Hi Jerry, You may find that pcDNA3.1 won't give you the protein yields needed for crystallization. Have a look at PMID: 17001101 for an alternative. Your Kozak sequence looks good,
radu ------------------------------------------ A. Radu Aricescu, PhD University Research Lecturer MRC Career Development Award Fellow University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 ---- Original message ---- >Date: Tue, 13 Mar 2012 19:36:30 -0700 >From: CCP4 bulletin board <CCP4BB@JISCMAIL.AC.UK> (on behalf of Jerry McCully ><for-crystallizai...@hotmail.com>) >Subject: [ccp4bb] mammalian expression vector >To: CCP4BB@JISCMAIL.AC.UK > > Dear ALL; > > As an alternative strategy to avoid endotoxin, > I plan to express the protein in mammalian cells. > > As suggested by others, the typical vector is > pcDNA3.1(+). Does anyone have comments on this > vector or recommend some other powerful vectors? > > I am new to mammalian expression. I designed a > Kozak sequence followed by a BSA signal peptide in > order to clone the target into pcDNA3.1(+). > > Is it right? Tentative Kozak sequence: > GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCTTTTCT > > Thanks a lot, > > Jerry
