Your message dated Fri, 11 Apr 2003 16:47:56 -0400 with message-id <[EMAIL PROTECTED]> and subject line Bug#33696: fixed in biomode 1.002-7 has caused the attached Bug report to be marked as done.
This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what I am talking about this indicates a serious mail system misconfiguration somewhere. Please contact me immediately.) Debian bug tracking system administrator (administrator, Debian Bugs database) -------------------------------------- Received: (at submit) by bugs.debian.org; 22 Feb 1999 09:03:54 +0000 Received: (qmail 7136 invoked from network); 22 Feb 1999 09:03:53 -0000 Received: from nefertiti.pasteur.fr (157.99.64.20) by master.debian.org with SMTP; 22 Feb 1999 09:03:53 -0000 Received: from ezili.sis.pasteur.fr ([EMAIL PROTECTED] [157.99.60.56]) by nefertiti.pasteur.fr (8.9.1/8.9.1) with ESMTP id KAA03826 for <[EMAIL PROTECTED]>; Mon, 22 Feb 1999 10:03:46 +0100 (MET) Received: from ezili.sis.pasteur.fr ([EMAIL PROTECTED] [127.0.0.1]) by ezili.sis.pasteur.fr (8.9.3/8.9.3/Debian/GNU) with ESMTP id KAA16179 for <[EMAIL PROTECTED]>; Mon, 22 Feb 1999 10:03:49 +0100 Message-Id: <[EMAIL PROTECTED]> X-Mailer: exmh version 2.0.2 2/24/98 (debian) From: Stephane Bortzmeyer <[EMAIL PROTECTED]> To: [EMAIL PROTECTED] Subject: biomode does not bytecompile Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit Date: Mon, 22 Feb 1999 10:03:48 +0100 Sender: [EMAIL PROTECTED] Package: biomode Version: 1.002-1 The bug is upstream and has been forwarded. The following patch (untested) may help. Thanks to Frozen Rose for it. - ------- Forwarded Message Date: Wed, 17 Feb 1999 02:51:26 +0000 From: Frozen Rose <[EMAIL PROTECTED]> To: Stephane Bortzmeyer <[EMAIL PROTECTED]> Subject: Problem bytecompiling an Emacs add-on package - - --2oS5YaxWCcQjTEyO Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit In article <[EMAIL PROTECTED]>, Stephane Bortzmeyer <[EMAIL PROTECTED]> wrote: >I'm struggling with my first Emacs package, biomode ><http://evolution.bmc.uu.se/~thomas/mol_linux/biomode/>. > >Everything works fine if I do not try to bytecompile. > >Now, I add a emacsen-install script, which is installed by dh_installemacsen. >When I 'dpkg -i' the resulting package, I see the attempt to bytecompile, a >ton of errors (see the attached file) and the mode no longer works in emacs19 >(but it works fine on xemacs20): > >File mode specification error: (void-variable bio-gencode-table) > >Is it possible that a '.el' file works only when not compiled? It bombs on xemacs21 as well, although you'd be unlikely to discover this... although this seems to be due to make-hash-table being different... In general, to get read of the "free variable" errors, defvar a variable before referring to it. For example, bio-current-seq is not defvar'ed, it's just referenced several times and then setq'd and referenced at toplevel for some reason... Hmmm.... lots of temporary variables used with using "let" to declare them... tut tut! :} Especially using "buffer-name", that's evil... Once you cut down on the free variable warnings, you'll find useful ones- e.g. the interactive spec for bio-search-forward is in the wrong place (?) emacs19 doesn't allow 3 args to delete-region, apparently. Depending on them will result in "FSF Emacs lossage", byte-compiled or no. Also: While compiling bio-embl-entry-extract in file /home/steve/bio-mode.el: ** variable translation-name bound but not referenced Yup, translation-name is in the "let", but it doesn't appear to be used... I think in the invocation of make-hash-table, you mean "make-hash-table :size 64". Although this introduces