On 2010-02-12, PeroMHC <macma...@gmail.com> wrote: > Hi All, I have a simple problem that I hope somebody can help with. I > have an input file (a fasta file) that I need to edit.. > > Input file format > >>name 1 > tactcatacatac >>name 2 > acggtggcat >>name 3 > gggtaccacgtt > > I need to concatenate the sequences.. make them look like > >>concatenated > tactcatacatacacggtggcatgggtaccacgtt
(echo "concantenated>"; grep '^ [actg]*$' inputfile | tr -d '\n'; echo) > outputfile -- Grant -- http://mail.python.org/mailman/listinfo/python-list
