[Bioc-devel] Errors and warnings while submitting package
Hi Bioconductor team, I submitted my package to the Bioconductor and there are these errors and warnings that appear in the bioconductor check but that doesn`t appear when I compile. I believe these errors happen not because of my package but rather because of the dependency of other packages/programs like X11 that need to be installed on the PC for the RGL package to work. Any suggestions on what I can do? One more thing, this error "Warning: Update R version dependency from 3.4.2 to 3.5“ I don`t know why I asked to change to version 3.5 since in my computers I use 3.4.2, I have to know what exactly is it requiring version 3.5? * checking whether package BASiNET can be installed … [6s/5s] WARNING Found the following significant warnings: Warning: 'rgl_init' failed, running with rgl.useNULL = TRUE * Warning in rgl.init(initValue, onlyNULL) : RGL: unable to open X11 display Warning: 'rgl_init' failed, running with rgl.useNULL = TRUE * ERROR: dependencies RWeka, rmcfs are not available for package BASiNET * Warning: Update R version dependency from 3.4.2 to 3.5 Thanks, Eric [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
Re: [Bioc-devel] Failing package LEA
Hi, Ok. My mistake. It is working. thanks a lot. Best, Eric Le ven. 29 sept. 2017 à 14:43, Turaga, Nitesh a écrit : > Hi, > > You have submitted the same key twice, under the SVN ID e.frichot. (13/09, > 27/09) > > ssh-rsa > B3NzaC1yc2EDAQABAAACAQCiVVkQ+sOy7g0+2sqALggVl4EAYTARZZSvJg6Gdz1NvLw9lUtp90qoEQ2VWvX > > This key has been added to our system on 13/09, without any problem. If > you use the corresponding private key to that public key, it should be > working. > > If you have trouble accessing our system because of your git > configuration, please have a look at our > http://bioconductor.org/developers/how-to/git/faq/. Feel free to post to > bioc-devel as well. > > Best, > > Nitesh > > > > On Sep 29, 2017, at 3:36 AM, Eric Frichot > wrote: > > > > Hi, > > > > Thanks. Someone told me about my mistake. > > I submitted a new form with a valid key the 13/09/2017 and a new one > after you advice the 27/09/2017 without feedback. > > > > Could you help me about it ? > > > > Thanks. > > > > Eric > > > > Le mer. 27 sept. 2017 à 19:35, Turaga, Nitesh < > nitesh.tur...@roswellpark.org> a écrit : > > Please resubmit your keys. The keys you submitted were bad, and hence > were not added to the system. > > > > 06/09/2017 15:24:35 eric.fric...@gmail.com e.frichot 5212830 > > > > If you don’t know what an SSH key is > https://bioconductor.org/developers/how-to/git/faq > > > > Best, > > > > Nitesh > > > > > On Sep 27, 2017, at 1:03 PM, Eric Frichot > wrote: > > > > > > Hi, > > > > > > thanks for pointing it out. > > > > > > we asked for access to the LEA git repository using the "git / svn > transition: ssh keys" form without success on september the 13rd. Could you > help us with that issue, please ? > > > > > > Thanks a lot, > > > > > > Eric Frichot > > > > > > Le mer. 27 sept. 2017 à 18:28, Turaga, Nitesh < > nitesh.tur...@roswellpark.org> a écrit : > > > Dear LEA maintainer, > > > > > > The LEA package is failing to pass 'R CMD check' on the Windows > platform in the devel version of Bioconductor (i.e. BioC 3.6): > > > > > > https://www.bioconductor.org/checkResults/devel/bioc-LATEST/LEA/ > > > > > > This is your first warning. If no action is taken over the next few > weeks we will begin the deprecation process for your package. Thank you > for your time and effort. > > > > > > Thanks for your contribution to Bioconductor. > > > > > > Pleae be advised that Bioconductor has switched from svn to Git. Some > helpful > > > links can be found here: > > > > > > https://bioconductor.org/developers/how-to/git/ > > > > > > Best, > > > > > > Nitesh Turaga > > > Bioconductor Core Team > > > > > > This email message may contain legally privileged and/or confidential > information. If you are not the intended recipient(s), or the employee or > agent responsible for the delivery of this message to the intended > recipient(s), you are hereby notified that any disclosure, copying, > distribution, or use of this email message is prohibited. If you have > received this message in error, please notify the sender immediately by > e-mail and delete this email message from your computer. Thank you. > > > > > > > > This email message may contain legally privileged and/or confidential > information. If you are not the intended recipient(s), or the employee or > agent responsible for the delivery of this message to the intended > recipient(s), you are hereby notified that any disclosure, copying, > distribution, or use of this email message is prohibited. If you have > received this message in error, please notify the sender immediately by > e-mail and delete this email message from your computer. Thank you. > > > > This email message may contain legally privileged and/or confidential > information. If you are not the intended recipient(s), or the employee or > agent responsible for the delivery of this message to the intended > recipient(s), you are hereby notified that any disclosure, copying, > distribution, or use of this email message is prohibited. If you have > received this message in error, please notify the sender immediately by > e-mail and delete this email message from your computer. Thank you. [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