a "reference to free variable :size" error. Grrr.... puthash: yarg. Maybe use cl-puthash? Some with gethash. Nope, this is severely crudulous. Well, I've hacked your elisp up so that it will compile and load into emacs19, xemacs20 and xemacs21. I'm not checking that at works at 2:47am, though. I still get these errors with emacs19: While compiling toplevel forms in file /home/steve/bio-mode.el: ** reference to free variable :size ** delete-region called with 3 args, but requires 2 While compiling bio-antiparallel-region: ** delete-region called with 3 args, but requires 2 While compiling bio-complement-region: ** delete-region called with 3 args, but requires 2 While compiling the end of the data: ** The following functions are not known to be defined: with-output-to-string, make-hash-table, replace-in-string, exec-to-string, isearch-make-extent, count, loop, return, char-to-int, substitute, cl-puthash, gethash, endp, popup-menu, add-submenu, add-menu-button It seems to me that the stuff to (require 'cl) on FSF Emacs should be surrounded with (eval-and-compile ...) but this breaks compilation for some reason (don't ask me, I'm an XEmacs person...) This is now a long and boring mail more about Emacs than Debian, so I'll take it off debian-mentors... SRH - - -- Steve Haslam Validation Engineer, ARM Limited, Cambridge, England Life's been like dragging feet through sand and never finding the promised land [queensrÿche] - - --2oS5YaxWCcQjTEyO Content-Type: text/plain; charset=us-ascii Content-Disposition: attachment; filename="bio-mode.el.patch" - - --- bio-mode.el.orig Wed Feb 17 02:22:09 1999 +++ bio-mode.el Wed Feb 17 02:48:09 1999 @@ -76,7 +76,11 @@ ;;{{{ Compatibility functions ;; Needs some Common Lisp functions - - -;;(require 'cl) + +;; sort out FSF Emacs needing 'cl package +(or (fboundp 'make-hash-table) + (require 'cl)) + ;; Check if replace-in-string is defined (cond ((null (fboundp 'replace-in-string)) (defun replace-in-string (str regexp newtext &optional literal) @@ -135,17 +139,6 @@ ;;}}} - - -;; check makehash-table, make alias if necessary (which needs Common Lisp) - - -(cond ((null (fboundp 'make-hash-table)) - - - (require 'cl))) - - -;(cond ((null (fboundp 'makehash-table)) - - -; (defalias 'makehash-table 'make-hash-table))) - - -;(fboundp 'makehash-table) - - - - - -(cond ((null (fboundp 'puthash)) - - - (defun puthash (key value table) - - - (setf (gethash key table) value)))) - - - ;; processes (cond ((null (fboundp 'exec-to-string)) (defmacro with-output-to-string (&rest forms) @@ -193,7 +186,26 @@ ;; the regex for grabbing an entry from an EMBL file (defconst bio-embl-entry "^FT [Crt][DR].*\\(\nFT .*\\)+") ;; hashtable for genetic code - - -(setf bio-gencode-table (make-hash-table 64)) +(defvar bio-gencode-table (make-hash-table :size 64)) + +(defvar bio-current-seq) +(defvar gene-direction) +(defvar gene-stop) +(defvar gene-start) +(defvar gene-length) +(defvar gene-type) +(defvar translation-name-tmp) +(defvar buffer-name) ; scary! +(defvar bio-seq-file) +(defvar seq) ; scary! +(defvar bio-aa-seq) ; scary! +(defvar entry-counter) +(defvar embl-current-entry) +(defvar bio-prompt) +(defvar bio-temp-file) +(defvar bio-command) +(defvar bio-blastp-res) +(defvar bio-acgt) ;;}}} ;;{{{ Functions @@ -411,8 +423,8 @@ (defun bio-embl-entry-extract (entry out) ;; Extracts the translation part - - - (let* ( - - - (translation-name "no_translation") + (let ( + ;(translation-name "no_translation") unused? (gene-name "no_gene") (gene-real-name "xxx") (note-name "no_note") @@ -566,8 +578,8 @@ newline, tab, space, integers.." ;; uses function from the isearch package ;; for highlighing - - - (isearch-dehighlight t) (interactive "p\nsSearch for oligo: ") + (isearch-dehighlight t) (setq oligo (bio-change-oligo oligo)) (re-search-forward oligo nil t) (isearch-make-extent (match-beginning 0) (match-end 0)) @@ -615,8 +627,8 @@ (setq gc3 (+ gc3 (bio-is-nt-gc (char-to-int (elt seq (+ counter 2)))))) (setq counter (+ counter 3)) ))) - - -(setq bio-current-seq "ATGGCAAATTCTTTCGTAAAAAGATGGT") - - -(bio-count-gc bio-current-seq) +;(setq bio-current-seq "ATGGCAAATTCTTTCGTAAAAAGATGGT") +;(bio-count-gc bio-current-seq) (defun bio-ATrich-over-GCrich-codons (seq) @@ -783,7 +795,7 @@ ) (defun bio-puthash (key val table) (let ((sym (if (stringp key) (intern key) key))) - - - (puthash sym val table))) + (cl-puthash sym val table))) (defun bio-gethash (key table &optional default) (let ((sym (if (stringp key) (intern-soft key) key))) - - --2oS5YaxWCcQjTEyO-- - ------- End of Forwarded Message --------------------------------------- Received: (at 33696-close) by bugs.debian.org; 11 Apr 2003 20:55:17 +0000 >From [EMAIL PROTECTED] Fri Apr 11 15:55:16 2003 Return-path: <[EMAIL PROTECTED]> Received: from auric.debian.org [206.246.226.45] (mail) by master.debian.org with esmtp (Exim 3.12 1 (Debian)) id 1945YK-0002C2-00; Fri, 11 Apr 2003 15:55:16 -0500 Received: from katie by auric.debian.org with local (Exim 3.35 1 (Debian)) id 1945RE-0004oA-00; Fri, 11 Apr 2003 16:47:56 -0400 From: Mario Lang <[EMAIL PROTECTED]> To: [EMAIL PROTECTED] X-Katie: $Revision: 1.33 $ Subject: Bug#33696: fixed in biomode 1.002-7 Message-Id: <[EMAIL PROTECTED]> Sender: Archive Administrator <[EMAIL PROTECTED]> Date: Fri, 11 Apr 2003 16:47:56 -0400 Delivered-To: [EMAIL PROTECTED] We believe that the bug you reported is fixed in the latest version of biomode, which is due to be installed in the Debian FTP archive: biomode_1.002-7.diff.gz to pool/main/b/biomode/biomode_1.002-7.diff.gz biomode_1.002-7.dsc to pool/main/b/biomode/biomode_1.002-7.dsc biomode_1.002-7_all.deb to pool/main/b/biomode/biomode_1.002-7_all.deb A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to [EMAIL PROTECTED], and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Mario Lang <[EMAIL PROTECTED]> (supplier of updated biomode package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing [EMAIL PROTECTED]) -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Format: 1.7 Date: Fri, 11 Apr 2003 22:07:19 +0200 Source: biomode Binary: biomode Architecture: source all Version: 1.002-7 Distribution: unstable Urgency: low Maintainer: Mario Lang <[EMAIL PROTECTED]> Changed-By: Mario Lang <[EMAIL PROTECTED]> Description: biomode - [Biology] An Emacs mode to edit genetic data Closes: 33696 100215 145589 185549 Changes: biomode (1.002-7) unstable; urgency=low . * Package adopted (Closes: Bug#100215) * Some rules cleanups, move to DH_COMPAT=4 * Depend on debhelper >> 4 and bump Standards-Version to 3.5.9 * bio-mode.el: - Change call to make-hash-table to use keywords (Closes: Bug#185549, Bug#145589) - Remove third arg from calls to delete-region - Use shell-command-to-string instead of exec-to-string - Fix several other byte-compile errors and reactivate dh_installemacsen again (Closes: Bug#33696) Files: 48fa97dd29cf5d092f2a858b1b5cccda 561 science optional biomode_1.002-7.dsc b1081aa198ea4ffe936c79d738973f45 4720 science optional biomode_1.002-7.diff.gz 200bc6ad4e828f1a47053a26767f3569 12686 science optional biomode_1.002-7_all.deb -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.2.1 (GNU/Linux) iD8DBQE+lya33/wCKmsRPkQRAnG7AJ9pCqPNvXTyz64TUeX4xJPXkZCYQwCfejP3 jHF3dSEuwOxDOwtvpoaw+6w= =GJMA -----END PGP SIGNATURE-----