I'm testing
>>
>> diff --git a/t/65_db_config.t b/t/65_db_config.t
>> index 6820736..1e336cf 100644
>> --- a/t/65_db_config.t
>> +++ b/t/65_db_config.t
>> @@ -211,7 +211,7 @@ for my $func (@CALL_FUNCS) {
>>
>>  # DEFENSIVE at connection
>>  SKIP: {
>> -skip 'DEFENSIVE is not supported', 8 if !SQLITE_DBCONFIG_DEFENSIVE;
>> +skip 'DEFENSIVE is not supported', 3 if !SQLITE_DBCONFIG_DEFENSIVE;
>>  my $dbh = connect_ok(RaiseError => 1, PrintError => 0,
>> sqlite_defensive => 1);
>>
>>  my $sql = 'CREATE TABLE foo (id, text)';
> 
> While the '8' here is obviously wrong, I think this fix is not
> enough. For starters, I don't see anything about "skipped DEFENSIVE is not
> supported" in the log.
> 
> I've now tried on minkus (the mips porterbox) and I get the same test
> failure as on the buildd, with or without the patch. The last test
> block is not skipped, it looks (with some diag() sprinkled it) like
> it just fails quietly in the first statement ('my $dbh =
> connect_ok(...)') and never reaches the 3 tests.
> 
> So with the following code:
> 
> #v+
> # DEFENSIVE at connection
> SKIP: {
> skip 'DEFENSIVE is not supported', 3 if !SQLITE_DBCONFIG_DEFENSIVE;
> diag "We don't skip this section";
> my $dbh = connect_ok(RaiseError => 1, PrintError => 0, sqlite_defensive 
> => 1);
> diag "We have dbh";
> 
> my $sql = 'CREATE TABLE foo (id, text)';
> $dbh->do($sql);
> diag "do sql done";
> $dbh->do('PRAGMA writable_schema=ON');
> diag "do pragma done";
> eval { $dbh->do('UPDATE sqlite_master SET name = ? WHERE name = ?', 
> undef, 'bar', 'foo'); };
> diag "evald";
> ok $@, "updating sqlite_master is prohibited";
> like $@ => qr/table sqlite_master may not be modified/;
> } 
> 
> #v-
> 
> I get
> 
> $ prove --blib --verbose t/65_db_config.t
> t/65_db_config.t .. 
> 1..79
> ...
> ok 76 - sql not found
> # We don't skip this section
> Failed 3/79 subtests 
> 
> Test Summary Report
> ---
> t/65_db_config.t (Wstat: 11 Tests: 76 Failed: 0)
>   Non-zero wait status: 11
>   Parse errors: Bad plan.  You planned 79 tests but ran 76.
> Files=1, Tests=76,  1 wallclock secs ( 0.20 usr  0.04 sys +  0.70 cusr  0.18 
> csys =  1.12 CPU)
> Result: FAIL

There is a difference earlier between mips and amd64: the first writes:

  # current DEFENSIVE value: 0

while the second has "1"

So it seems that these tests should be disabled for mips but it seems
that SQLITE_DBCONFIG_DEFENSIVE is badly set to a true value.

Processed: Re: sphinxbase: build appears broken for multiple python3 versions

[Debian Bug Tracking System]

Processing control commands:

> tags -1 + patch - moreinfo
Bug #903698 [dh-python] sphinxbase: build appears broken for multiple python3 
versions
Added tag(s) patch.
Bug #903698 [dh-python] sphinxbase: build appears broken for multiple python3 
versions
Removed tag(s) moreinfo.

-- 
903698: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=903698
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems

Bug#919217: marked as done (Missing dependency on devscripts)

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 19:35:04 +
with message-id 
and subject line Bug#919217: fixed in lintian-brush 0.11
has caused the Debian Bug report #919217,
regarding Missing dependency on devscripts
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919217: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919217
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: lintian-brush
Version: 0.10
Severity: serious

Lintian-brush must depend on devscripts because it calls dch to update
the changelog.