[Bioc-devel] reopen issue (submission) on github
Good morning. I recently submitted a package via the Contributions repository (issue #660). Due to the "two weeks notice" policy, my submission/issue was closed whilst I was working on responding to reviewer suggestions. I have since made changes to the package in response to reviewer comments, and pushed new commit. This does not seem to be triggering a build or re-opening the issue. I have contacted the reviewer via a comment on my closed issue as well. Will this issue be re-opened in due course, or do I need to do something else to reopen it? I do not appear to have rights to re-open it myself. Thank you! -Eric ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
Re: [Bioc-devel] reopen issue (submission) on github
Perfect! Thank you. For future reference, how will this situation (submissions closed and then needing to be reopened later) be handled generally? Is an email to Bioc-devel the preferred stimulus for re-opening or is there another mechanism either in place or foreseen? Thanks again. From: Shepherd, Lori [mailto:lori.sheph...@roswellpark.org] Sent: Thursday, May 17, 2018 9:56 AM To: Kort, Eric ; bioc-devel@r-project.org Subject: Re: [Bioc-devel] reopen issue (submission) on github We will reopen the issue for you. Please make sure the webhook is still initialized to trigger builds on version bumps. Once the issue is open, please bump the version and commit to trigger a new build. Thank you for your interest in Bioconductor. Lori Shepherd Bioconductor Core Team Roswell Park Cancer Institute Department of Biostatistics & Bioinformatics Elm & Carlton Streets Buffalo, New York 14263 From: Bioc-devel mailto:bioc-devel-boun...@r-project.org>> on behalf of Kort, Eric mailto:eric.k...@vai.org>> Sent: Thursday, May 17, 2018 9:50:54 AM To: bioc-devel@r-project.org<mailto:bioc-devel@r-project.org> Subject: [Bioc-devel] reopen issue (submission) on github Good morning. I recently submitted a package via the Contributions repository (issue #660). Due to the "two weeks notice" policy, my submission/issue was closed whilst I was working on responding to reviewer suggestions. I have since made changes to the package in response to reviewer comments, and pushed new commit. This does not seem to be triggering a build or re-opening the issue. I have contacted the reviewer via a comment on my closed issue as well. Will this issue be re-opened in due course, or do I need to do something else to reopen it? I do not appear to have rights to re-open it myself. Thank you! -Eric ___ Bioc-devel@r-project.org<mailto:Bioc-devel@r-project.org> mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel This email message may contain legally privileged and/or confidential information. If you are not the intended recipient(s), or the employee or agent responsible for the delivery of this message to the intended recipient(s), you are hereby notified that any disclosure, copying, distribution, or use of this email message is prohibited. If you have received this message in error, please notify the sender immediately by e-mail and delete this email message from your computer. Thank you. [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
[Bioc-devel] push upstream master denied
I am attempting my first push of updates to my recently accepted package, slinky, which is in the development branch of BioConductor. When I try to push to the remote I get: FATAL: W any packages/slinky e.kort DENIED by fallthru (or you mis-spelled the reponame) fatal: Could not read from remote repository. Please make sure you have the correct access rights and the repository exists. My remotes are setup like this: > git remote -v origin https://github.com/vanandelinstitute/slinky (fetch) origin https://github.com/vanandelinstitute/slinky (push) upstream g...@git.bioconductor.org:packages/slinky.git (fetch) upstream g...@git.bioconductor.org:packages/slinky.git (push) I have submitted my ssh key to bioconductor, and confirmed that I have access with > ssh -T g...@git.bioconductor.org hello e.kort, this is git@ip-172-30-0-33 running gitolite3 v3.6.6-6-g7c8f0ab on git 2.18.0 Two things strike me as not quite right: 1. I am not sure where the username e.kort is coming from. Does it matter? 2. When I login to https://git.bioconductor.org/BiocCredentials/, the only package that it shows I have access to is dualKS, not my new package slinky. Can someone spot what I am doing wrong? Thank you! -Eric ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
[Bioc-devel] development vs release version
Hi everyone, I am new in the bioconductor community. I just finished the bioconductor review of my package called LEA. By the way, all your feedbacks are more than welcome about it. I am not sure to understand how the release of a new version works in bioconductor. I have few questions you may help me with. I just downloaded my package through bioconductor. So, it is under development. I tried to install my package using biocLite function. I got the error message package ‘LEA’ is not available (for R version 3.1.3) Does it mean that I have to wait the next bioconductor release ? If it is the case, imagine that I add new features for my package, do I have to wait the next release (every 6 month) for these features to be available ? Thanks a lot for your help, Eric Frichot [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
Re: [Bioc-devel] development vs release version
Ok. Thanks for your help. It worked with the r-devel I assume that my package will be available with the current version of R after the next bioconductor release ? If I add a new version for my package, after the release, people will also have to install the r-devel to access this new version ? Thanks, Eric Frichot On Sun, Mar 22, 2015 at 7:01 PM Vincent Carey wrote: > The message means that you should use R-devel to get your package. > R 3.1.3 is currently regarded as R-patched. > > On Sun, Mar 22, 2015 at 1:44 PM, Eric Frichot > wrote: > >> Hi everyone, >> >> I am new in the bioconductor community. I just finished the bioconductor >> review of my package called LEA. By the way, all your feedbacks are more >> than welcome about it. >> >> I am not sure to understand how the release of a new version works in >> bioconductor. I have few questions you may help me with. >> >> I just downloaded my package through bioconductor. So, it is under >> development. I tried to install my package using biocLite function. I got >> the error message >> >> package ‘LEA’ is not available (for R version 3.1.3) >> >> Does it mean that I have to wait the next bioconductor release ? >> >> If it is the case, imagine that I add new features for my package, do I >> have to wait the next release (every 6 month) for these features to be >> available ? >> >> Thanks a lot for your help, >> >> Eric Frichot >> >> [[alternative HTML version deleted]] >> >> ___ >> Bioc-devel@r-project.org mailing list >> https://stat.ethz.ch/mailman/listinfo/bioc-devel >> > > [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
[Bioc-devel] custom genome
Hi I have 2-3 genomes that are not listed that I would like to use with bioconductor and I do not really understand how to prepare one properly. I know you have to use BSforge, but after that I need some help. One of the genomes is *Physcomitrella patens*, which is actually being updated at the moment, so I am waiting for version 3.1 to come out, but if someone has time they could add version 1.6 or 3.0. However, the other two genomes I have to do myself as they will not be published for a while so I could just as well try a third. Any help would be appreciated, thanks. Also, if this was already posted I apologize but I could not find enough information on this subject when I searched the forums. -- Cheers, Eric [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
Re: [Bioc-devel] custom genome
Hi
Ok sorry for misusing the email list. It is just that I looked through the
forum and there were some questions about this that weren't answered very
well. Basically they just said to look at the documentation for BSforge.
And to be honest I am not an R user, so I don't really understand the
process, so no I did not follow the process as I didn't understand the
documentations account of readying a genome for bioconductor. The main
reason that I want to use bioconductor is for the edgeR and cummerbund
functions as well as some graphical representations since I can do the rest
of the analysis on my linux machine, but I thought that I could also try
the whole pipeline since it seems pretty streamlined. But I can post this
on the forum if Martin's code doesn't work out. Thanks for all the help and
again sorry for the mispost.
Cheers,
Eric
On 9 May 2015 at 19:43, Martin Morgan wrote:
> On 05/09/2015 08:36 AM, Vincent Carey wrote:
>
>> did you put this request on the forum? did you follow the steps with
>> BSforge and find
>> an instruction that could not be followed or led to an error? if you did,
>> please put an
>> account of that event on the support.bioconductor.org and you will get
>> assistance. read
>> the posting guide and provide sessionInfo() so that your errors can be
>> reproduced.
>>
>
> Vince is right that the question should probably be asked on the support
> forum, but for what it's worth I downloaded the file(?) to my current
> working directory
>
> url = "ftp://ftp.plantgdb.org/pub/Genomes/PpGDB/Ppatens_152.fa.gz";
> fl = basename(url)
> download.file(url, fl, mode="wb")
>
> It's small enough that it can be read in to memory.
>
> library(Biostrings)
> dna = readDNAStringSet(fl)
>
> but it would be convenient to have quick random access to to the
> sequences, so I exported it to "2bit' format
>
> library(BSgenome); library(rtracklayer)
> twobit = TwoBitFile(sub(".gz", ".2bit", fl)))
> export(dna, twobit)
>
> and then I have ready access to the sequences, e.g.,
>
> > seqinfo(twobit)
> Seqinfo object with 2106 sequences from an unspecified genome:
> seqnames seqlengths isCircular genome
> scaffold_15387533
> scaffold_24973254
> scaffold_34236991
> scaffold_44046325
> scaffold_53779828
> ... .........
> scaffold_11864 1003
> scaffold_11874 1002
> scaffold_11881 1000
> scaffold_11890 1000
> scaffold_11893 1000
> > query = GRanges("scaffold_109", IRanges(seq(1, 1000, by=100), width=50))
> > getSeq(twobit, query)
> A DNAStringSet instance of length 10
> width seq
> [1]50 GTTACAGATTGGTAAGATCTTGTAGAGGCTCACTCTGGGCATATAT
> [2]50 AAATTGATAGTATAAGAGAAGGAAATTCTTTCAAGAGACAAATTTG
> [3]50 TACAATATTGGAAGAATGAGGA
> [4]50 CATATTTAAAGGGAGTAATTGACATGTAGTAAATGCTAAGATAGAA
> [5]50 AATATTTGATATATAATTCACTATATAATATAGTGAGAGTTAATTA
> [6]50 GTTTTGGCCATTGTTGAAGTTGAAGGTTGATAATAGTA
> [7]50 TTATTTCATTTGATAGAACATATATTATATAAATCTTATAAA
> [8]50 ATATGGATGAATGGAGATGGATGATGAAGTTCTCCATTGCTATTTCCAAA
> [9]50 TATGATCACTCTTTCAGGGCATTTAAACTTAAGAGACTAAGATCAAGAAG
> [10]50 CTTTATATATAGGCATGCTATTGATGCAAAGATATATCAGGA
> > query$seq = getSeq(twobit, query)
>
> Hope that's helpful; I might have made different decisions with a larger
> genome or on Windows, so if you re-post your question on the support forum
> (which I hope you do) it would be helpful to include that information as
> well as your intended use.
>
> Martin
>
>
>
>> On Fri, May 8, 2015 at 7:34 PM, Eric P wrote:
>>
>> Hi
>>>
>>> I have 2-3 genomes that are not listed that I would like to use with
>>> bioconductor and I do not really understand how to prepare one properly.
>>> I
>>> know you have to use BSforge, but after that I need some help. One of the
>>> genomes is *Physcomitrella patens*, which is actually being updated at
>>> the
>>> moment, so I am waiting for version 3.1 to come out, but if someone has
>>> time they could add version 1.6 or 3.0.
>>> However, the other two genomes I have to do myself as they will not be
>>> published for a while so I could just as well try a third. Any help would
>>> be appreciated, thanks. Also, if this was already posted I apologize but
>>> I
>>> could not find enou
[Bioc-devel] Bioconductor build system using old commit
Good day. I have made updates to my package, slinky. I pushed my changes both to my github rep, and the Bioconductor git repository. My remotes are set up as follows: > git remote -v origin https://github.com/vanandelinstitute/slinky (fetch) origin https://github.com/vanandelinstitute/slinky (push) upstream g...@git.bioconductor.org:packages/slinky.git (fetch) upstream g...@git.bioconductor.org:packages/slinky.git (push) Following directions here: https://bioconductor.org/developers/how-to/git/maintain-github-bioc/ I then did git fetch upstream git merge upstream/master git push origin master But on the build system (https://bioconductor.org/checkResults/3.13/bioc-LATEST/) where errors are being encountered, the git_last_commit shows an old commit and commit date. Do I have the wrong remote? Or is there another mistake I am making? -Eric [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
[Bioc-devel] Deprecation of dualKS and Slinky packages
Colleagues, As I am now focused entirely on clinical and administrative duties at my institution, I would like to deprecate the following packages: dualKS slinky Please advise on next steps. Thank you! -Eric [[alternative HTML version deleted]] ___ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
