Hello everyone, I am not sure if this should go on the general R mailing list (for example, if there is a text mining solution that might work here) or the bioconductor mailing list (since I wasn't able to find a solution to my question on searching their lists) - so this time I tried both, and in the future I'll know better (in case it should go to only one of the two).
The task I'm trying to achieve is to align several sequences together. I don't have a basic pattern to match to. All that I know is that the "True" pattern should be of length "30" and that the sequences I'm looking at, have had missing values introduced to them at random points. Here is an example of such sequences, were on the left we see what is the real location of the missing values, and on the right we see the sequence that we will be able to observe. My goal is to reconstruct the left column using only the sequences I've got on the right column (based on the fact that many of the letters in each position are the same) Real_sequence The_sequence_we_see 1 CGCAATACTAAC-AGCTGACTTACGCACCG CGCAATACTAACAGCTGACTTACGCACCG 2 CGCAATACTAGC-AGGTGACTTCC-CT-CG CGCAATACTAGCAGGTGACTTCCCTCG 3 CGCAATGATCAC--GGTGGCTCCCGGTGCG CGCAATGATCACGGTGGCTCCCGGTGCG 4 CGCAATACTAACCA-CTAACT--CGCTGCG CGCAATACTAACCACTAACTCGCTGCG 5 CGCACGGGTAAGAACGTGA-TTACGCTCAG CGCACGGGTAAGAACGTGATTACGCTCAG 6 CGCTATACTAACAA-GTG-CTTAGGC-CTG CGCTATACTAACAAGTGCTTAGGCCTG 7 CCCA-C-CTAA-ACGGTGACTTACGCTCCG CCCACCTAAACGGTGACTTACGCTCCG Here is an example code to reproduce the above example: ATCG <- c("A","T","C","G") set.seed(40) original.seq <- sample(ATCG, 30, T) seqS <- matrix(original.seq,200,30, T) change.letters <- function(x, number.of.changes = 15, letters.to.change.with = ATCG) { number.of.changes <- sample(seq_len(number.of.changes), 1) new.letters <- sample(letters.to.change.with , number.of.changes, T) where.to.change.the.letters <- sample(seq_along(x) , number.of.changes, F) x[where.to.change.the.letters] <- new.letters return(x) } change.letters(original.seq) insert.missing.values <- function(x) change.letters(x, 3, "-") insert.missing.values(original.seq) seqS2 <- t(apply(seqS, 1, change.letters)) seqS3 <- t(apply(seqS2, 1, insert.missing.values)) seqS4 <- apply(seqS3,1, function(x) {paste(x, collapse = "")}) require(stringr) # library(help=stringr) all.seqS <- str_replace(seqS4,"-" , "") # how do we allign this? data.frame(Real_sequence = seqS4, The_sequence_we_see = all.seqS) I understand that if all I had was a string and a pattern I would be able to use library(Biostrings) pairwiseAlignment(...) But in the case I present we are dealing with many sequences to align to one another (instead of aligning them to one pattern). Is there a known method for doing this in R? Thanks, Tal ----------------Contact Details:------------------------------------------------------- Contact me: tal.gal...@gmail.com | 972-52-7275845 Read me: www.talgalili.com (Hebrew) | www.biostatistics.co.il (Hebrew) | www.r-statistics.com (English) ---------------------------------------------------------------------------------------------- [[alternative HTML version deleted]] ______________________________________________ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.