-- System Information:
Debian Release: 9.6
  APT prefers stable
  APT policy: (990, 'stable'), (500, 'stable-updates')
Architecture: amd64 (x86_64)
Foreign Architectures: i386

Kernel: Linux 4.9.0-8-amd64 (SMP w/4 CPU cores)
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8 (charmap=UTF-8), 
LANGUAGE=en_US.UTF-8 (charmap=UTF-8)
Shell: /bin/sh linked to /bin/dash
Init: systemd (via /run/systemd/system)
--- End Message ---
--- Begin Message ---
Source: lintian-brush
Source-Version: 0.11

We believe that the bug you reported is fixed in the latest version of
lintian-brush, which is due to be installed in the Debian FTP archive.

A summary of the changes between this version and the previous one is
attached.

Thank you for reporting the bug, which will now be closed.  If you
have further comments please address them to 919...@bugs.debian.org,
and the maintainer will reopen the bug report if appropriate.

Debian distribution maintenance software
pp.
Jelmer Vernooij  (supplier of updated lintian-brush package)

(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing ftpmas...@ftp-master.debian.org)


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA512

Format: 1.8
Date: Sat, 19 Jan 2019 19:11:40 +
Source: lintian-brush
Binary: lintian-brush
Architecture: source
Version: 0.11
Distribution: unstable
Urgency: medium
Maintainer: Jelmer Vernooij 
Changed-By: Jelmer Vernooij 
Description:
 lintian-brush - automatically fix lintian problems
Closes: 919217
Changes:
 lintian-brush (0.11) unstable; urgency=medium
 .
   [ Jeroen Dekkers ]
   * Add dependency on devscripts. Closes: #919217
Checksums-Sha1:
 4f6292f52a8baf8046b50670a3569ca094780a02 1805 lintian-brush_0.11.dsc
 2d06c140b880a617517f63b1bb7ebfa9fd8f 626892 lintian-brush_0.11.tar.xz
 c99445c21f8bddbfd17cac88ae93cdca96e5a266 6601 
lintian-brush_0.11_amd64.buildinfo
Checksums-Sha256:
 86cfe479af09614076db70f578337d5b6f12e8d4e2b74959372d887a1868b629 1805 
lintian-brush_0.11.dsc
 c8af5ff537dcebb1e26cbe120645236441f285ccba1f81835506c0abb82d7375 626892 
lintian-brush_0.11.tar.xz
 8f61430e52c88faa380fce3312c8993db95312666edd30764617aa6e5631de8d 6601 
lintian-brush_0.11_amd64.buildinfo
Files:
 b344428d2e987535bdf10d07c00657b7 1805 devel optional lintian-brush_0.11.dsc
 a1c36edeeb19865fbe1c1a509313f943 626892 devel optional 
lintian-brush_0.11.tar.xz
 340eafdf3f322ce502614f3218e36c4c 6601 devel optional 
lintian-brush_0.11_amd64.buildinfo

-BEGIN PGP SIGNATURE-

iQIzBAEBCgAdFiEEsjhixBXWVlpOhsvXV5wWDUyeI+gFAlxDdqIACgkQV5wWDUye
I+i51w//fVZYRD8KSLASQAWOHEA6zbA90NhFWXsmmAREth5XDTOqjZMJNuUGcEYa
EQt+nNVGf5fou3Hxku6p9bIvfc393lCHqke2d41kAYrZ+F0cnSBk3XLktnA/GLyh
+IdtElx0St84+IQop1wWb1XXSn6SzqScgEh5w8aFUamiS1NKNDIOlYcv2B/0ZSt5
snTwPIDoJGzACVWo4zRCluE0jWy6nT7nAuBzPBSUBlQ7gvIUF8BWebCdFm03HbIF
bzB8Wb96GGfqJT2b++iqhN6Rl+b23RIivj/SVG1Fi/FL509KyrxW0+wj0SPGVY1t
TICODFeyvy8s5WCbwrqkjk7enVFqKnLKHH93iVmsGqAIXj9nR8WnPAC3qNaIqJVc
SpoysGJiWxM00JkkXLGCkN7PPB6HRaUIhbjhMr9aJ3FooZ1t7vbgG8mWH/qJQ/8R
kuMZn3ub6MLSZ/p0F89N3WyDwJvOMu6mlf7GihtefL7AvRaDTBvXQ5lHNNH3yX6w
xLtLVV8jc2MlvghFnZ0hvfdA7yvYl29cdj88slYNXKmZrUht7EzaCj7IOALvHQSd
ZK4HbiCgw6YBNrN0AxZxeVR1y+arJmoiBJALcOEYZi6qGbvUo6Di/8yKOHobebVK
fMWBiM4wounaid7jLAYZTYY6oj1Smz8MP9aifVdNovbWgOVrtvE=
=xU1g
-END PGP SIGNATURE End Message ---

Bug#919296: git-daemon-run: fails with 'warning: git-daemon: unable to open supervise/ok: file does not exist'

[Dmitry Bogatov]

[2019-01-16 14:49] Dmitry Bogatov 
> So, should I propose you patch (in 7 days), that merges
> bin:git-daemon-run into bin:git-daemon, would you be able to review
> and apply/upload it before hard freeze?

Probably, even better would be to merge `git-daemon-run' and
`git-daemon-sysvinit'. What do you think?

Bug#919804: marked as done (ndcube: FTBFS (No module named 'sphinx_astropy'))

[Debian Bug Tracking System]

Your message dated Sat, 19 Jan 2019 19:34:07 +
with message-id 
and subject line Bug#919804: fixed in astropy-helpers 3.1-2
has caused the Debian Bug report #919804,
regarding ndcube: FTBFS (No module named 'sphinx_astropy')
to be marked as done.

This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.

(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact ow...@bugs.debian.org
immediately.)


-- 
919804: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919804
Debian Bug Tracking System
Contact ow...@bugs.debian.org with problems
--- Begin Message ---
Package: src:ndcube
Version: 1.0.1-2
Severity: serious
Tags: ftbfs

Dear maintainer:

I tried to build this package in buster but it failed:


[...]
 debian/rules build-indep
dh build-indep --with python3,sphinxdoc --buildsystem=pybuild
   dh_update_autotools_config -i -O--buildsystem=pybuild
   dh_autoreconf -i -O--buildsystem=pybuild
   dh_auto_configure -i -O--buildsystem=pybuild
I: pybuild base:217: python3.7 setup.py config 
running config
   debian/rules override_dh_auto_build
make[1]: Entering directory '/<>'
dh_auto_build
I: pybuild base:217: /usr/bin/python3 setup.py build 
running build
running build_py
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/_sunpy_init.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/ndcube_sequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/ndcube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
copying ndcube/version.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube
creating 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/visualization
copying ndcube/visualization/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/visualization
copying ndcube/visualization/animation.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/visualization
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/wcs.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/cube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
copying ndcube/utils/sequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_ndcubesequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_utils_cube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_utils_wcs.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/setup_package.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_utils_sequence.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/helpers.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
copying ndcube/tests/test_ndcube.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
copying ndcube/mixins/plotting.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
copying ndcube/mixins/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
copying ndcube/mixins/ndslicing.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/mixins
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils/tests
copying ndcube/utils/tests/__init__.py -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/utils/tests
creating /<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/data
copying ndcube/data/README.rst -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/data
copying ndcube/tests/coveragerc -> 
/<>/.pybuild/cpython3_3.7_ndcube/build/ndcube/tests
PYTHONPATH=. sphinx-build -D html_last_updated_fmt="November 19, 2018" -D 
html_show_copyright=0 -N -bhtml docs/ build/html # HTML generator
Running Sphinx v1.7.9

Configuration error:
There is a programable error in your configuration file:

Traceback (most recent call last):
  File "/usr/lib/python3/dist-packages/sphinx/config.py", line 161, in __init__
execfile_(filename, config)
  File "/usr/lib/python3/dist-packages/sphinx/util/pycompat.py", line 150, in 
execfile_
exec_(code, _globals)
  File "conf.py", line 42, in 
from astropy_helpers.sphinx.conf import *
  File "/usr/lib/python3/dist-packages/astropy_helpers/sphinx/conf.py", line 3, 
in 
from sphinx_astropy.conf import *
ModuleNotFoundError: No module named 'sphinx_astropy'

make[1]: *** [debian/rules:18: